ID: 1126340356

View in Genome Browser
Species Human (GRCh38)
Location 15:47634728-47634750
Sequence ATTCCCTGCCTGACAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126340356_1126340357 2 Left 1126340356 15:47634728-47634750 CCTCTGTCTGTCAGGCAGGGAAT 0: 1
1: 0
2: 2
3: 22
4: 184
Right 1126340357 15:47634753-47634775 AAGATCAGTTTCCGTGTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 92
1126340356_1126340360 19 Left 1126340356 15:47634728-47634750 CCTCTGTCTGTCAGGCAGGGAAT 0: 1
1: 0
2: 2
3: 22
4: 184
Right 1126340360 15:47634770-47634792 CCATGGACAGCACCATAGTGAGG 0: 1
1: 0
2: 2
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126340356 Original CRISPR ATTCCCTGCCTGACAGACAG AGG (reversed) Intronic
900173823 1:1283320-1283342 CTTCCCTGGCTGACAGACACTGG - Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901021469 1:6258067-6258089 CTTCCCTGCCCGAGAGCCAGGGG - Intronic
904909324 1:33922179-33922201 ATTCCCTGCCTCACAGTCTCTGG - Intronic
906553674 1:46689364-46689386 TTTCCCTGCATGTCAGTCAGTGG - Intronic
908661455 1:66440125-66440147 ATTCCCTACTTGAAAGGCAGAGG + Intergenic
911323767 1:96445153-96445175 ATTGCCTGAGTGACAGACAGGGG - Intergenic
915699192 1:157774659-157774681 ATTTCCATCCAGACAGACAGTGG + Intronic
915744130 1:158143116-158143138 AGTTCCTGCCTAACAGATAGGGG + Intergenic
916314756 1:163436809-163436831 ACTCCCTGCAGGCCAGACAGGGG + Intergenic
918854639 1:189735466-189735488 ATTCTCTGACTGACATACACTGG + Intergenic
923260511 1:232263741-232263763 TTGCTCTGCCTGACAGATAGGGG + Intergenic
923648806 1:235852315-235852337 TCTCCCTCCCTGACAGGCAGGGG - Intronic
1064549589 10:16485507-16485529 ATTGCCTGCATGACAGGCATAGG + Intronic
1066354621 10:34670323-34670345 ATCACCTGCCTGAGAGCCAGCGG - Intronic
1067230357 10:44403011-44403033 ACTCCCTGCCTGCCACACACTGG - Intergenic
1070568507 10:77622097-77622119 TTTCTCTACCTGACAGGCAGTGG - Intronic
1071100944 10:82037079-82037101 ATACCCTGCCTGACTCAGAGGGG - Intronic
1073447905 10:103592081-103592103 ATGCCCTGCCTGCCACACAGAGG - Exonic
1076117354 10:127909442-127909464 ATTCCCTCCCTGAAGGCCAGAGG + Intronic
1077373827 11:2195896-2195918 ATGCCCTGACTCACAGGCAGGGG - Intergenic
1078467415 11:11560467-11560489 GTTCCCAGCCTTACAGACATTGG - Intronic
1079105356 11:17568728-17568750 ATTTCCTGCCTGCCTGTCAGTGG + Intronic
1079541920 11:21586956-21586978 CTTCCCTGACTGACACACAGTGG - Intergenic
1083122387 11:60527494-60527516 ACTCCCTCCCTGACTGAAAGCGG - Intronic
1084937335 11:72594132-72594154 ACTCCATGCCTGACATACAGTGG + Intronic
1085267953 11:75248539-75248561 ATTCCCAGCCTGGGTGACAGAGG - Intergenic
1087806646 11:102562616-102562638 ATTGCTTGCCTGGGAGACAGAGG + Intergenic
1089347203 11:117797892-117797914 CTTTCCTGCCTGACAGAAATTGG + Intronic
1090711263 11:129387902-129387924 TTTCCCTGCCTGAAAAGCAGTGG - Intronic
1091123070 11:133073107-133073129 ATTACCTGCCTGAGGGACGGAGG + Intronic
1091180806 11:133602708-133602730 ATTCCCTGGCTGAAGGACATTGG + Intergenic
1093137595 12:15471034-15471056 ATTACCTGCCTGACAGTAATTGG + Intronic
