ID: 1126341498

View in Genome Browser
Species Human (GRCh38)
Location 15:47645766-47645788
Sequence TGGGAATCCCAATGTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 3, 2: 20, 3: 53, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126341498_1126341506 30 Left 1126341498 15:47645766-47645788 CCAGCTATACATTGGGATTCCCA 0: 1
1: 3
2: 20
3: 53
4: 162
Right 1126341506 15:47645819-47645841 TACAGCAGTTCACAGAAACCCGG 0: 1
1: 1
2: 4
3: 35
4: 281
1126341498_1126341499 -7 Left 1126341498 15:47645766-47645788 CCAGCTATACATTGGGATTCCCA 0: 1
1: 3
2: 20
3: 53
4: 162
Right 1126341499 15:47645782-47645804 ATTCCCACAACTCCCTCCTCAGG 0: 2
1: 9
2: 46
3: 111
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126341498 Original CRISPR TGGGAATCCCAATGTATAGC TGG (reversed) Intronic
903350312 1:22712822-22712844 TAAACATCCCAATGTATAGCGGG - Intronic
904730607 1:32588187-32588209 TGGAAACCCCAGTTTATAGCTGG + Intronic
905487685 1:38315543-38315565 TGGGAATCCCAACTTAAAGCTGG + Intergenic
907663229 1:56412758-56412780 TGGCATTCCCAATGCTTAGCGGG - Intergenic
908195826 1:61744842-61744864 TGGGATTCCCAATTTATAGGTGG - Intronic
908766363 1:67558350-67558372 TGGGAAGCCCAATATGTTGCAGG + Intergenic
908849849 1:68364714-68364736 TAGAAATCCCAATTTATAGCTGG - Intergenic
909499956 1:76323118-76323140 TATGAATCCCAAAGTATACCTGG + Intronic
910102924 1:83598046-83598068 TGGGAACTCCAATTTATAGCTGG - Intergenic
911413411 1:97540247-97540269 TGGGAATCCCAGTTTATAGCTGG - Intronic
911700141 1:100943218-100943240 TGGGATCCCCAGTTTATAGCCGG - Intronic
911889136 1:103344810-103344832 TGGGAACCCTGATTTATAGCTGG - Intergenic
912665848 1:111578851-111578873 AGGGAATCTCAGTTTATAGCCGG - Intronic
912887954 1:113496369-113496391 TGGGAATGCCAATTGATAGATGG + Intronic
916124516 1:161557386-161557408 TGGGAACCCCCATTTATAACTGG - Intergenic
916134406 1:161638736-161638758 TGGGAACCCCCATTTATAACTGG - Intronic
918042713 1:180922930-180922952 TGGGAACCCCGATTTATAGCTGG - Intronic
918652735 1:186985810-186985832 TTGGAATCCCAATGAATTTCAGG + Intronic
919678757 1:200412027-200412049 TGGGAACCCCGATTTACAGCTGG + Intergenic
920266168 1:204725036-204725058 TGGGAACCCCAACTTATAGTTGG - Intergenic
921467657 1:215509435-215509457 TGGGAACTCCAATTTATAGCTGG - Intergenic
922939453 1:229448820-229448842 TGGGAACCCCAATTTATAGCTGG + Intronic
923228396 1:231960869-231960891 TGGGAATCCCAATTTCTAGTTGG - Intronic
923967280 1:239155964-239155986 TGGGAACCCTGATTTATAGCTGG - Intergenic
1063979522 10:11442357-11442379 TGGGAACCCTGATTTATAGCTGG + Intergenic
1064583883 10:16820148-16820170 TGGGAACCCTGATTTATAGCTGG - Intergenic
1064805712 10:19129228-19129250 TGGGAACTCCAATTTATAGCTGG - Intronic
1065990666 10:31006599-31006621 TGGGAACCCCAATTTATAGCAGG + Intronic
1070084739 10:73226161-73226183 TGGGGATCACATTGTAGAGCAGG - Intronic
1071310782 10:84341721-84341743 TGGGAACCCCAATTTATGGCTGG - Intronic
1071859164 10:89655129-89655151 TGGGAACCTTAATATATAGCTGG + Intergenic
