ID: 1126338872

View in Genome Browser
Species Human (GRCh38)
Location 15:47617749-47617771
Sequence GGGATGGTACCTACCTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126338866_1126338872 22 Left 1126338866 15:47617704-47617726 CCTAAGGCAAGACTTCGACAGAT 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1126338872 15:47617749-47617771 GGGATGGTACCTACCTCTTAGGG 0: 1
1: 0
2: 3
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126338872 Original CRISPR GGGATGGTACCTACCTCTTA GGG Intronic