1094009007 12:25786663-25786685 AATACATGCCTGACAGACATGGG + Intergenic
1095146665 12:38738128-38738150 ATTATCTTCCTGACAGACTGAGG + Intronic
1095323282 12:40856717-40856739 TTTCCCTGCCTGACATACTTTGG - Intronic
1095518911 12:43038513-43038535 ATGGCCTGCCTGAAAGACAAGGG - Intergenic
1096407992 12:51357673-51357695 GTTCCCTGCCTGCCCCACAGAGG - Intronic
1097178462 12:57156999-57157021 TCTCCCTGCATGTCAGACAGAGG - Intronic
1097796049 12:63863078-63863100 ATTTACTTCATGACAGACAGTGG + Intronic
1102014721 12:109640343-109640365 AGTCCCTGCCAGCCAGGCAGCGG - Intergenic
1102731394 12:115114003-115114025 AGCTCCTGCCTGACAAACAGTGG - Intergenic
1102777203 12:115530919-115530941 AATCCCTGCCTCACATACGGTGG + Intergenic
1103084155 12:118049148-118049170 ATTCCCTACCTGAAATACAAGGG - Intronic
1104390653 12:128388302-128388324 ATTCGCTGCCTGGCAGCCATCGG - Intronic
1104571412 12:129929483-129929505 ATTCCCTGCTTGAAACTCAGAGG - Intergenic
1105650995 13:22377878-22377900 ATTACCTGCCTAACAGAGGGAGG + Intergenic
1106157562 13:27171974-27171996 ATGCCCGGCCTGCCAGGCAGCGG + Intergenic
1107455010 13:40546678-40546700 TTTCCCTGCCTGACCTACTGTGG - Intergenic
1107566188 13:41607194-41607216 AATACCTGCCTGGCACACAGTGG + Intronic
1108570151 13:51741562-51741584 GTTCCCTGCCTGCCTGAAAGTGG - Intronic
1110068667 13:71143840-71143862 ATTCCCTGCCTCACTGGCATTGG - Intergenic
1111831711 13:93338482-93338504 AATCACTGCCTGAAAAACAGTGG - Intronic
1113444069 13:110352200-110352222 CCTCCCTGCCTGACAGCCTGAGG - Intronic
1115994494 14:39181754-39181776 ATTCCCGGTCCGACAGAAAGAGG + Exonic
1116822777 14:49641614-49641636 TTTCCCTGCCTTACAGGCATAGG - Intergenic
1118607506 14:67514767-67514789 TTTCCCTGCCTGAAACAAAGGGG - Intronic
1121766814 14:96494860-96494882 AGTCCCTGGGTGACAGAGAGAGG - Intergenic
1122858094 14:104569591-104569613 ATTCCCTGCCTGGCAGACACCGG - Intronic
1122892283 14:104738358-104738380 GTTGCCTGCATGAGAGACAGAGG - Exonic
1122987325 14:105218485-105218507 GTTCCCTGCCTGCGAGACTGGGG - Intronic
1126340356 15:47634728-47634750 ATTCCCTGCCTGACAGACAGAGG - Intronic
1126703780 15:51389025-51389047 ATTCCCTGCCTTCAAGGCAGAGG + Intronic
1127759642 15:62125926-62125948 ATTCTCAGACAGACAGACAGAGG + Intergenic
1128462585 15:67882500-67882522 ATTTCCTGCCTTACAAGCAGGGG - Intergenic
1130011554 15:80156483-80156505 ACTCCCAGCCTGACATAGAGGGG - Intronic
1132126875 15:99235212-99235234 AACCCCAGCCTGAGAGACAGAGG + Intronic
1135630733 16:24034175-24034197 TGTCCCTGCCTCAGAGACAGTGG + Intronic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140969938 16:80003128-80003150 ATTCCCTGCCTTATAATCAGAGG + Intergenic
1142285171 16:89168692-89168714 AGGCCCTGCCTGTCAGACAGGGG + Intergenic
1142323079 16:89397437-89397459 ACTCCCTGCCAGCCACACAGGGG + Intronic
1143555656 17:7658208-7658230 TTAACGTGCCTGACAGACAGCGG - Intergenic
1144293065 17:13845193-13845215 CTTGCCTGCCTGACAAACAGGGG + Intergenic
1146512643 17:33463485-33463507 ATTCACTGACTGACAGACATTGG - Intronic
1146805858 17:35864652-35864674 AGTCCTTGCCTGAAAAACAGAGG - Intronic
1148476291 17:47930900-47930922 ATTCCATGCCTGGAAGAAAGAGG + Intergenic