1071877049 10:89853214-89853236 TTGTAATCCCCATGTATAGAGGG + Intergenic
1073232493 10:101983883-101983905 TAGGAACCCCAATTTATAGCCGG + Intronic
1073245566 10:102087915-102087937 GGGGAAGGCTAATGTATAGCAGG - Intergenic
1073285395 10:102384439-102384461 TGCGAAGCCCAATTTATAGCTGG + Intergenic
1073517188 10:104086953-104086975 TGGGAATCCCAGTGTGATGCTGG - Intergenic
1074578581 10:114694439-114694461 TGAGAATCCCCAGGGATAGCTGG - Intergenic
1075092056 10:119449333-119449355 AGGGAATCCCCATGTATAGGGGG - Intronic
1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG + Intronic
1079695290 11:23474794-23474816 TGAGAACCCCAATTTATAGTTGG + Intergenic
1080180715 11:29422670-29422692 TGAGAATTCCCATGTAAAGCAGG + Intergenic
1080326475 11:31079489-31079511 TGAGAATCCCGACATATAGCTGG + Intronic
1081749508 11:45499771-45499793 TGGGAACTCCAATGTGAAGCAGG + Intergenic
1083390497 11:62346168-62346190 TGGGAACCCCAATTTATAGCTGG - Intronic
1083703251 11:64495203-64495225 TGGGAACCCCCATTTATAGCTGG - Intergenic
1084370691 11:68740785-68740807 TGGGAGTCCTAGTGTATAGATGG - Intronic
1085452709 11:76645092-76645114 TGGGAACCCTGATTTATAGCTGG + Intergenic
1086953732 11:92915478-92915500 TCCGAATCCCATTGTAAAGCTGG - Intergenic
1087886812 11:103491646-103491668 TGGAAACCCCAATTTATAGCAGG - Intergenic
1088068601 11:105753706-105753728 CGGGAACCCCAATTTATAGCTGG - Intronic
1088921783 11:114264708-114264730 TGGGAACCCTGATATATAGCTGG - Intronic
1090534317 11:127624184-127624206 TGGGATTCCCAGTGTAGAGGTGG + Intergenic
1091812946 12:3415073-3415095 AGGAAACCCCAATGTATAGCCGG - Intronic
1091869859 12:3880320-3880342 GGGGAATACCATTGTATAGTTGG + Intergenic
1092358999 12:7820357-7820379 TGGGAATCCTGATCTACAGCTGG + Intronic
1092372120 12:7925285-7925307 TGGGAATCCTGATCTACAGCTGG + Intronic
1092821684 12:12358787-12358809 GAGGAATCACAATTTATAGCAGG + Intronic
1094608676 12:31972236-31972258 TGGGAATCCCAGTTTACAGCTGG + Intronic
1095469893 12:42525399-42525421 AGGGAACCCCAATATAGAGCTGG + Intronic
1095519162 12:43041390-43041412 TGGGAACCCCAATTTATAGCAGG - Intergenic
1096328892 12:50691464-50691486 TTTGACTCCAAATGTATAGCTGG - Intronic
1097698364 12:62796406-62796428 TGGGAACCCAGATTTATAGCTGG - Intronic
1100939019 12:99704676-99704698 TGGGAATGCCAATATTAAGCTGG - Intronic
1103986293 12:124769707-124769729 TGGGAACCCCAATTCACAGCTGG + Intergenic
1105235714 13:18551128-18551150 GGGGAAAACCAATGTATAGCAGG - Intergenic
1105623150 13:22088282-22088304 TGGGACACCCATTGTATACCTGG + Intergenic
1107984693 13:45765510-45765532 TAGGATCCCCAATTTATAGCTGG + Intergenic
1112998453 13:105602667-105602689 TTGTAATCTCAATGTATATCTGG + Intergenic
1115262707 14:31470048-31470070 TGGGAATCCCAACTTAAAGCTGG + Intergenic
1116363363 14:44029278-44029300 TGGGAAGCCCAATTAATAGCTGG - Intergenic
1118620318 14:67609085-67609107 TGGGAATGCCAATTAATAGCTGG - Intergenic
1121242042 14:92438189-92438211 TCGGAATCCTGATTTATAGCAGG - Intronic
