ID: 1126341156

View in Genome Browser
Species Human (GRCh38)
Location 15:47642529-47642551
Sequence CTAGACAGTGAAGCCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 2, 3: 58, 4: 373}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126341156_1126341160 -9 Left 1126341156 15:47642529-47642551 CCCTCAAAGGCTTCACTGTCTAG 0: 1
1: 1
2: 2
3: 58
4: 373
Right 1126341160 15:47642543-47642565 ACTGTCTAGTTGGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1126341156_1126341162 11 Left 1126341156 15:47642529-47642551 CCCTCAAAGGCTTCACTGTCTAG 0: 1
1: 1
2: 2
3: 58
4: 373
Right 1126341162 15:47642563-47642585 AGGCTTGCACACATCTAGATAGG 0: 1
1: 0
2: 3
3: 15
4: 102
1126341156_1126341163 22 Left 1126341156 15:47642529-47642551 CCCTCAAAGGCTTCACTGTCTAG 0: 1
1: 1
2: 2
3: 58
4: 373
Right 1126341163 15:47642574-47642596 CATCTAGATAGGAGCAATGTAGG 0: 1
1: 0
2: 0
3: 13
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126341156 Original CRISPR CTAGACAGTGAAGCCTTTGA GGG (reversed) Intronic
901013507 1:6214149-6214171 CGAGAGAGCGATGCCTTTGAAGG - Intronic
902126817 1:14221049-14221071 CTAGACAGTGAACTCCTTGGGGG - Intergenic
902145429 1:14394971-14394993 CTAGGCAGTGATCTCTTTGAAGG + Intergenic
902308506 1:15562293-15562315 CCAGACAGTGAGGCGTTTCAAGG + Exonic
904210265 1:28882629-28882651 CTAGGCAGTGGGGCCTTTCAGGG + Intergenic
904308212 1:29604435-29604457 CTAGAGAGTGCAGCATTTCAAGG - Intergenic
905017911 1:34790240-34790262 TTAGACTGTGAGCCCTTTGAGGG - Intronic
905853298 1:41290234-41290256 CTAGGCAGGGAAGCCTGTGCAGG + Intergenic
906239728 1:44235474-44235496 CTAGACCATGAACTCTTTGAGGG + Intronic
906946558 1:50299660-50299682 CCAGACTGTGAATCCTTTGAAGG + Intergenic
906947594 1:50308600-50308622 ATAGTCAGTGAAGCCTTTCAGGG - Intergenic
906953782 1:50355654-50355676 ATAGACAGTGATTCCTCTGATGG + Intergenic
907282478 1:53360134-53360156 CTAGACAGTGAGGGCCATGAGGG + Intergenic
908965669 1:69759331-69759353 CTAAACAGTAAGGCCTTTCAGGG - Intronic
909491126 1:76227427-76227449 CTAGACAGTGAAGCACTTGAGGG + Intronic
909631283 1:77772179-77772201 CTATCTAGAGAAGCCTTTGATGG - Intergenic
911038712 1:93575540-93575562 CTAGACAGTGTTTTCTTTGAGGG - Intronic
912473309 1:109920673-109920695 CTAGGCTGTGAAGTCCTTGAAGG - Intronic
912525013 1:110276125-110276147 ATAGACACTGAAGACTCTGAAGG + Intronic
912954214 1:114142138-114142160 ATAGACAGTGATTCCTCTGATGG + Intronic
914870801 1:151472301-151472323 CTAGACAGTGGAACTTTTTAAGG - Intergenic
915631352 1:157155710-157155732 GTTGACTGTGAAGCCTTTGCTGG - Intergenic
916657923 1:166893942-166893964 CTAGACTGTGAGCCCCTTGAGGG - Intergenic
917119907 1:171636365-171636387 CGAGACAGTGAAGGCTGAGAAGG - Exonic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
918299433 1:183189261-183189283 TTAGACAGTGATGCCATTAAAGG + Intronic
918498279 1:185163951-185163973 ATAGACAGTGATTCCTCTGATGG - Intronic
918675918 1:187285944-187285966 ATAGACAATGAAGACTTAGAAGG - Intergenic
919054992 1:192559495-192559517 CTAGACAGTGATTCCTCTGGTGG + Intergenic
919628631 1:199937256-199937278 CTAGACTGTGAACTCCTTGAGGG + Intergenic
920131753 1:203737406-203737428 CCTGACAGTGATGGCTTTGATGG + Intronic
920192439 1:204202205-204202227 GTAGGCAGTGGAGCCTCTGAAGG - Intronic
920887661 1:209947275-209947297 ATAGATAGTGATTCCTTTGATGG + Intronic
921231412 1:213076043-213076065 CTAGACTGTGAACTCTTTGAAGG + Intronic
922010128 1:221575165-221575187 CTAGACAGGGAAGCTATTGGTGG - Intergenic
922727853 1:227932589-227932611 ATAGACAGTGATTCCTCTGATGG - Intronic
924161541 1:241238067-241238089 CTAGCCTGTGAGGCCTTTGAGGG - Intronic
924819811 1:247478472-247478494 ATAGACAGTGAAGCCTCAGAAGG - Intergenic
924841424 1:247713677-247713699 AAAGACAGTGAAGACTTTGGCGG + Intergenic
1062995761 10:1865013-1865035 ATAGACAGTGAGTCCTCTGATGG + Intergenic
1063264514 10:4433092-4433114 ATAGACAGTGATTCCTCTGATGG - Intergenic
1064030898 10:11881987-11882009 CTAGACTGTGAGGCCTGTGTGGG - Intergenic
1064615600 10:17152581-17152603 CTAGCCAGGGAAGCATTCGAGGG + Intronic
1066625629 10:37402569-37402591 CTAGACAGGGAGGCGTTTAAGGG + Intergenic
1070583836 10:77746133-77746155 CTAGACAGTTGGCCCTTTGAAGG + Intergenic
1070698713 10:78583107-78583129 CTAGAAAGTGAAGTATTTGGGGG - Intergenic
1071662881 10:87523267-87523289 ATAGACAGTGATGCCTTTAATGG - Intronic
1072640195 10:97205838-97205860 CTAGACTGTGAACTCTCTGAGGG - Intronic
1072784671 10:98271573-98271595 CTAGACAGTGAGCTCCTTGAGGG - Intergenic
1074079418 10:110156067-110156089 CTAGATTGTGAACCCTTGGAGGG - Intergenic
1074768609 10:116718680-116718702 CTAGGCAGTGCAGCCCTTCAAGG - Intronic
1075412900 10:122242096-122242118 GTAGAGCGTGAAGCCTTTCAGGG + Intronic
1075716190 10:124557175-124557197 CCAGAAAGTGAAGTCTCTGATGG - Intronic
1076628309 10:131835147-131835169 CTTGAGAGTGGTGCCTTTGATGG - Intergenic
1077755396 11:5023607-5023629 ATAGACAGTGATTCCTCTGATGG - Intergenic
1078601541 11:12735791-12735813 CTGGACTGTGAAATCTTTGAGGG + Intronic
1078688011 11:13550778-13550800 CGAGACAGTGATGCTTTTTAGGG + Intergenic
1079360392 11:19765895-19765917 CTAGAGAGAGAAGCCACTGAGGG - Intronic
1079533438 11:21482652-21482674 CTAGACACTGAACTCTTTGAGGG + Intronic
1080021086 11:27560861-27560883 CCAGATTCTGAAGCCTTTGAGGG + Intergenic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1080924987 11:36747028-36747050 CTGGACAGTGGAGCCATAGAAGG - Intergenic
1081780661 11:45709277-45709299 CTAGACTGTGAATTCTTTGAAGG - Intergenic
1081801232 11:45860750-45860772 CCAGACTCTGAAGGCTTTGAGGG - Intronic
1082686467 11:56244509-56244531 TTAGATAGTGATTCCTTTGATGG - Intergenic
1084113801 11:67030278-67030300 CTTGACAGTGAAGACATTAATGG - Intronic
1085825855 11:79846604-79846626 CTTGAGAGTGAGGCCTTTGCTGG - Intergenic
1086006280 11:82041799-82041821 TTTGACAGTGCTGCCTTTGATGG - Intergenic
1086846196 11:91752420-91752442 TCAGAGAGTGAAGCCTCTGAAGG + Intergenic
1087044844 11:93836379-93836401 CTGGCCAGTCAAGCCTTTGAAGG - Intronic
1087145116 11:94803024-94803046 CTAGAAAGAGACGCCTCTGATGG + Intronic
1087819909 11:102700085-102700107 TTAGACAGTGAAGCCCTGGAGGG + Intronic
1088518563 11:110667629-110667651 ATAGACAGTGATTCCTCTGATGG + Intronic
1088525087 11:110744301-110744323 CTAGATTGTGAACTCTTTGAAGG - Intergenic
1088567965 11:111193243-111193265 ATAGACAGTGATTCCTCTGATGG + Intergenic
1089597736 11:119592356-119592378 ATAGGCAGAGCAGCCTTTGAGGG - Intergenic
1089878501 11:121749900-121749922 GTAGAGAATGAAGCCTTGGAAGG + Intergenic
1089896154 11:121932205-121932227 TTAGACTGTGAGGCCTGTGAGGG - Intergenic
1090226431 11:125074756-125074778 CTCGGCAGTGAAGCCCTTGCTGG - Intronic
1093375159 12:18416928-18416950 ATAGACAGTGATTCCTTGGATGG + Intronic
1093933547 12:24977907-24977929 CTAGAAAGTGAACCCCCTGAAGG + Intergenic
1095562360 12:43581189-43581211 CTAGCCAGTGAAGGCCTTTATGG + Intergenic
1095628000 12:44340959-44340981 ATAGACAATGAAGACTTGGAAGG - Intronic
1097911564 12:64975509-64975531 ATAGACAGAGGAGCCTATGATGG + Intergenic
1098598068 12:72296065-72296087 TTAGACTGTGAACTCTTTGAAGG + Intronic
1100229670 12:92594200-92594222 CAGGACAGTGAACTCTTTGAAGG + Intergenic
1100435057 12:94563535-94563557 CAAGACAGTGAAGTCTCTGGTGG - Intergenic
1100943490 12:99751700-99751722 TTAGACTGTGAACCCCTTGAGGG - Intronic
1101748511 12:107563016-107563038 CCAGACTCTGAAGTCTTTGAGGG + Intronic
1102349813 12:112184190-112184212 CACGACTGCGAAGCCTTTGATGG + Exonic
1105324880 13:19361645-19361667 TTAGACAGTGATTCCTCTGATGG - Intergenic
1105868405 13:24481906-24481928 ATAGACAGTGATTCCTCTGATGG + Intronic
1105946318 13:25192807-25192829 CTCTTCAGAGAAGCCTTTGAAGG + Intergenic
1108962977 13:56260231-56260253 ATAGACAATGGAGCCTTTGGGGG + Intergenic
1110637218 13:77780238-77780260 TTAGACAGTTAAGCCTTTCTAGG + Intergenic
1110782059 13:79478133-79478155 CCAGACACTGAAGCCCTTAAAGG - Intergenic
1110887031 13:80653056-80653078 CTAGATGGTGAATGCTTTGAGGG - Intergenic
1111572618 13:90106998-90107020 CTTGACAGTGAAGGATGTGAGGG - Intergenic
1111637883 13:90929028-90929050 CTATATAGTGAAGCCAGTGAAGG - Intergenic
1112416006 13:99204175-99204197 ATAGACAGTGAACTCCTTGAGGG - Intronic
1113190167 13:107736025-107736047 CTAGACTATAAAGACTTTGAGGG + Intronic
1113265266 13:108609382-108609404 CTAGACTGTGAATCCCATGAGGG + Intronic
1114164152 14:20201879-20201901 CAAGACTGTGAATCCTATGAGGG - Intergenic
1116153506 14:41173061-41173083 CTAGACACAGAAGTTTTTGAGGG - Intergenic
1117324471 14:54656335-54656357 ATGGAGAGAGAAGCCTTTGATGG - Intronic
1117868472 14:60173415-60173437 CTAGCCAGTGAGTCCTTGGAGGG - Intergenic
1119817084 14:77579339-77579361 ATAGACAGTGGAGACTTGGAAGG - Intronic
1120790078 14:88572614-88572636 GTCAACAGTGAAACCTTTGAGGG + Exonic
1121705024 14:95985747-95985769 ATAGATAGTGAATCCTCTGATGG - Intergenic
1121860700 14:97315206-97315228 TTAGACAGTGAACTCCTTGAGGG + Intergenic
1122054442 14:99083505-99083527 ATAGATAGTGATTCCTTTGATGG - Intergenic
1123013655 14:105362493-105362515 ATAGACAGTGATTCCTCTGATGG - Intronic
1202838663 14_GL000009v2_random:99908-99930 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1202908020 14_GL000194v1_random:89978-90000 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1202885208 14_KI270722v1_random:99327-99349 CTAGAAAGTGATTCCTTTGATGG - Intergenic
1123604186 15:22007267-22007289 CAAGACAGTGAACCCTGTGGTGG + Intergenic
1125000421 15:34764192-34764214 TTAGACAGTGATTCCTCTGATGG - Intergenic
1125801188 15:42448825-42448847 CTAGACTGTGAGCCCCTTGAAGG - Intronic
1125870743 15:43099745-43099767 CTAGACAGTGAAGTTCTTGAAGG - Intronic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1127708452 15:61570741-61570763 CTTAACAGTGAATCCATTGAGGG + Intergenic
1127801338 15:62479796-62479818 TTAGACAGTGAGCCCCTTGAGGG + Intronic
1127974689 15:63988393-63988415 CTTGACAGTGAAGACTTTGGGGG - Intronic
1128451874 15:67810628-67810650 ATAGACTGTGAGCCCTTTGAGGG + Intergenic
1128688648 15:69706588-69706610 CTACATAGTGAAGGCTTTGCTGG - Intergenic
1128840936 15:70851538-70851560 CTAGACAGTGAGATCCTTGAAGG - Intronic
1129783344 15:78289672-78289694 CTAGCCAGTGGAGCCATAGATGG - Exonic
1129992371 15:79976271-79976293 CTAGACTGAAAATCCTTTGAAGG - Intergenic
1130716654 15:86341282-86341304 CTAGACAGAGCAGGCTTTTATGG + Intronic
1131814793 15:96211295-96211317 CTTGACAGTGTAGCCTTGGAAGG + Intergenic
1132368529 15:101276766-101276788 CTAGACCATGAAGGCTTTGAGGG - Intronic
1133715230 16:8441147-8441169 CTTGAGAGTGAGGCCTTTGCTGG - Intergenic
1137826154 16:51497517-51497539 ATAGACAGTGGAGACTTGGAAGG - Intergenic
1137940907 16:52683427-52683449 CTAGACCATGAACTCTTTGAAGG + Intergenic
1138077486 16:54057015-54057037 CTAGACTGTGAGTTCTTTGAAGG - Intronic
1138722138 16:59094712-59094734 ATAGACAGTGAATTCTTGGAGGG + Intergenic
1139302429 16:65956823-65956845 CTAGTCAGTAAACCCCTTGAAGG - Intergenic
1144421927 17:15106783-15106805 CTAAACACTGAAGCCTGTGCGGG - Intergenic
1146106069 17:30038627-30038649 ATAGATAGTGATTCCTTTGATGG + Intronic
1148136654 17:45296858-45296880 CTACTCAATGAAGCCTTTTATGG + Intronic
1149100112 17:52895586-52895608 ATAGACAGTTAATCCTGTGATGG - Intronic
1149368591 17:55970207-55970229 CCAGACAGTGCAGATTTTGAAGG + Intergenic
1150661852 17:67087944-67087966 CCAGACAGTCTAGCCTTAGATGG - Intronic
1151140829 17:71990704-71990726 TTAGACTATGAAGTCTTTGAGGG + Intergenic
1154096500 18:11421198-11421220 ATAGACAGTGATTCCTCTGATGG - Intergenic
1154227733 18:12523000-12523022 ATAGACAGTGATTCCTCTGATGG + Intronic
1155037910 18:22040846-22040868 CTAGACTATGAAGCACTTGAGGG + Intergenic
1155364765 18:25038948-25038970 CCAGCCACTGAAGGCTTTGAAGG - Intergenic
1155500500 18:26482634-26482656 CTAGACAGTGCAGCATGGGAAGG - Intronic
1156281040 18:35638729-35638751 ATAGACAGTGATTCCTTTGGTGG + Intronic
1157883371 18:51342938-51342960 CTAGGCAGTGATTCCTGTGATGG + Intergenic
1158345370 18:56511001-56511023 CTAAGCAGTGAAGACATTGAAGG - Intergenic
1158547690 18:58410012-58410034 CAATACAGGCAAGCCTTTGAAGG - Intergenic
1158642539 18:59215882-59215904 GGAGCCAGTGAAGGCTTTGAGGG - Intergenic
1158744603 18:60184931-60184953 CTAGACTGTGAATGCCTTGAAGG - Intergenic
1159319678 18:66830656-66830678 CTAGAACTTGAGGCCTTTGATGG + Intergenic
1159780908 18:72659441-72659463 AGAGACAGTGAAGCATTTGGTGG - Intergenic
1160450421 18:78960016-78960038 CTGGACAGTGATTCCTCTGATGG - Intergenic
1161709135 19:5838090-5838112 GGAGACAGTGAAGTCTTTGCCGG + Intronic
1162614951 19:11791771-11791793 ATAGACAGTGGAGACTTAGAAGG - Intergenic
1163291123 19:16379635-16379657 CTAGACACTGAAGGCCTAGATGG - Intronic
1163291131 19:16379709-16379731 CTAGACGCTGGAGCCTTAGATGG - Intronic
1163291135 19:16379746-16379768 CTGGACACTGTAGCCTTAGACGG - Intronic
1163291153 19:16379929-16379951 CTAGACACTGGAGTCTTAGATGG - Intronic
1163291182 19:16380225-16380247 CTAGACACTGGAGCCTTAGATGG - Intronic
1163291201 19:16380447-16380469 CTAGACACTAGAGCCTTAGACGG - Intronic
1163291217 19:16380558-16380580 CTAGACCCTGGAGCCTTAGATGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1163509397 19:17726154-17726176 CAGCACAGTGAAGCCATTGACGG - Exonic
1164573345 19:29389919-29389941 CTAGAGAGTGCAGCTTTTGGAGG - Intergenic
1166970999 19:46567768-46567790 CTGGACAGTGATGTCTGTGAGGG - Intronic
1167017883 19:46853284-46853306 CTAGACTGTGAATGCTGTGAGGG - Intergenic
1168533310 19:57147674-57147696 ATAGATAGTGAATCCTCTGATGG + Intergenic
1202634364 1_KI270706v1_random:30671-30693 CTAGAAAGTGATTCTTTTGATGG - Intergenic
1202651511 1_KI270707v1_random:9360-9382 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1202660614 1_KI270708v1_random:66358-66380 CTAGAAAGTGATTCCTTTAATGG - Intergenic
925296471 2:2780557-2780579 GTAGAGTGTGAAGCCTTGGAGGG - Intergenic
925296513 2:2780791-2780813 GTAGAGTGTGAAGCCTGTGAGGG - Intergenic
925414152 2:3657649-3657671 GCAGACAGTGGGGCCTTTGAAGG + Intergenic
926978131 2:18535316-18535338 CTAGACTGTGAGTACTTTGATGG + Intergenic
927276051 2:21263306-21263328 CTAGACTGTGATCTCTTTGAAGG + Intergenic
927300881 2:21512849-21512871 AGAGACAGTGAAGCCCATGAAGG + Intergenic
927566234 2:24115783-24115805 CTAGACAGTGAACTCCATGAGGG - Intronic
927959767 2:27233819-27233841 GCAGACAGTGAAGTCTCTGAGGG + Intronic
928060496 2:28107767-28107789 CTAGACTGTGAAGATTTTGAGGG + Intronic
928792011 2:34968750-34968772 CTAGCCACTAAAGCCTTAGAAGG + Intergenic
929438214 2:41945005-41945027 CTAGAAAATAAACCCTTTGAGGG - Intronic
931032583 2:58196622-58196644 CTAGACTGGAAAGTCTTTGAAGG - Intronic
936551665 2:113448084-113448106 ATAGACAGTGATTCCTCTGATGG - Intronic
936690278 2:114879265-114879287 CTAGACAGTAAATTCCTTGAGGG - Intronic
937074117 2:119088610-119088632 CTAGACTGTGAGCCTTTTGAGGG + Intergenic
937759093 2:125578268-125578290 CTAGACTGTGAAGTCCTGGAGGG + Intergenic
939063304 2:137450496-137450518 CTAGACAGTGAATCGTAGGAGGG + Intronic
939525947 2:143294659-143294681 CTAGGAAGTGTAGCCTTTGGGGG + Intronic
940374707 2:152945096-152945118 CCACAGAGTGAAGCTTTTGATGG + Intergenic
942980352 2:182073239-182073261 CTAGACTGCGGAGCCCTTGAGGG + Intronic
944010714 2:194971389-194971411 ATAGACAGTGATTCCTTCGAGGG + Intergenic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
945756913 2:213857761-213857783 ATAGACAGTGATTCCTCTGATGG + Intronic
947050487 2:226037365-226037387 ATAGACAGTGATTCCTCTGATGG + Intergenic
1168739920 20:178893-178915 ATAGACAGTGAAGATTTTAAAGG + Intergenic
1168911610 20:1452510-1452532 CTCGCCAGTGAAGGCTTTGAAGG + Exonic
1172511698 20:35505203-35505225 CTAGACTGTGAACTCTGTGAGGG - Intronic
1173465463 20:43277528-43277550 CCAAACAGTGAAGCATTAGAAGG + Intergenic
1174902653 20:54516801-54516823 CTAGACTGTAAATTCTTTGAGGG - Intronic
1176600636 21:8790286-8790308 CTAGCAAGTGATTCCTTTGATGG - Intergenic
1176627382 21:9104662-9104684 TTAGAAAGTGATTCCTTTGATGG + Intergenic
1176646584 21:9356446-9356468 CTAGAAAGTGATTCCTTTGATGG - Intergenic
1177140034 21:17348016-17348038 ATAGACAATGAAGACTTGGAAGG - Intergenic
1178070764 21:28963706-28963728 ATAGACAGTGATTCCTCTGATGG + Intronic
1178295189 21:31403831-31403853 CTAGACTAGGAAGTCTTTGAGGG - Intronic
1178558970 21:33619991-33620013 CTAGAGAGTGAACCGTTTAAGGG + Intronic
1179772132 21:43629186-43629208 ATAGACAGTGATTCCTCTGATGG + Intronic
1180328098 22:11449949-11449971 CTAGAAAGTGATTCCTTTGATGG - Intergenic
1180342919 22:11681824-11681846 CTAGCAAGTGATTCCTTTGATGG - Intergenic
1180366337 22:11942557-11942579 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1180417727 22:12784259-12784281 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1180658407 22:17444211-17444233 GCAGACAGTGAAGCGTTTGCTGG + Intronic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
1180926793 22:19560767-19560789 ATAGACAATGGAGACTTTGAAGG + Intergenic
1181480074 22:23193242-23193264 GTTGACAGTGCAGACTTTGAAGG + Intronic
1181512226 22:23394158-23394180 CTTGACAGTGAGGCCTCTGCAGG + Intergenic
1182734791 22:32525050-32525072 ATAGACAGTGATTCCTCTGATGG + Intronic
1182993957 22:34795840-34795862 GGAGACAGGGATGCCTTTGAAGG - Intergenic
1183356816 22:37364176-37364198 CTAGACAGTAAAGGCTTTCCTGG + Intergenic
1183494014 22:38132206-38132228 CCAGACAGTAAGGGCTTTGAGGG + Intronic
1183947292 22:41333781-41333803 CTAGACTGTGAGCTCTTTGAGGG - Intronic
1184409000 22:44315922-44315944 CCGGACTGTGAATCCTTTGAGGG - Intergenic
949457204 3:4251643-4251665 TCAGACAGTCAATCCTTTGAAGG + Intronic
950330992 3:12156020-12156042 CTGGACAGTGAACTCTTTTAAGG + Intronic
951036157 3:17934544-17934566 CTAGACAGAGAAGCTCTGGATGG + Intronic
951529983 3:23689369-23689391 ATAAACAGTGATTCCTTTGAAGG - Intergenic
951608686 3:24466443-24466465 CTGGAGAGTGAAGGCTTGGATGG + Intronic
951823657 3:26843102-26843124 ATAGACATTGGAGACTTTGAAGG + Intergenic
952003593 3:28814650-28814672 ATAGACAGTGATTCCTTTGATGG - Intergenic
953025979 3:39145199-39145221 CCAGGCCGTGTAGCCTTTGATGG - Exonic
954141372 3:48608156-48608178 ATGGACAGTGAAGACTTGGAAGG - Intronic
955354586 3:58220466-58220488 TTAGACAGTGATTCCTCTGATGG + Intergenic
956952116 3:74294664-74294686 CTAAACAGAGAGGTCTTTGAAGG + Intronic
957093686 3:75757698-75757720 CTAGAAAGTGATTCCTTTGATGG + Intronic
957481020 3:80793954-80793976 ATAGACAGTGGAGACTTGGAAGG + Intergenic
957656430 3:83083480-83083502 ATAGACAGTGGAGACTTGGAAGG - Intergenic
958452199 3:94287573-94287595 ATAGACAGTGATTCCTCTGATGG + Intergenic
959636885 3:108584945-108584967 CTAGACTGAGAAGTCTTTGAAGG + Intronic
959751612 3:109843592-109843614 ATAGACAGTGGAGACTTGGAAGG + Intergenic
961840549 3:129707142-129707164 CTAGACAGTGAACTCCTTCAGGG + Intronic
962522186 3:136207660-136207682 CTAGACTGTGAACTCTTTGAGGG - Intergenic
963544904 3:146644228-146644250 CTAGACAGTGCTGCTTTAGAAGG + Intergenic
965899024 3:173615978-173616000 CAAGACAGTGAACTCTTTGAGGG - Intronic
967861065 3:194152103-194152125 CTAGACTGTGATGTCCTTGAAGG - Intergenic
967886037 3:194334057-194334079 CTAGACAGTCTAATCTTTGACGG + Intergenic
1202740301 3_GL000221v1_random:48594-48616 CTAGAAAGTGATTCCTTTGATGG + Intergenic
968438328 4:607629-607651 ATAGACAGTGATTCCTATGATGG + Intergenic
970664441 4:18320558-18320580 CTAGACAGTGAGTTCCTTGAGGG + Intergenic
971741179 4:30523810-30523832 ATAGACAGTGAAGACTGGGAAGG - Intergenic
973013248 4:45103711-45103733 CAAGACAGAGAAGCCTTGGCCGG - Intergenic
973364067 4:49193034-49193056 CTAGAAAGTGGTTCCTTTGATGG - Intergenic
973397015 4:49603709-49603731 CTAGAAAGTGATTCCTTTGATGG + Intergenic
973739333 4:53903856-53903878 CAAGACAGTAAAGGCCTTGATGG - Intronic
973805675 4:54523990-54524012 CTTGACAATGAAACCTTAGAGGG - Intergenic
973830178 4:54751334-54751356 ATAGACAATGAAGACTTGGAGGG + Intergenic
974146566 4:57955133-57955155 CTTCACAGAGAAGCCTATGAAGG + Intergenic
974684185 4:65203521-65203543 CTAGACAGGGAATCCATTAATGG - Intergenic
975596611 4:76052608-76052630 ATAGACAGTGGAGACTTGGAAGG - Intronic
975755276 4:77565685-77565707 CTAGACGGTGAGTCCTTTGAGGG - Intronic
976256060 4:83102150-83102172 ATAGACAGTGATACCTCTGATGG + Intronic
977104093 4:92858264-92858286 ATAGACAGTGATTCCTCTGATGG + Intronic
977596972 4:98893859-98893881 GTAGATAGTGATTCCTTTGATGG - Intronic
977991750 4:103451529-103451551 CTAGACAGTCAAGTTTTTCAAGG - Intergenic
979695130 4:123604407-123604429 ATAGACAGTGAATCCTCTGAGGG + Intergenic
980323296 4:131307337-131307359 ATAGACAGTGAAGACTCAGAAGG + Intergenic
980706942 4:136510464-136510486 TTAGACAGTGATTCCTCTGATGG - Intergenic
980768059 4:137333952-137333974 CTAGATAGTGATTCCTCTGATGG - Intergenic
982974948 4:162044136-162044158 ATAGACAGTGATTCCTCTGATGG - Intronic
983295891 4:165868523-165868545 ATAGACTCTGAAACCTTTGATGG - Intergenic
983464659 4:168072153-168072175 ATAGATAGTGATTCCTTTGATGG - Intergenic
983794749 4:171848005-171848027 ATAGACAGTGACTCCTCTGATGG - Intronic
984258512 4:177415831-177415853 ATAGACAGTGATTCCTCTGATGG - Intergenic
984299462 4:177896347-177896369 ATAGATAGTGATTCCTTTGATGG + Intronic
984915235 4:184717707-184717729 CTAGACAGTGAACCCTTTGAAGG - Intronic
1202761379 4_GL000008v2_random:114147-114169 CTAGAAAGTGATTCCTTTGATGG - Intergenic
986485762 5:8235094-8235116 GTAGATAGTGATTCCTTTGATGG - Intergenic
987100282 5:14585100-14585122 CTAGAGAGTAAAGACCTTGAAGG - Intronic
987454605 5:18128098-18128120 ATAGACAGTGAATACTCTGAAGG - Intergenic
987922526 5:24302198-24302220 CTGGAGAGTGAAGCCTTTTATGG - Intergenic
988431739 5:31127007-31127029 ATAGACAGTGATTCCTTTGATGG + Intergenic
989225227 5:39019815-39019837 ATAGACAGTGATTCCTCTGATGG + Intronic
989574161 5:42973613-42973635 CCAGACACTGGAGCCATTGAAGG - Intergenic
990522987 5:56597696-56597718 ATAGATAGTGATTCCTTTGATGG - Intronic
990677213 5:58200964-58200986 ATAGATAGTGACTCCTTTGATGG + Intergenic
990748813 5:58989585-58989607 ATAGACAATCAAGTCTTTGATGG - Intronic
991228710 5:64304339-64304361 ATAGATAGTGATGCCTGTGATGG + Intronic
991621938 5:68553930-68553952 CTAGATAGTGATTCCTCTGATGG - Intergenic
992243945 5:74798233-74798255 CTAGGCAGTCAATCCTTTGAGGG + Intronic
992950033 5:81849838-81849860 CTACACAAAGAAGCCTTTAAGGG + Intergenic
994516866 5:100783259-100783281 ATAGACAGTGATTCCTCTGATGG - Intergenic
996444982 5:123537405-123537427 ATAGACAGTGGAGACTTGGAAGG + Intronic
997786803 5:136721001-136721023 CCAGACAGTGAGCCCCTTGAAGG - Intergenic
997907074 5:137828551-137828573 CCAGACTGTGAGCCCTTTGAGGG + Intergenic
999434289 5:151551037-151551059 CTAGACTGTGCAGCATCTGAAGG - Intronic
1000386533 5:160679648-160679670 CTAGACTGAGAGTCCTTTGAGGG + Intronic
1000819261 5:165963439-165963461 AGAGACAGAGAAGCCTTTCAAGG - Intergenic
1000879706 5:166683067-166683089 CTAGACTATGAACTCTTTGAAGG + Intergenic
1001959984 5:175874039-175874061 CTAGACTGTGCAGGCCTTGAAGG + Intronic
1003008209 6:2401497-2401519 CTAGACAGTGATTCCTCTGATGG + Intergenic
1003976738 6:11351772-11351794 CATGACACAGAAGCCTTTGAGGG - Intronic
1004053334 6:12109848-12109870 ATAGACAGTGATTCCTCTGATGG - Intronic
1004593948 6:17080930-17080952 CTAGACTGTGAACCCCTTGAGGG - Intergenic
1005439772 6:25854512-25854534 CTGGACAGTGAGCTCTTTGAGGG - Intronic
1007017664 6:38485376-38485398 ATAGATAGTGATTCCTTTGATGG - Intronic
1007651303 6:43424377-43424399 ATAGACAGTGATTCCTCTGATGG + Intergenic
1007908261 6:45486277-45486299 CTAGACTGTGAACTCCTTGAGGG + Intronic
1007944327 6:45811801-45811823 CTAGGCAGTGAAGCTTTGGATGG - Intergenic
1008009003 6:46444095-46444117 CTAGACCCTGAAGCCCTTCAAGG - Intronic
1008022012 6:46589627-46589649 GAAGACAGTGAAGCTTTTGCAGG + Intronic
1008268826 6:49464997-49465019 CTAGACAGTGATTCCTCTGATGG - Intronic
1008902867 6:56642628-56642650 TTCGGCAGTGAATCCTTTGATGG - Exonic
1009573462 6:65420657-65420679 ATAGACAGTGATTCCTCTGATGG - Intronic
1009649270 6:66452105-66452127 CTATACAGTGAAGCCTGTATAGG + Intergenic
1010669676 6:78673542-78673564 ATAGACAATGAAGACTCTGAAGG - Intergenic
1011069732 6:83366944-83366966 ATAGACAGTGATTCGTTTGATGG - Intronic
1011861501 6:91763176-91763198 CTAGACAGTGAATTATTTGAAGG - Intergenic
1012942397 6:105428918-105428940 CCAAACAATGAGGCCTTTGATGG - Intergenic
1013541771 6:111117574-111117596 ATAGAAATTGAACCCTTTGAGGG + Intronic
1014262613 6:119236788-119236810 ATAGACAGTGATTCCTCTGATGG + Intronic
1014929556 6:127318667-127318689 CTAGACAGTAAGTCCCTTGATGG + Intronic
1015624008 6:135160946-135160968 TTAGACTGTGAATTCTTTGAGGG + Intergenic
1015754980 6:136597815-136597837 TTGGACAGTGAAGCTATTGATGG - Intronic
1016348714 6:143144357-143144379 CTAGGCTGTGAAACCTTTGAAGG - Intronic
1016370638 6:143370512-143370534 TTAGACAGTGTAGCTTTAGAAGG + Intergenic
1016460984 6:144279987-144280009 CGAGACAGTGAGCTCTTTGAAGG + Intergenic
1017680655 6:156861100-156861122 GTAGACAGAGGAGCCTTTGCAGG + Intronic
1017859460 6:158381960-158381982 CTAGACAGTGAGCTCTTTTAGGG + Intronic
1018323085 6:162634195-162634217 TTAGACAGGGAGGCCTGTGAGGG - Intronic
1018651323 6:165993814-165993836 GTACACACTGAAGCCTTTGGGGG - Intergenic
1018691639 6:166349761-166349783 ATAGACAGTGATTCCTCTGATGG - Intergenic
1020365541 7:7377358-7377380 CTGGACTGTGAATCCTTTGAGGG - Intronic
1020921577 7:14271581-14271603 GCAGACAATGGAGCCTTTGAGGG + Intronic
1021211259 7:17855880-17855902 CTAGATAGTGATTCCTCTGATGG + Intronic
1021282877 7:18741692-18741714 ATAGACAGTGATTCCCTTGATGG + Intronic
1023107946 7:36781306-36781328 CTTGACAGTGAACTCTGTGAGGG - Intergenic
1023285917 7:38619686-38619708 ATAGACAGTGAATCCATTGTAGG - Intronic
1024135532 7:46403889-46403911 CTAAACAGTGAGTCCTTTGATGG + Intergenic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1026990189 7:74580736-74580758 CTGGACAGTGACACCTTTGGTGG - Intronic
1027134825 7:75616721-75616743 CTAGGCAGGGCAGCCTATGAGGG + Intronic
1027342265 7:77222253-77222275 ATGAACAGTGAAGCCTTTCACGG - Intronic
1029239552 7:99149718-99149740 CTAGACAGAGAAGATTTTAAAGG - Intergenic
1030217853 7:107064606-107064628 CAAGACCATGAAGCCTTGGAGGG + Intronic
1030387113 7:108877922-108877944 CTTGAGAGTGAGGCCTTTGCCGG - Intergenic
1033241774 7:139685990-139686012 ATAGACAGTGAGTCCTCTGATGG + Intronic
1033294716 7:140121423-140121445 CTTGAAAGTGAGTCCTTTGAGGG - Intronic
1033950420 7:146778543-146778565 CAAGACTGGGAAGCCTTCGATGG - Intronic
1034036098 7:147824148-147824170 CTACACAGTTAAACCTCTGAAGG - Intronic
1035036150 7:155895939-155895961 ATAGACAGTGATTCCTCTGATGG + Intergenic
1035325046 7:158060376-158060398 CGAGACAGTGAGACCTGTGATGG - Intronic
1035644932 8:1211299-1211321 CTAATCAGTGGAGCCTGTGAGGG + Intergenic
1036123921 8:6045668-6045690 CTAGACATGGGAACCTTTGAAGG + Intergenic
1037522756 8:19696394-19696416 CTAAACAGTGAGCCCCTTGAGGG - Intronic
1038069990 8:24003308-24003330 TTATAGAATGAAGCCTTTGAAGG - Intergenic
1038359047 8:26859528-26859550 CTAGACTGTGAGGCCCTTGAGGG + Intronic
1038634533 8:29274971-29274993 CCAGACAGTGAACACTTTGGGGG - Intergenic
1039337247 8:36605135-36605157 ATAGATAGTGATACCTTTGATGG - Intergenic
1040447586 8:47511377-47511399 CTCGCCAGTGAAGGCTTTGAAGG + Intronic
1042171128 8:65992077-65992099 CTAGACAATGAAATATTTGAGGG - Intergenic
1042495875 8:69454084-69454106 CAAGACAGTGAACTCTTCGAGGG - Intergenic
1042596527 8:70453792-70453814 CTTGACTGTAAAGTCTTTGAGGG - Intergenic
1043005501 8:74813226-74813248 GTAGATAGTGAATCCTCTGATGG + Intronic
1043307068 8:78807706-78807728 CTGGACAGAAAAGCCTTTAAGGG + Intergenic
1044089694 8:87983889-87983911 ATAGACAGTGATTCCTATGATGG - Intergenic
1044640039 8:94369866-94369888 ATAGACAGTGATTCCTCTGATGG + Intergenic
1045126575 8:99097445-99097467 CTAAACAGTTAACTCTTTGAGGG - Intronic
1045327721 8:101128975-101128997 CTAGACAGTCAGCCCTTTGAAGG + Intergenic
1046389922 8:113557235-113557257 AGAGAAATTGAAGCCTTTGATGG + Intergenic
1046573609 8:115997596-115997618 CCAGGCAGTGTAGCCTGTGATGG - Intergenic
1046793336 8:118344683-118344705 CTAGACAGTAAAGTCCTTGAGGG + Intronic
1047027351 8:120838527-120838549 TGAAACAGTGAAGTCTTTGAGGG + Intergenic
1047038647 8:120968243-120968265 CTAGACAGAAAAGCTCTTGAGGG - Intergenic
1047904072 8:129454025-129454047 GTAGACAGTGAAGCCCTGGAGGG - Intergenic
1048077669 8:131090757-131090779 ATAGATAGTGATTCCTTTGAAGG + Intergenic
1048365160 8:133732101-133732123 CTAGACTGGGAACTCTTTGAGGG - Intergenic
1048573538 8:135673696-135673718 CCAGAGAATGAAGACTTTGAAGG + Intergenic
1049447466 8:142638007-142638029 CTACAAAGTAAAGCCTTTGGAGG + Intergenic
1049827380 8:144678306-144678328 CTAGACTGGGAAGTCCTTGAGGG - Intergenic
1049901331 9:169065-169087 ATAGACAGTGATTCCTCTGATGG + Intronic
1050927961 9:11289309-11289331 CTTGACAGAGGAGCCTTGGATGG + Intergenic
1051083830 9:13323678-13323700 GTTGACACTGAACCCTTTGATGG + Intergenic
1051201444 9:14630608-14630630 GTAGACAGTGATTCCTCTGATGG - Intronic
1051298330 9:15620229-15620251 ATAGATAGTGACTCCTTTGATGG + Intronic
1051545419 9:18269242-18269264 CTATACAGTAAACTCTTTGAAGG + Intergenic
1051993340 9:23180964-23180986 CTATACGGTGTTGCCTTTGATGG - Intergenic
1052231170 9:26155046-26155068 CAAAACAGTATAGCCTTTGAAGG - Intergenic
1052566145 9:30154505-30154527 TTAGACAATGCAGACTTTGAAGG - Intergenic
1052634094 9:31078489-31078511 TTAGGCAGAGAAGACTTTGAAGG + Intergenic
1053408816 9:37901775-37901797 CTAGACACTGAAGTCTGTTAGGG + Intronic
1054795710 9:69299679-69299701 ATAGACAGTGATTCCTCTGATGG - Intergenic
1054914398 9:70482528-70482550 CTGGACAATAAAGTCTTTGAAGG - Intergenic
1056694128 9:88832075-88832097 CCAGACAATGGAGCCTTCGAAGG + Intergenic
1057591797 9:96379402-96379424 TTGGACAGAGAGGCCTTTGAAGG - Intronic
1058475449 9:105328358-105328380 CTTCTCAGTGAAGCCTTTGCTGG - Intronic
1058897819 9:109415210-109415232 TTGGACAGTGAATTCTTTGAGGG - Intronic
1059158237 9:112009211-112009233 CCAGACAGTGATTCCTCTGATGG + Intergenic
1059613360 9:115922918-115922940 CTAGGCTGTGAACACTTTGATGG - Intergenic
1060735999 9:126066922-126066944 CTAGACAGCGAGGCATTTGGGGG + Intergenic
1061258055 9:129464212-129464234 CCAGACAGTGAACCCTGTGGAGG - Intergenic
1203750226 Un_GL000218v1:72348-72370 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1203708942 Un_KI270742v1:78550-78572 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1203542149 Un_KI270743v1:99028-99050 CTAGAAAGTGATTCCTTTGATGG - Intergenic
1186660098 X:11660853-11660875 CTGGACAGTGAAGCCTTTCAAGG + Intronic
1186849134 X:13562740-13562762 ATAGATAGTGATTCCTTTGATGG - Intergenic
1186933063 X:14416040-14416062 ATAGACATTGAAGTCTCTGAAGG + Intergenic
1187677092 X:21727038-21727060 CTAGACTGTGAGTCCCTTGAGGG + Intronic
1188189302 X:27155434-27155456 ATAGACACTGGAGCCTTGGAAGG + Intergenic
1188540696 X:31247266-31247288 ATAGACAGTGATTCCTCTGATGG + Intronic
1190715509 X:53099651-53099673 ATAGACAGTGATTCCTCTGATGG - Intergenic
1190759451 X:53427525-53427547 CCAGACTGTGAACCCTTTCAGGG - Intronic
1191693883 X:63968268-63968290 CTAGAGTGTGAACTCTTTGAGGG - Intergenic
1191957702 X:66663757-66663779 ATAGATAGTGATTCCTTTGATGG - Intergenic
1192054264 X:67757511-67757533 CTAGAAAGTGATCCCTTTGAGGG - Intergenic
1192283349 X:69707353-69707375 CTAAGGAGTGAAGCCTTTGGGGG + Intronic
1192539087 X:71953098-71953120 CTAGACAGTGGAGAGTTAGATGG - Intergenic
1194541420 X:95177513-95177535 CTAGGCGCTCAAGCCTTTGATGG - Intergenic
1194976186 X:100398620-100398642 CTAGACTGTGAACTCTCTGAGGG + Intronic
1196209889 X:112984195-112984217 CTGTACAGTGCAGCTTTTGATGG + Intergenic
1196411545 X:115425143-115425165 ATAGACAGTGAGGCCATTTAGGG - Intergenic
1197120839 X:122890409-122890431 CTAGACTGTAACTCCTTTGAGGG + Intergenic
1197349245 X:125362671-125362693 CTAGACTGTGAATGCCTTGAGGG - Intergenic
1197854357 X:130899427-130899449 CTAGACTGTGAACTCCTTGAGGG - Intronic
1198228606 X:134669257-134669279 CTGGAAAGTGAACTCTTTGAGGG - Intronic
1199405090 X:147447884-147447906 ATAGACAGTGATTCCTTTGATGG + Intergenic
1199902374 X:152189102-152189124 CTAGACTGTGAACATTTTGAGGG - Intronic
1200274521 X:154719030-154719052 CTAGAGAGTGAGGTCTTTTAGGG - Intronic
1200374379 X:155764625-155764647 TTAGACAGTGATCTCTTTGAGGG - Intergenic
1201163877 Y:11189985-11190007 CTAGAAAGTGATTCCTTTGATGG + Intergenic
1201708032 Y:16958221-16958243 ATAGACAGGGAAGACTCTGAAGG - Intergenic