1150497078 17:65616196-65616218 AATCAGTGCCTGACACACAGAGG + Intronic
1152550667 17:81028387-81028409 TCTCCCTGCCTTAGAGACAGTGG + Intergenic
1154340965 18:13501752-13501774 ATTCCCTGGCTCTCAGAGAGAGG - Intronic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1156968568 18:43127262-43127284 CTCCCCTGTCTGAGAGACAGGGG + Intergenic
1158780180 18:60639523-60639545 AGTCCCTGTGTGAAAGACAGAGG - Intergenic
1158984196 18:62797293-62797315 ATTCAATACCTGACACACAGTGG - Intronic
1160171790 18:76561441-76561463 CTTCCCTGCCTCAGAGGCAGAGG + Intergenic
1162439191 19:10682261-10682283 ATGCCCTCCCTGAGAGACAATGG - Intronic
1164427028 19:28150612-28150634 CTTTGCTGCCTAACAGACAGTGG - Intergenic
1164792639 19:31001382-31001404 CTTGCCTGCCTGCCGGACAGAGG - Intergenic
1164845007 19:31424567-31424589 TTTCTCTGCCTGGCAGACATAGG - Intergenic
1165392776 19:35547895-35547917 ATCCCCTGGCTGCCATACAGAGG - Intergenic
1165636148 19:37341854-37341876 ATTCCCTACCTAACATACAGTGG + Intronic
926195984 2:10763762-10763784 TTTCCCTACCTGAGACACAGCGG - Intronic
927885527 2:26715932-26715954 ATTCTCTCCCTCACAAACAGTGG - Intronic
928096356 2:28407378-28407400 ATCCCATGCCTGTCACACAGAGG - Intronic
929212914 2:39378115-39378137 ATTCCGTGCCTAAAAGAAAGAGG + Exonic
929953091 2:46431814-46431836 ACTGCCTGCCTTACAGACAGAGG + Intronic
936529467 2:113265756-113265778 ACTCCCTGCCTGCCACACTGAGG + Intronic
939048283 2:137275960-137275982 ATTCCCTGCCAGACAGACTCTGG - Exonic
940256692 2:151738567-151738589 ATTCCCAGAATGAAAGACAGTGG - Intergenic
941621192 2:167781639-167781661 ATTCCCTGCCTGAGAGGGAAAGG - Intergenic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
944163974 2:196697365-196697387 GTTCCCTGCGTGACTGCCAGTGG - Intronic
944442780 2:199759460-199759482 ATTCCTAGCCTGCCAAACAGAGG + Intergenic
946194624 2:218025652-218025674 GATCCCTGCCTGGGAGACAGGGG + Intergenic
946308308 2:218868576-218868598 ATTCCCTGCCTGATTCCCAGTGG + Intronic
946724631 2:222650272-222650294 ATTGCCTGCCTGTAAGAAAGAGG - Intronic
1169198831 20:3697780-3697802 ATTCCCTGCCTGACTCACCCTGG + Exonic
1170711450 20:18794788-18794810 CTTGCCTCCCTGACAGACACTGG + Intergenic
1172415958 20:34768090-34768112 ATTCTCTGCCTCAGAGAAAGTGG + Intronic
1173759667 20:45548396-45548418 TTTTCCTACATGACAGACAGAGG + Intergenic
1173974128 20:47174434-47174456 ACTCCATGCCTGATACACAGCGG + Intronic
1174264840 20:49323793-49323815 CTTCCCAGCCTTACAGAAAGGGG - Intergenic
1175263390 20:57688598-57688620 GTTCCCTGCCTGGCAGAGTGAGG - Intronic
1178927105 21:36785295-36785317 AAGCCCTGCCTGAAAGAAAGAGG - Intronic
1184552274 22:45210749-45210771 ATTCCCTGCCTGCCCGAGTGTGG + Intronic
1185377181 22:50487996-50488018 CTTCCATGCCTTCCAGACAGCGG + Exonic
950131925 3:10553329-10553351 GTTCCATGCCTGACACAGAGAGG + Intronic
950981265 3:17307633-17307655 ATTCCCTACCTGTCAGAAGGTGG + Intronic
954579098 3:51693390-51693412 ATTCCCTGCCTTTCAGCCGGTGG + Intronic
956601207 3:71024552-71024574 ATTCCCTGCGTGAGAGAGAAAGG - Intronic
957447018 3:80326134-80326156 ATTCCGTGCCTCACATCCAGGGG - Intergenic
