ID: 1126338872 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:47617749-47617771 |
| Sequence | GGGATGGTACCTACCTCTTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 243 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 23, 4: 216} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1126338866_1126338872 | 22 | Left | 1126338866 | 15:47617704-47617726 | CCTAAGGCAAGACTTCGACAGAT | 0: 1 1: 0 2: 0 3: 3 4: 68 |
||
| Right | 1126338872 | 15:47617749-47617771 | GGGATGGTACCTACCTCTTAGGG | 0: 1 1: 0 2: 3 3: 23 4: 216 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1126338872 | Original CRISPR | GGGATGGTACCTACCTCTTA GGG | Intronic | ||