1124413236 15:29453747-29453769 TTGGAATCCTACTGTATAGCAGG + Intronic
1125235707 15:37511246-37511268 TGGGAATGCCCATGTTTGGCTGG - Intergenic
1126341498 15:47645766-47645788 TGGGAATCCCAATGTATAGCTGG - Intronic
1126662807 15:51048845-51048867 TGGAAACCCCAGTGTAGAGCAGG - Intergenic
1129137590 15:73568558-73568580 TGGGAGTCCTAATATGTAGCAGG + Intronic
1129778714 15:78254697-78254719 TGGAAACCCCAATTCATAGCTGG + Intergenic
1133867662 16:9659214-9659236 TGGGAACCCTAATTTATAGCTGG - Intergenic
1135412550 16:22246104-22246126 TGGGAACCCTGATTTATAGCTGG - Intronic
1138296427 16:55889391-55889413 TGGGAATCCCAATTTATAGCTGG - Intronic
1140389500 16:74572813-74572835 TGGGAAGCCCAATTTATAGCAGG + Intronic
1141078925 16:81034087-81034109 TGGGAAATGCAATTTATAGCTGG - Intergenic
1141300920 16:82814751-82814773 TGGGAACTCCAATTTATAGTGGG + Intronic
1141373595 16:83509195-83509217 TGGTATTCACAAAGTATAGCAGG + Intronic
1141402709 16:83764543-83764565 TGGCAATGCCAATATAAAGCTGG - Intronic
1142181457 16:88672895-88672917 TGGGAATCCCAAGGAAATGCAGG - Intergenic
1143902646 17:10185615-10185637 TGGGAAACCCAATTTACAGCCGG + Intronic
1144197261 17:12906444-12906466 TGGGACCCCTAATTTATAGCTGG - Intronic
1145086265 17:19943705-19943727 TGGGAACTCCAATTTATAGAAGG + Intronic
1147507981 17:41039389-41039411 TGGAATTCCCAATTTATGGCTGG - Intergenic
1149093362 17:52811905-52811927 TGACACTCCCAATATATAGCAGG + Intergenic
1151192233 17:72406945-72406967 TGGGAACCCCAACTTAAAGCTGG + Intergenic
1151837589 17:76593461-76593483 TGGGAACCCAAATTTATAGCTGG + Intergenic
1152907993 17:82980515-82980537 TGGGAACCCCGATTTATAGCTGG - Intronic
1154154155 18:11930708-11930730 TGGGAACCCCAATTCATATCTGG - Intergenic
1154513825 18:15138870-15138892 GGGGAAAACCAATGTATAGCAGG + Intergenic
1156409336 18:36812674-36812696 TGGGAACCCCAATTTATAGCTGG + Intronic
1160418585 18:78728676-78728698 TGGGAAGCCCAATTTGAAGCTGG + Intergenic
1165584272 19:36899658-36899680 TGAGAAATCTAATGTATAGCAGG + Intronic
1167737831 19:51307774-51307796 ATGGAACCCCAATTTATAGCTGG - Intergenic
1167818151 19:51902404-51902426 TGTGAATCCTGATTTATAGCTGG - Intronic
1168358631 19:55719121-55719143 GGGGAACCCCCATGTATAGCCGG - Intronic
1168563478 19:57403413-57403435 TGGGTAGCCCAATGTGTAGCTGG - Intronic
925061317 2:893185-893207 CGGGAACCCCAATGTATGGCTGG - Intergenic
927403030 2:22735420-22735442 TGGGAAACATAATGTCTAGCTGG + Intergenic
928330791 2:30356461-30356483 TGGGAACCCCAATTTATAGCCGG - Intergenic
929755395 2:44760084-44760106 TGGGAATCTCATAGTTTAGCAGG + Intronic
930194654 2:48497059-48497081 TGGGAACCTCAATTTAAAGCCGG + Intronic
933184961 2:79268538-79268560 GGGGAACCCCAATTTATAGCCGG + Intronic
933246001 2:79975592-79975614 TGGGAATGCTGATTTATAGCTGG - Intronic
933553809 2:83807705-83807727 TGGGAACCCCAATTTGAAGCTGG - Intergenic
933795305 2:85914785-85914807 TGGGAATACCAATTCATTGCAGG - Intergenic
934027123 2:88010433-88010455 TGGGAACCCTAATTCATAGCTGG - Intergenic
934131427 2:88952810-88952832 TGGGAATCTCCATGTTTGGCTGG - Intergenic
935535956 2:104294881-104294903 TGGGAATCCCAATTTATAGCTGG - Intergenic
937286869 2:120759407-120759429 TGGGAACCCAGATTTATAGCTGG - Intronic
938514069 2:131983483-131983505 GGGGAAAACCAATGTATAGCAGG + Intergenic
938643866 2:133311187-133311209 TGGGAACCCTGATTTATAGCTGG - Intronic
939126928 2:138188711-138188733 TAGAAATTCCAATTTATAGCTGG + Intergenic
942221138 2:173770194-173770216 TGGGAATCCCAATTTAATGCTGG - Intergenic
943869562 2:192976488-192976510 TGGGAATCCAGAGGTATGGCAGG - Intergenic
944672964 2:202011236-202011258 TGGGAATCACAGTGTATGGCGGG - Intergenic
946937119 2:224733887-224733909 TGGGAACCCCAATTTATAGCTGG - Intergenic
947134083 2:226959654-226959676 TGGAAATCCAAATGTTTATCAGG - Intronic
1172365402 20:34345355-34345377 TGGGAATCCTGATTTATGGCTGG - Intergenic
1173546644 20:43903031-43903053 TGGGGAGCCCTGTGTATAGCAGG + Intergenic
1173894330 20:46538867-46538889 TGGGAACCCCAATTTATAGTTGG + Intergenic
1176779715 21:13179414-13179436 GGGGAAAACCAATGTATAGCAGG - Intergenic
1177303153 21:19276962-19276984 TGGGAATACCAATTTACAGGCGG - Intergenic
1178032445 21:28543328-28543350 TGGAAACCCCAATTTATAGCTGG + Intergenic
1178237273 21:30857496-30857518 TGGGAACCCCAAGGTATCGCTGG - Intergenic
1178342889 21:31801097-31801119 TGGGAACCCCAATTCAGAGCTGG - Intergenic
1178785402 21:35648822-35648844 TGGCAATCCCCATCTATGGCAGG - Intronic
1181384887 22:22537310-22537332 TGGGAAGCCCAAAGTAGAGGGGG - Intergenic
1183565802 22:38614353-38614375 TGGGTGTCCTAATTTATAGCTGG + Intronic
1184124967 22:42480586-42480608 TGGAAACCCCAATTTATGGCTGG + Intergenic
1184133171 22:42529999-42530021 TGGGAACCCCAATTTACGGCTGG + Intergenic
949262342 3:2117176-2117198 CGGGAACACCAATTTATAGCTGG - Intronic
951221688 3:20075549-20075571 TGGGAACCCTGATTTATAGCCGG - Intronic
952261356 3:31743443-31743465 TGGGAGCCCAAATGTATAGATGG + Intronic
953401709 3:42628055-42628077 TAGAAATCCCAATGTAAAGCAGG - Intronic
955570301 3:60297926-60297948 TAGGAATCCTGATTTATAGCTGG - Intronic
956272499 3:67462725-67462747 TGGGAAACCCAATTTATAGCCGG + Intronic
956485890 3:69721693-69721715 TGGGAACCCCAATTTATAACTGG + Intergenic
957141779 3:76368790-76368812 TCAGAATCTGAATGTATAGCAGG + Intronic
958706209 3:97659121-97659143 TGGGAATCCCAATTTAAGTCTGG - Intronic
961100049 3:124190964-124190986 TGCGAACCCCAATTTTTAGCTGG - Intronic
962653170 3:137516655-137516677 TCTGAATCCTAATGTATAGATGG - Intergenic
963154944 3:142086410-142086432 GAGGAACCCCAATTTATAGCTGG - Intronic
964659733 3:159106790-159106812 CGGGAACCCCAATTCATAGCTGG - Intronic
965082580 3:164053776-164053798 TGGAAATCCCAATGTGAAGCTGG - Intergenic
965884075 3:173423218-173423240 TTGTAATCCCAATGTATTGAGGG - Intronic
966694841 3:182778952-182778974 TGGGAACCCTGATTTATAGCAGG - Intergenic
970360844 4:15307608-15307630 TTGTAATCCCCATGTATAGAGGG - Intergenic
971256594 4:25019717-25019739 TGGAATTCCAAATGGATAGCTGG - Intronic
973239236 4:47939527-47939549 TGGGAACTCCAATTTATAGCTGG + Intronic
973755415 4:54068876-54068898 TGGGAACCCCAATTTATAGCTGG - Intronic
976661085 4:87541251-87541273 TGGCAATTACAATTTATAGCTGG + Intergenic
977715983 4:100184549-100184571 TGGGAACCCTAATTTATAGCAGG - Intergenic
977721589 4:100245321-100245343 TGCAAATCCCATTTTATAGCTGG + Intergenic
978514246 4:109554401-109554423 TGGGAGGCCCAATGGATAACAGG + Intergenic
979465408 4:121031959-121031981 TGGCTATCCCACAGTATAGCGGG - Intergenic
981188011 4:141827976-141827998 TGGGAATCACGATCTATTGCTGG + Intergenic
981595648 4:146418873-146418895 TGGGAACCCTGATTTATAGCTGG - Intronic
984232491 4:177115622-177115644 TGGGAACCCCAATTTATAGCTGG + Intergenic
984500949 4:180557898-180557920 TAGGAATCACAAAATATAGCGGG + Intergenic
985608013 5:869037-869059 TGGGAACCCCATTTGATAGCTGG - Intronic
991734786 5:69621718-69621740 TAGAAATCCCAATATTTAGCTGG - Intergenic
991780192 5:70125000-70125022 TAGAAATCCCAATATTTAGCTGG + Intergenic
991811220 5:70476853-70476875 TAGAAATCCCAATATTTAGCTGG - Intergenic
991859479 5:71000429-71000451 TAGAAATCCCAATATTTAGCTGG + Intronic
991872639 5:71125323-71125345 TAGAAATCCCAATATTTAGCTGG + Intergenic
992144865 5:73835730-73835752 TGGGAACCCCATTTTATAGCTGG + Intronic
993715176 5:91269146-91269168 TGGGATCCCCAGTTTATAGCTGG + Intergenic
995599521 5:113780376-113780398 TGGGAACCCCAATTTATAGCTGG + Intergenic
998605703 5:143632545-143632567 TGGGAATCCCAACTTGAAGCTGG - Intergenic
999074749 5:148783671-148783693 TGGGAGTTCAAATGTTTAGCAGG + Intergenic
1000273031 5:159704961-159704983 TAGGAACCCTAATTTATAGCTGG - Intergenic
1000611700 5:163382245-163382267 TGAGAATCCCAATGAACACCTGG + Intergenic
1003352319 6:5329644-5329666 GGGGACCCCCAATTTATAGCTGG - Intronic
1003773337 6:9332350-9332372 TGGAAACTCAAATGTATAGCTGG + Intergenic
1004590933 6:17050911-17050933 TGGGAACCCCAAATTATAGCTGG + Intergenic
1004832306 6:19490225-19490247 TGGGAATCCCAATTTATACCTGG + Intergenic
1005976605 6:30804888-30804910 TGGGAATCCCAACTTGAAGCTGG - Intergenic
1009436203 6:63621115-63621137 TGGGAATCCCAGTTTATAGTTGG - Intergenic
1010240947 6:73614949-73614971 TGGGAACCCTGATTTATAGCCGG + Intronic
1011821700 6:91260740-91260762 TGGGAACCCTGATTTATAGCTGG + Intergenic
1012540003 6:100351606-100351628 TAGAAACCCCAATTTATAGCTGG + Intergenic
1012860802 6:104556774-104556796 TGGGAACTCCAATTCATAGCCGG + Intergenic
1013071942 6:106737425-106737447 TGGGAACCCCAATTTATAGCTGG - Intergenic
1013127347 6:107197179-107197201 TGGGAGCCCCACTTTATAGCAGG + Intronic
1013604726 6:111737377-111737399 TGGAGATCCCGATTTATAGCCGG - Intronic
1014207065 6:118667438-118667460 TGGGCATCTTAATGTAAAGCTGG + Intronic
1014214424 6:118738910-118738932 TGGGGATCCCAGTGTACAGCTGG + Intergenic
1014492353 6:122078125-122078147 TGGGAACCCTGATTTATAGCTGG + Intergenic
1015740216 6:136446022-136446044 TGGGAACCCCAATTTATAGCAGG - Intronic