959938384 3:112054429-112054451 TTAACCTGCTTGACAGACAGAGG - Intronic
960288118 3:115852609-115852631 ATTCCCTTCCTGAAAAACAGAGG + Exonic
961001061 3:123374320-123374342 CTTCCCATCCTGGCAGACAGTGG - Intronic
964019336 3:151989274-151989296 ATGTCCTGCATGACACACAGAGG - Intergenic
965403458 3:168241641-168241663 ACTCTCTGCATGACACACAGAGG + Intergenic
967154677 3:186681569-186681591 AATCCCTGCCTGACTGAAATAGG - Intergenic
968481163 4:833662-833684 AATACCTGGCTGGCAGACAGTGG - Intergenic
968879224 4:3290666-3290688 CTTCCGTGCCTGCCAGGCAGCGG - Intergenic
970832410 4:20357120-20357142 ATTTCCAGGCTGAAAGACAGTGG - Intronic
972845676 4:42986347-42986369 ATTTCCTGCAAGACAGACATAGG - Intronic
974239282 4:59224938-59224960 ATGCCCTGCCTAACAGAAATAGG + Intergenic
976063873 4:81161613-81161635 ATTTCCTTACTGACTGACAGTGG + Intronic
980248806 4:130285470-130285492 ATTACCCGCCTGACATACTGTGG - Intergenic
981544886 4:145883739-145883761 TTTCCTTACCTAACAGACAGGGG - Intronic
982937107 4:161494278-161494300 ATTCCCTTTCTGAAAGACAGTGG + Intronic
984892369 4:184505040-184505062 CTTCCCTTCCTGACTGCCAGCGG + Intergenic
984983248 4:185302903-185302925 ATTCCCTGCCTGAAGGTCTGTGG + Intronic
985844436 5:2334011-2334033 AATCACTCCCTGCCAGACAGAGG + Intergenic
986001695 5:3635499-3635521 ATTCGCTGCATTGCAGACAGCGG - Intergenic
987419845 5:17706559-17706581 ATTTACTGCCTAACACACAGTGG - Intergenic
987906550 5:24085176-24085198 CTTCCCTTACTGAAAGACAGAGG + Intronic
987998755 5:25321020-25321042 ATTCCCTGCCTGACTGTTACAGG + Intergenic
990311950 5:54548667-54548689 ACTCCCTCCATGACAGACATGGG + Intergenic
990598290 5:57332666-57332688 ATTCCCTGGCAGAAAGAAAGTGG + Intergenic
995225766 5:109699156-109699178 ATTCCTTGACTGACAGAGTGGGG - Intronic
995697570 5:114897723-114897745 ATTCTGTGCCTGAAAGAAAGAGG - Intergenic
995990648 5:118234700-118234722 ATTCCCAGTCTCACAGACAGGGG - Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
999170570 5:149590679-149590701 ATTCTCTGCCTGGGAGGCAGAGG - Intronic
999497020 5:152109058-152109080 AGACCATTCCTGACAGACAGGGG + Intergenic
1000257215 5:159551444-159551466 ATTTCCTGCCTGACAAGCAGAGG - Intergenic
1000875862 5:166637548-166637570 ATTCCATGCCTGTCAGTGAGTGG + Intergenic
1000981264 5:167819549-167819571 AGTCCCTGCTTGGCAGGCAGAGG - Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001387393 5:171351221-171351243 ATTCCCAGGCTTCCAGACAGTGG - Intergenic
1002137373 5:177116308-177116330 TTTCCCTGCCTGACAAACAAAGG - Intergenic
1003134824 6:3426940-3426962 ATGCCCTTCCTCAGAGACAGTGG - Intronic
1004412936 6:15398586-15398608 CTTCCTGGCCTGACAGACACAGG + Intronic
1004720300 6:18263316-18263338 TTTCCCTCCCTGGCAAACAGCGG - Intronic
1005426629 6:25709805-25709827 ATTCCCTGCGAGAAAGACAAGGG - Intergenic
1005609712 6:27512126-27512148 ATTCCCTGCATGAAAGACACTGG - Intergenic
1006445951 6:34079901-34079923 ATTCCCTGCACAACAGCCAGAGG + Intronic
1007235732 6:40390410-40390432 AACCCCTCCCTGCCAGACAGTGG - Intergenic
1008536459 6:52509677-52509699 AGTCCCCACCTGACAGAAAGAGG + Intronic