1016825614 6:148385957-148385979 TGGGAACCCTAATTTGTAGCAGG + Intronic
1020407336 7:7852484-7852506 TGGGAACCCCAACTTAAAGCTGG - Intronic
1020766490 7:12328409-12328431 TGGGAACTCTAATTTATAGCTGG + Intergenic
1020862765 7:13515651-13515673 TGGAAACCCCGATTTATAGCTGG - Intergenic
1021115195 7:16739305-16739327 TGGGAAACCCAATTTGAAGCTGG + Intergenic
1021878255 7:25068957-25068979 TGGGAGTCACAGTGTATAGATGG + Intergenic
1024331785 7:48162249-48162271 TGGGAACCCCAACATAAAGCTGG - Intergenic
1029542083 7:101189587-101189609 TGGGACCCCCAGTATATAGCCGG - Intergenic
1029791181 7:102844821-102844843 TGGGAACACTAATATATAGCTGG - Intronic
1030780847 7:113598011-113598033 TGGGAATCCTGATTTATAGCTGG + Intergenic
1032209811 7:129903032-129903054 TGGGAAGCCAAATGCAGAGCAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036533999 8:9627357-9627379 TGGGAACCCCAATTTATAGCTGG + Intronic
1038726164 8:30084230-30084252 TGGAAACCCTAATTTATAGCTGG - Intergenic
1039878279 8:41606182-41606204 TGGGAACCCCGATTTATAGCTGG + Intronic
1040932344 8:52748220-52748242 TGGGAATTCCAATTTATAACTGG - Intergenic
1042076498 8:65001094-65001116 TGGGAACCCCAATTTATAGCTGG + Intergenic
1042488943 8:69377535-69377557 TGGGAACCCCAATTTATAGCTGG - Intergenic
1042539317 8:69892267-69892289 TTGTATTCCCAATGTCTAGCAGG + Intergenic
1043603968 8:81976807-81976829 TTGCAATCCCCATGTATAGAGGG - Intergenic
1044765959 8:95574263-95574285 TGGGGATTCCAATATATAGCTGG - Intergenic
1044831089 8:96250020-96250042 TGGTATTCCCAATGCCTAGCAGG + Intronic
1047218157 8:122895960-122895982 TGGTAATCCTAATGAATTGCAGG - Intronic
1048154821 8:131936607-131936629 TGGGAATCCTGATTTATAGCTGG - Intronic
1050412404 9:5380853-5380875 TTGTAATCCCTATGTATAGAGGG + Intronic
1052181019 9:25527969-25527991 AGTGAATGCCAATGTATAGGAGG + Intergenic
1052407663 9:28082964-28082986 TGGGAGTACCAAAGTATACCTGG - Intronic
1052816994 9:33109474-33109496 TAGAAACCCCAATTTATAGCTGG + Intronic
1054781560 9:69170809-69170831 TGGGAATGCCAATATTTAGGGGG - Intronic
1057424414 9:94936781-94936803 TGGGAACCCCAATTTATAGTTGG - Intronic
1057542525 9:95988912-95988934 TGGGAACCCTGATTTATAGCTGG - Intronic
1057711454 9:97449411-97449433 TGGGAACCCCAATTTGAAGCTGG - Intronic
1058551855 9:106123307-106123329 TAAGAACCCAAATGTATAGCTGG + Intergenic
1059708858 9:116848954-116848976 TGGGAACCCTGATTTATAGCTGG - Intronic
1060961687 9:127685144-127685166 GGGGAACCCCAATCTTTAGCGGG + Intronic
1190280689 X:48927453-48927475 TGGGAATCCCAATTTATAGCTGG - Intronic
1190632847 X:52405400-52405422 TGGAAAACTCAATTTATAGCTGG - Intergenic
1190684719 X:52861568-52861590 TGGGAAATTCAATTTATAGCTGG - Intergenic
1195303343 X:103554435-103554457 TGAGAATCCCATTGTATCTCTGG - Intergenic
1197210627 X:123825431-123825453 TGGGAACCCCAACTTAAAGCCGG + Intergenic
1198853102 X:140986747-140986769 TGGGAACCCCAATTTATAGCTGG - Intergenic
1200301869 X:154984534-154984556 TGGGGATCTTAATGTATAGTAGG - Intronic