1010519746 6:76818257-76818279 CTTTCCTGAGTGACAGACAGAGG - Intergenic
1012921139 6:105222059-105222081 ATTCCCTCCCTGACCTACACTGG - Intergenic
1016417732 6:143850794-143850816 AGGCCCTGCCACACAGACAGTGG - Intronic
1020766656 7:12330387-12330409 ATTCCCAGCCTTACAAAAAGTGG - Intergenic
1023728148 7:43164973-43164995 ATTCCCTGACTCAGAGAGAGAGG - Intronic
1023735319 7:43230999-43231021 ATTCCCTACAGAACAGACAGAGG - Intronic
1024001265 7:45190762-45190784 ATCCACTGCATGACTGACAGAGG - Intergenic
1028101303 7:86824092-86824114 CTTCACTGGCTGACTGACAGAGG - Intronic
1029859134 7:103550682-103550704 TCTCCCTGCATGACAGACATAGG + Intronic
1032480158 7:132239614-132239636 ATACCTTGCCAGGCAGACAGGGG - Intronic
1035105546 7:156439453-156439475 AGTCACTGACTGGCAGACAGTGG + Intergenic
1037604424 8:20425498-20425520 ATTCCCTGCCTGGCTGCCTGAGG + Intergenic
1037841576 8:22248936-22248958 ACTCCCTGGCTGAGTGACAGTGG + Intronic
1039659663 8:39448633-39448655 ATCCCCAGCCTGACAGCCACAGG + Intergenic
1040822854 8:51584301-51584323 ATTCCCTGCCTTACAGAGTGGGG - Intronic
1042029322 8:64458006-64458028 ATTCCCTGCCTGACACTCAGTGG + Intergenic
1042116908 8:65442316-65442338 ATTCCAGGCCTAACAGACACTGG + Intergenic
1042200295 8:66274770-66274792 CTCCCCTGCCTGACAGCCACCGG + Intergenic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1045034937 8:98169553-98169575 ATTCCCTGGCTGAAAGACCTCGG + Intergenic
1045508931 8:102798478-102798500 CCTCCCAGCCTGACAGTCAGGGG - Intergenic
1045525697 8:102939873-102939895 TTTCCCTACCTGAAAAACAGGGG + Intronic
1047547319 8:125831376-125831398 AGTGCCTGCCTGACTGACAGTGG + Intergenic
1050771020 9:9200088-9200110 ATTTCCTCGCTAACAGACAGTGG - Intronic
1050932629 9:11349336-11349358 ATCCACAGCCTGACAGACAGTGG + Intergenic
1055730706 9:79277152-79277174 ATTCCCAGCCTGGGTGACAGAGG - Intergenic
1056042257 9:82680499-82680521 TTTCCCTGGCAAACAGACAGGGG - Intergenic
1060709605 9:125845551-125845573 ATTCCCTGCCTGCCCTACAAGGG + Intronic
1060732929 9:126049480-126049502 GACCCCTGCCTCACAGACAGGGG - Intergenic
1061056728 9:128226709-128226731 AATCCGTGCGTGAGAGACAGGGG + Intronic
1185723463 X:2400558-2400580 ATTCAGTGCCTGAAACACAGTGG - Intronic
1185826040 X:3250631-3250653 ATTCTGTGACTGACAAACAGTGG - Intergenic
1187595533 X:20767797-20767819 ATTCCCTGCTTGAAAGAAAGAGG + Intergenic
1189222661 X:39385526-39385548 ATTCTCTGCCCAACAGGCAGAGG + Intergenic
1190995977 X:55609627-55609649 ATTCCCTGTCTGTCACACAGAGG + Intergenic
1192682797 X:73268900-73268922 GGTCCCAACCTGACAGACAGAGG - Intergenic
1195832871 X:109078704-109078726 ATTCCCTGGCAGACATTCAGGGG + Intergenic
1196041094 X:111205064-111205086 ATTTCTTGACTGACAGACATCGG - Intronic
1197720408 X:129741015-129741037 AATCCCTCCCTAAAAGACAGGGG + Intronic
1197934957 X:131730243-131730265 ATTCCCTGGATGCCTGACAGGGG - Intergenic
1197935403 X:131735228-131735250 ATTCCCTGGATGCCTGACAGGGG - Intergenic
1197984260 X:132250623-132250645 ATTCCCTCGCTGTCAGTCAGAGG - Intergenic
1198716013 X:139558393-139558415 ATCCCCTGCCTGCCAGCCACAGG - Intronic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic