ID: 1126342440

View in Genome Browser
Species Human (GRCh38)
Location 15:47656225-47656247
Sequence ATAGAAACACATATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 4, 2: 22, 3: 194, 4: 609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126342437_1126342440 9 Left 1126342437 15:47656193-47656215 CCAACAGTATATACGAAATAAGG 0: 1
1: 0
2: 1
3: 19
4: 154
Right 1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG 0: 1
1: 4
2: 22
3: 194
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126342440 Original CRISPR ATAGAAACACATATCAAACA AGG Intronic
900961704 1:5926351-5926373 ATAGTAATACATAATAAACATGG - Intronic
902794850 1:18794457-18794479 ACAGAAACACATACCAAGAAAGG - Intergenic
903568759 1:24288486-24288508 ATAGAATCACACATAAAACAAGG - Intergenic
903615784 1:24655135-24655157 AATCAAACACATATGAAACATGG + Intronic
904925202 1:34042174-34042196 ATAGAAAAACATAGAAGACAGGG + Intronic
905098073 1:35492704-35492726 ATAAAAACTCACATCAAACTAGG + Intronic
905492071 1:38352405-38352427 CCAGAAAAACATAACAAACATGG + Intergenic
905696556 1:39978952-39978974 ATAGAAGCACATGTAAAACATGG + Intergenic
906010407 1:42518960-42518982 ATAAAAACACTTAACAAACATGG - Intronic
906555019 1:46703445-46703467 ACAGAAATACATATACAACAAGG - Intronic
907557239 1:55354884-55354906 ATAGCAAGACAAATCAGACATGG - Intergenic
908551330 1:65211795-65211817 ATAGAAACACTTAAAAAATAAGG + Intronic
908859495 1:68467272-68467294 ATAGAAATAAATATAAAATAAGG - Intergenic
908903049 1:68978368-68978390 ATAAAAAGACAAATTAAACATGG - Intergenic
909257106 1:73438316-73438338 ATACAAACACATATCTGACAAGG - Intergenic
909925289 1:81431178-81431200 ACACAAACACAAAGCAAACACGG - Intronic
910173750 1:84405883-84405905 ATACAAACATAGACCAAACATGG - Intronic
910239869 1:85074797-85074819 ACAGAAATACACATAAAACAAGG - Intronic
910819506 1:91330683-91330705 AGACAAAGACATATCAAAAAAGG + Intronic
911035743 1:93545020-93545042 ACAGAAACACAAATAAAAAAAGG - Intronic
911868055 1:103053136-103053158 ATAGAAATCCAAATTAAACAGGG + Intronic
911870549 1:103092463-103092485 ACACAAACACAGATCATACATGG + Intronic
911903739 1:103538538-103538560 ACATAAACACATATCAAACAAGG + Intronic
911909643 1:103616612-103616634 ATAGAAAACAATATAAAACAAGG + Intergenic
912037725 1:105342569-105342591 ATATAAACACTCATAAAACAAGG - Intergenic
912343820 1:108945062-108945084 ACAGAAACACACATAAAACAAGG - Intronic
912989242 1:114467666-114467688 AAACAAACACAAGTCAAACAAGG + Intronic
913204326 1:116522493-116522515 ACAGAGACACACATAAAACAAGG + Intronic
913376951 1:118163239-118163261 ATAGAAACACTTATAATACAAGG + Intronic
914885462 1:151580975-151580997 ATAGAAAAACAAATCAGTCATGG + Exonic
914895909 1:151672453-151672475 AGACAAAGACATATCAAAAAAGG - Intronic
915387866 1:155512745-155512767 AAAAAAACACATATCAAGCTGGG + Intronic
915683952 1:157611886-157611908 ATATATACACATATAAAACATGG - Intergenic
916524389 1:165595920-165595942 AGATAATCACATATCAAAAAAGG + Intergenic
917127766 1:171705166-171705188 ACAGAAACACATATAAACCAAGG - Intronic
918259711 1:182784534-182784556 ATAGAAACAGAAATGAGACATGG - Intergenic
918377946 1:183928056-183928078 ACAGAAGCACAAATCGAACAGGG - Exonic
918396374 1:184117375-184117397 ATAGTAACACATAAAAACCATGG + Intergenic
918571266 1:185996187-185996209 ACAGAAAGACAAATCAAACAAGG + Intronic
918770709 1:188555510-188555532 ATAGAAAAATGTATAAAACAAGG + Intergenic
919816895 1:201447040-201447062 ACAGAAACACATATAATACAAGG - Intergenic
920265458 1:204718429-204718451 ACAGAAACACACACAAAACAAGG + Intergenic
920599257 1:207306121-207306143 ATAGAAATACCTAGCAAATAAGG - Intergenic
921049027 1:211497966-211497988 ATAGAAATGCACATAAAACAAGG + Intergenic
921080341 1:211733916-211733938 GCAGAAACACACATAAAACAAGG - Intergenic
921159241 1:212461480-212461502 ATAGAAATACACATAAAACAAGG - Intergenic
921668834 1:217904442-217904464 ACAGAAACACACATAAAACAAGG + Intergenic
922144537 1:222926576-222926598 AAAGAAACACACATAAAACAAGG - Intronic
922301701 1:224307276-224307298 ATAGATTCACATACCTAACAGGG + Intronic
922989965 1:229898445-229898467 TTAGTAAAACATATAAAACAGGG - Intergenic
923128612 1:231055434-231055456 ACAGAAACACTCATGAAACAAGG + Intergenic
923199547 1:231698126-231698148 ACAGAAACACACATAGAACAAGG + Intronic
923463135 1:234224534-234224556 ACAGAAACACATTTGTAACATGG - Intronic
923839909 1:237658698-237658720 ATAGAACTACATATAAAACCTGG - Intronic
924280844 1:242435616-242435638 ACAGAAACACACATAAAACAAGG + Intronic
924377516 1:243428707-243428729 ACACAAACACAGATCATACATGG + Intronic
924407241 1:243760933-243760955 ACAGAAACACACATAAAACCAGG + Intronic
1062881793 10:984946-984968 AAACAAACAAATACCAAACAAGG + Intergenic
1062903312 10:1162087-1162109 ATAGAAACACACATTACAGAAGG + Intergenic
1063754666 10:8994163-8994185 ACAGAAACACACATAAAACAAGG + Intergenic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1064389044 10:14925560-14925582 ACAGAAACACACATAAAACAAGG - Intronic
1064399660 10:15011237-15011259 TTAGAAAAACATATCACTCATGG - Intergenic
1065068268 10:21995783-21995805 TCAGAAACACTTATCAAATATGG + Intronic
1065073648 10:22053861-22053883 ATAGAAAAATCTATCAAACTAGG - Intergenic
1065227932 10:23565354-23565376 ATAGAAACATCTATGAAACAAGG - Intergenic
1065309958 10:24405739-24405761 AGAGAAACAAATGCCAAACAGGG + Intronic
1065648507 10:27863080-27863102 ACAGAAATACACATAAAACAAGG - Intronic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1066706104 10:38179679-38179701 ATAGAAACAAAGAGCAAACTGGG + Intergenic
1068055921 10:52012850-52012872 ATATAATCACATCTCACACATGG - Intronic
1068495251 10:57778267-57778289 ATAGATACACTTATGTAACATGG + Intergenic
1068612468 10:59075396-59075418 ATAGAAACATACATAAAACAAGG - Intergenic
1069210393 10:65751131-65751153 ATAGAAACACACATAAAATAAGG + Intergenic
1069335502 10:67344696-67344718 ATAAAATCACATATGAAAAAGGG - Intronic
1069499207 10:68935324-68935346 ATAAAAACACATATAAAAATAGG - Intronic
1069917153 10:71794308-71794330 AAAGAAATGCATATTAAACAAGG - Intronic
1071073267 10:81720179-81720201 ATAGAAACTCTTAGCAAACTAGG + Intergenic
1071811010 10:89180825-89180847 ACAGAAACACACATAAAACAAGG + Intergenic
1072099213 10:92213695-92213717 AATGAAACACAAAACAAACATGG + Intronic
1072351261 10:94559797-94559819 ACAGAAACACAAATAAAACAGGG + Intronic
1072548961 10:96462636-96462658 ACAGAAACACACATAAAACAAGG - Intronic
1073679960 10:105692409-105692431 ATAGGGAAACATACCAAACAAGG - Intergenic
1073822808 10:107284304-107284326 AGAGAAAGACACATCAAGCAAGG - Intergenic
1073928187 10:108541996-108542018 ATGGAAACACATATTAAACCTGG + Intergenic
1074629362 10:115233692-115233714 ATATAAACCCTTATCAAACCAGG - Intronic
1075249820 10:120856976-120856998 ACGGAAACACATATAAAGCAAGG - Intronic
1075260624 10:120960696-120960718 ACAGAAACACACATAAAACACGG - Intergenic
1075448339 10:122529431-122529453 ATAAAAACACATTACAAAAATGG - Intergenic
1075903367 10:126061276-126061298 ATAGAACCACATATATTACATGG + Intronic
1076183508 10:128429293-128429315 AAAGAAATACATATTGAACATGG + Intergenic
1076703328 10:132285555-132285577 ATCAAAGCACATTTCAAACAAGG + Intronic
1077920004 11:6634532-6634554 ACAGAAACACACATCAAACAAGG - Intronic
1078494960 11:11808645-11808667 ATCAAAACAAAAATCAAACAAGG + Intergenic
1078793392 11:14567994-14568016 ACAGAAACACACATAAAACTAGG + Intronic
1079299469 11:19264907-19264929 ACAGAAACACACATAAAACAAGG + Intergenic
1079475567 11:20825816-20825838 TGAGAAACACATTTCAAACCTGG + Intronic
1079483251 11:20906248-20906270 CTAGAAACACATAACCAACCAGG + Intronic
1079676064 11:23228262-23228284 ATATATACACATTTGAAACAGGG - Intergenic
1080233560 11:30044668-30044690 ATAGATATACATATCCAAAATGG + Intergenic
1080360942 11:31512852-31512874 ATAGAACCATATATCTAACCTGG + Intronic
1080489588 11:32748924-32748946 AAAGAAACAAATAACATACATGG - Intronic
1080856804 11:36118874-36118896 ATAGAAACAGAAATCAAACTGGG - Intronic
1080943563 11:36946526-36946548 ATACAACTACACATCAAACAAGG + Intergenic
1081011223 11:37814390-37814412 ATAGAAACGCACATAAATCAAGG - Intergenic
1081138678 11:39471036-39471058 ATAAAAACACATAGCAATTAGGG + Intergenic
1081748619 11:45490789-45490811 ACAGAAACACCCATAAAACAAGG + Intergenic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1082776769 11:57251315-57251337 ATAGCAACACAAAACAAACTAGG - Intergenic
1083817225 11:65141160-65141182 ATAGAACCACATATCCATTAGGG + Intergenic
1084314281 11:68335379-68335401 TTAGAAACACACATAAGACAAGG - Intronic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085654076 11:78296335-78296357 ACAGAAACACATATAAAACGAGG - Intronic
1086047928 11:82554601-82554623 ATAGAAAAAAATATCAAAATTGG + Intergenic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087072258 11:94092778-94092800 AAAGAAACAGACATAAAACAAGG + Intronic
1087355575 11:97089533-97089555 ATAAAATTACATATAAAACATGG - Intergenic
1087494602 11:98874555-98874577 TTAGAAACATATATCACAAATGG + Intergenic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1088390056 11:109304435-109304457 ACAGAAACACACATAAAACAAGG + Intergenic
1088464537 11:110120237-110120259 ACAGAAACACACATAAAACAAGG - Intronic
1088562559 11:111130602-111130624 ACAGAAACATATATAAAACAAGG - Intergenic
1088570178 11:111215136-111215158 AAAGAAACAAATAACATACAAGG + Intergenic
1088605209 11:111523408-111523430 ACAGAAACACACATAAAACAAGG + Intronic
1090428358 11:126626122-126626144 ATAGAAACATGTATCTCACAGGG - Intronic
1090592043 11:128282536-128282558 ATAGAAACATACATAAAGCAAGG + Intergenic
1090931056 11:131298462-131298484 ATAGAACCACATAAAAGACAAGG - Intergenic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1091357126 11:134945768-134945790 ATAGAATCACAATTCAAACCTGG + Intergenic
1091492642 12:946451-946473 ACAGAAGCACACATAAAACAAGG - Intronic
1091678532 12:2509488-2509510 ATAGAAACACACTTAAAACAAGG - Intronic
1092326556 12:7537594-7537616 AAAGAAGCAAATAACAAACAAGG - Intergenic
1092438211 12:8470976-8470998 ATAAAAACACTCAGCAAACAAGG - Intronic
1092916791 12:13196684-13196706 ATAGAAACTCCTTTAAAACACGG + Intergenic
1093269718 12:17045049-17045071 ACAGAAATACACATGAAACAAGG + Intergenic
1093504523 12:19849746-19849768 ACAGAAACACACATAAAACAAGG + Intergenic
1093589850 12:20888871-20888893 ATAAAAACACTTACCAAACTAGG - Intronic
1093707802 12:22294673-22294695 AGAGAAACACAAATTACACATGG - Intronic
1093912892 12:24767514-24767536 ACAGAAACATACATAAAACATGG + Intergenic
1094166799 12:27451461-27451483 ACAGAAACACATATAAAACGAGG - Intergenic
1094180164 12:27584098-27584120 ACAGAAACACACATAAAACAAGG - Intronic
1094248605 12:28332733-28332755 ACAGAAACACACATAAAACAAGG - Intronic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1094670150 12:32562334-32562356 ATAGAAACACTTTTCCCACATGG - Intronic
1094781135 12:33793276-33793298 GTAAAAACACATAGCAAACATGG - Intergenic
1095220952 12:39613792-39613814 ATAAAATCACATATACAACATGG - Intronic
1095695414 12:45138202-45138224 ATAACAGCACCTATCAAACAAGG + Intergenic
1096040597 12:48512550-48512572 ACAGAAGCACACATAAAACAAGG + Intronic
1096399435 12:51293057-51293079 ACAGAAACTCACATAAAACAAGG + Intronic
1096563069 12:52451094-52451116 ATAGAAACAACTGTAAAACATGG - Intronic
1096565221 12:52472754-52472776 ATAGAAACAACTGTAAAACATGG - Intronic
1097448126 12:59700154-59700176 ACAGAAACACACATAAAACAAGG + Intronic
1098006826 12:66006366-66006388 ACAGAAACACATACAAAGCAAGG + Intergenic
1098221611 12:68275693-68275715 ACAGAAACACACATAAAACAAGG - Intronic
1098359455 12:69640711-69640733 ATAAAACCAAATTTCAAACATGG - Intergenic
1098928097 12:76376015-76376037 ATAGAAGCATATATAAAACAAGG + Intronic
1099571320 12:84322538-84322560 ATAGATACACTTATGTAACAGGG - Intergenic
1099808557 12:87550987-87551009 AGACAAAGACATATCAAAAAAGG + Intergenic
1100512883 12:95294399-95294421 TTAGAAACAGAAATCCAACAAGG - Intronic
1100573494 12:95865941-95865963 ATAGTAATTCATATCATACATGG + Intronic
1100873790 12:98941131-98941153 ACAGAAACACATATAAAACAAGG - Intronic
1101307847 12:103547552-103547574 ATAGAAAAACAAATTAGACATGG + Intergenic
1101584121 12:106069596-106069618 ACAGAGACACACATAAAACAAGG + Intronic
1102422036 12:112811159-112811181 ACAGAAACACACATAAAACAAGG - Intronic
1102976962 12:117213705-117213727 ATAGCAAGACACAACAAACAGGG + Exonic
1103629743 12:122250422-122250444 GCAGAAACACATATAAAACTGGG - Intronic
1105580441 13:21690999-21691021 ACAGAAACACACATAAAACAAGG + Intronic
1106749525 13:32746441-32746463 ACAGAAACATACATAAAACAAGG - Intronic
1106808285 13:33333724-33333746 CAAGAAACACTTATGAAACATGG + Intronic
1107059431 13:36141262-36141284 ACAGAAACACATACAAAACAAGG + Intergenic
1107096087 13:36537539-36537561 ATAAATACCAATATCAAACAAGG + Intergenic
1107154125 13:37146456-37146478 ATACAACCACAAATCAGACATGG - Intergenic
1107282860 13:38756341-38756363 ATAGAAACACACATAAAACAAGG - Intronic
1107792849 13:44019489-44019511 ACAGAAACACATATAAAACAAGG + Intergenic
1108117329 13:47143712-47143734 ACAGAAACATATATAAAACAAGG - Intergenic
1108156349 13:47589250-47589272 AGAAAGACACATATCAAAAAGGG + Intergenic
1108165696 13:47690700-47690722 ATTGACACACAAAACAAACAGGG - Intergenic
1108621439 13:52188362-52188384 ATATAAATACATATCAAGAATGG - Intergenic
1108665201 13:52623183-52623205 ATATAAATACATATCAAGAATGG + Intergenic
1108687053 13:52828917-52828939 ATAGAAATATATACCAAAAAGGG + Intergenic
1109048748 13:57449533-57449555 CTAGCAACAGATATCCAACATGG + Intergenic
1109380617 13:61554806-61554828 ATTGAAATACATTTCAAACATGG - Intergenic
1109522347 13:63530758-63530780 AAAGAAACAAATAACATACAAGG - Intergenic
1109604994 13:64681643-64681665 ATAAAAACACACAACAAACTAGG - Intergenic
1109727078 13:66355686-66355708 ACAGAAACACACATAAAACAAGG + Intronic
1109762970 13:66854850-66854872 ACAGAAACGTATATAAAACAAGG + Intronic
1109871081 13:68334734-68334756 ACAGAAACACACATAAAACAAGG - Intergenic
1109993007 13:70083579-70083601 CTACAAAAAGATATCAAACAGGG + Intronic
1110014512 13:70384880-70384902 ATAGAACCACATTATAAACAAGG - Intergenic
1110443063 13:75546968-75546990 ACAGAAATACACATAAAACAAGG - Intronic
1110776037 13:79409098-79409120 AAAGAAACACACATAAAACAAGG - Intergenic
1110894047 13:80726818-80726840 ATATAAACTCATTTCAAATAGGG + Intergenic
1111056190 13:82953720-82953742 ATAGCAACACCTCTCCAACACGG + Intergenic
1111265788 13:85811351-85811373 AAAGAAACACACGTAAAACAAGG + Intergenic
1111346569 13:86964148-86964170 CTCGGAACAAATATCAAACATGG + Intergenic
1111440191 13:88272439-88272461 ATACAGACACATTTAAAACAGGG + Intergenic
1111845641 13:93505376-93505398 ACAGTAACACACATAAAACAAGG - Intronic
1111910462 13:94305292-94305314 ACAGAAACACACATAACACAAGG - Intronic
1112057422 13:95703174-95703196 ACAGAAACACACAGAAAACAAGG - Intronic
1112121552 13:96417914-96417936 ACAGAAACACACATAAAACAAGG - Intronic
1112271459 13:97974178-97974200 ATAGAAACACATATCGCAACAGG + Intronic
1112714362 13:102166769-102166791 ATAGAAACACATATTAAACAAGG + Intronic
1112854862 13:103755945-103755967 ATATAAACACAAACCATACATGG + Intergenic
1113169594 13:107485461-107485483 ACAGCAACACATTTTAAACAAGG + Intronic
1113285301 13:108840071-108840093 GTAGAACCAGACATCAAACATGG + Intronic
1113447120 13:110377749-110377771 ATAGAAAAACATGTTAAAGAAGG + Intronic
1113578149 13:111408952-111408974 ATAGAAACAAACATTAAACAAGG + Intergenic
1113979188 13:114258663-114258685 ATAGAAACACACATAAAACAAGG + Intronic
1114150734 14:20036105-20036127 ATAGGAACACTTATCCAACTAGG + Intergenic
1114184828 14:20392818-20392840 AAAGAAACACACATGAAATAAGG + Intronic
1114541117 14:23460007-23460029 ATAAAAACACTTAACAAACTAGG + Intergenic
1115019829 14:28663180-28663202 ACAGAAACACACATCCAACAGGG - Intergenic
1116032888 14:39593995-39594017 ATAAAAACACAAATAAAACAAGG - Intergenic
1116248037 14:42443120-42443142 ATATAAACACGTATCAAAAAAGG + Intergenic
1116274356 14:42811341-42811363 AAAGAAAAAAATATAAAACAGGG - Intergenic
1116798903 14:49421899-49421921 ATAGACTCACATATCAACCTAGG - Intergenic
1116827990 14:49690544-49690566 ATAAAAACACACATAAAACAAGG - Intergenic
1116900703 14:50359978-50360000 ACAGGAAAACATATCAATCATGG + Intronic
1117703870 14:58442577-58442599 ATTAAATCACCTATCAAACAAGG - Intronic
1118139323 14:63062817-63062839 AGGGAAACACATTTCAAAGAAGG - Intronic
1118259446 14:64233702-64233724 AAAGAAACACACATAAAACAAGG - Intronic
1118424500 14:65644772-65644794 ATAGAAACACACATAAAACAAGG - Intronic
1118718299 14:68575835-68575857 ATAGAAAGATATATTAATCAGGG + Intronic
1118959147 14:70512681-70512703 ATACACACACATATAAAACCAGG + Intergenic
1119135818 14:72218575-72218597 ACAGAAACACATGTAAAACAAGG - Intronic
1119329409 14:73783056-73783078 ATACAAAGATATATAAAACAGGG + Intronic
1119570965 14:75672048-75672070 ATAAAAACACACAACAAACTAGG - Intronic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120763218 14:88304863-88304885 ACAGAAACACACATACAACAAGG + Intronic
1120816595 14:88866267-88866289 AAAGATAAAAATATCAAACAGGG + Intronic
1120957499 14:90095863-90095885 TCAGAAGCACAGATCAAACACGG - Intronic
1121108935 14:91299146-91299168 ACAGAAACCCACATAAAACAAGG - Intronic
1121255876 14:92529932-92529954 ACAGAGACACACATAAAACAAGG + Intronic
1121366670 14:93318640-93318662 ATAAAAACACAAATCAGACTGGG + Intronic
1123980130 15:25594588-25594610 ACAGAAACACACATAAAACAAGG + Intergenic
1124006021 15:25796105-25796127 ATAGCAACACAAAACGAACAGGG + Intronic
1124364044 15:29059634-29059656 ACAGAAACACACATAAAACAAGG + Intronic
1124411217 15:29438861-29438883 ACAGAAACACACATGAAACAAGG + Intronic
1125016535 15:34942704-34942726 ATAGAAACACACATAAAATAAGG + Intronic
1125493298 15:40165436-40165458 ATAGAAATACATTTTATACAGGG + Intronic
1126342440 15:47656225-47656247 ATAGAAACACATATCAAACAAGG + Intronic
1126946445 15:53826767-53826789 AAAGTAAAACATATCAAAGATGG + Intergenic
1127053555 15:55109685-55109707 ATGGAAACAAACAACAAACAAGG - Intergenic
1127816106 15:62610376-62610398 ATAGAAACACACATAAAACAAGG - Intronic
1128274767 15:66344003-66344025 AAAGAACCACTTATGAAACATGG + Intronic
1128348808 15:66875363-66875385 ACAGAAACACACATGAAACAAGG - Intergenic
1128604280 15:69025159-69025181 ATAGAAACACACATAAAACAAGG - Intronic
1128859757 15:71057988-71058010 ACAGAAACACACATATAACAGGG + Intergenic
1128926236 15:71658726-71658748 GGAGAAATACATAGCAAACATGG + Intronic
1128937212 15:71757090-71757112 ATAGAAACACATTTCTGACAGGG - Intronic
1129285587 15:74522051-74522073 AAAGAAACACATGACAAACTGGG + Intergenic
1129633798 15:77292271-77292293 ACAGAAATACAGATAAAACAAGG - Intronic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1131444389 15:92484939-92484961 ACACACACACATATGAAACAAGG + Intronic
1131656405 15:94463758-94463780 ATAAAAACTCATAGCAAACTAGG - Intronic
1132366112 15:101258138-101258160 GGAGGAACACATATAAAACAAGG - Intergenic
1134817391 16:17217058-17217080 ATAGAAACACACATGCAACAGGG + Intronic
1134895542 16:17883244-17883266 ACAGAAACACACATAAAACAAGG + Intergenic
1135383768 16:22017274-22017296 TTAGAGAAGCATATCAAACACGG - Intronic
1137723842 16:50643737-50643759 ACAGAAGCACACATAAAACAAGG - Intergenic
1137969627 16:52971534-52971556 ATGGAAACACCCATGAAACAAGG - Intergenic
1137994059 16:53189346-53189368 ATAAAAACACAAAACAAACTAGG - Intronic
1138067463 16:53956991-53957013 ATAGAAATACATTTTAAATAGGG - Intronic
1138470992 16:57236188-57236210 ACAGAAACAAAGATCAAAAAGGG - Intronic
1138906709 16:61344623-61344645 ATAGAAACACATATAAATCTAGG + Intergenic
1140606643 16:76546905-76546927 TTAGAAGCAGATATCAAGCAAGG - Intronic
1140967649 16:79982874-79982896 ATAGATACACAAATAAAATATGG - Intergenic
1141775498 16:86120247-86120269 ACAGAAACACACATCATACAGGG - Intergenic
1141782499 16:86172969-86172991 ATATAATCAAATATGAAACAAGG - Intergenic
1142791891 17:2273201-2273223 ACAGAAACCCACATAAAACAAGG + Intronic
1142931467 17:3287708-3287730 AGAGAATTACCTATCAAACATGG - Intergenic
1143004465 17:3819575-3819597 AGAGAAACATATGTAAAACAAGG + Intronic
1144277920 17:13693316-13693338 ACAGAAACACACATAAAACAAGG + Intergenic
1144361434 17:14498237-14498259 AAACAAACAAATCTCAAACATGG + Intergenic
1149092658 17:52802915-52802937 AAAGAAACAAATAACATACAAGG - Intergenic
1149214008 17:54333229-54333251 AAAGCAACACATAGCATACAAGG - Intergenic
1149725546 17:58890158-58890180 GCAGAAACACATATAAAACAAGG - Intronic
1149885343 17:60334264-60334286 ATACAAACACAGATCGTACATGG - Intronic
1150573683 17:66411027-66411049 ATATATACAATTATCAAACATGG - Intronic
1150985901 17:70196899-70196921 AAAGTAAGACATATAAAACAAGG - Intergenic
1151409609 17:73913180-73913202 ATAGAAGCACACATCAATCTGGG + Intergenic
1152060824 17:78073737-78073759 ACAGAAAAACATATAAAACAAGG - Intronic
1152289880 17:79433889-79433911 ATAGAAACACCCTTAAAACAAGG - Intronic
1152974367 18:199770-199792 ACAGAAACACACATAAAACAAGG + Intronic
1153038400 18:786858-786880 ACAGAAACACACATATAACAAGG + Intronic
1153068450 18:1076626-1076648 ATGGAGACACATATTAACCATGG + Intergenic
1153227335 18:2908808-2908830 ATAGAAACAGACATAGAACAAGG - Intronic
1153329604 18:3860417-3860439 ATAAAAATACCTATCATACAGGG - Intronic
1153446908 18:5183808-5183830 ACAGAAACATATATTAAACAAGG - Intronic
1153821852 18:8838964-8838986 TGAGAAACACATAGCAAACAGGG + Intergenic
1154013853 18:10598732-10598754 ACAGAAACACAAATAAAACAAGG - Intergenic
1154134735 18:11766367-11766389 ATACAAACACAAATTAAAAATGG - Intronic
1154153097 18:11922427-11922449 ACAGAAACACAAATAAAACAAGG - Intergenic
1154497553 18:14973533-14973555 ATAGAATCACAATTCAAACCTGG - Intergenic
1154995246 18:21634477-21634499 ACAGAAACACTCATAAAACAAGG - Intergenic
1155051712 18:22153881-22153903 ACAGAAACACACATAAAACAAGG + Intergenic
1155473839 18:26217939-26217961 ATAGAAACACACATGAAATAAGG - Intergenic
1155789539 18:29948238-29948260 ATACAAACACAAACCATACATGG - Intergenic
1156019589 18:32584615-32584637 ACAAAAACACACATGAAACAAGG - Intergenic
1156708628 18:39914336-39914358 ATAGAAAAACATAACAAAGCTGG - Intergenic
1156999356 18:43506063-43506085 ATAAAAACTCACAACAAACAAGG - Intergenic
1157137194 18:45067792-45067814 TTAGAAGCACATATCAACCAAGG + Exonic
1157303793 18:46501601-46501623 ACAGAAACACACATAAAACAAGG + Intronic
1157572113 18:48719968-48719990 ACAGAAACACATACAAAACGAGG + Intronic
1158057599 18:53300585-53300607 ATAGAAACACACATAAAACAAGG + Intronic
1158162532 18:54501782-54501804 ACAGAAACACACATAAAACAAGG + Intergenic
1158817221 18:61116361-61116383 TTAGAAACACATAGAAAACAAGG + Intergenic
1159420841 18:68217299-68217321 ATTGAAACAATTATCAATCAGGG - Intergenic
1160020664 18:75178237-75178259 GCAGAAACACATATAAAACAAGG + Intergenic
1160367179 18:78336327-78336349 ACAGAAACACACATTATACAAGG + Intergenic
1161923498 19:7283907-7283929 ACAGAAACACACATAAAACAAGG - Intronic
1164659143 19:29948410-29948432 ATAAAAACTCATAGCAAACTTGG - Intronic
1165260361 19:34610490-34610512 ATAGAAACTCTTAACAAACCGGG - Intronic
1166883914 19:45947131-45947153 AGAGAAACACAAAATAAACAAGG - Intronic
1167170526 19:47828176-47828198 AGAGAAACCAATAACAAACAAGG - Intronic
1167188508 19:47965588-47965610 ACAGAAACACATATAAAAGAAGG + Intergenic
1167525559 19:49981572-49981594 ACAGAAACATACATAAAACAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167701835 19:51052992-51053014 AGAGAAACACACCTAAAACAAGG + Intergenic
1168382311 19:55934200-55934222 ACAGAGACACATATAAAACAAGG - Intergenic
1168427731 19:56252648-56252670 TAAGAAACAAACATCAAACATGG + Intronic
925784361 2:7415909-7415931 ATAGAAAAAAATAAGAAACAAGG - Intergenic
926705149 2:15831908-15831930 ACAGAAACACACCTCAAACAAGG - Intergenic
926726509 2:16002705-16002727 ACAGAAACACATGGAAAACAAGG - Intergenic
926802380 2:16670160-16670182 ACAGAAACACACATAAAGCAAGG - Intergenic
927906055 2:26858118-26858140 ATAAAGACAAATACCAAACATGG - Intronic
928160243 2:28916869-28916891 ATAGAAACAAACATAAAACAAGG - Intronic
928280964 2:29945964-29945986 ACAGAAACACACATAAAACAAGG + Intergenic
928858711 2:35830053-35830075 ATATAAACACATAGCAATTATGG + Intergenic
928948821 2:36796295-36796317 AGAAAAACACATGTAAAACAAGG + Intronic
929043219 2:37766980-37767002 TAAAAAACACAAATCAAACAGGG + Intergenic
929210582 2:39352551-39352573 ATACAAATACATACCAAACCGGG + Intronic
930247213 2:48996456-48996478 ATAGAAACATATATAAAACATGG - Intronic
930356101 2:50322452-50322474 ATGCAAACACATTTTAAACAAGG + Intronic
930395453 2:50817812-50817834 ATAAAAACACTTAACAAACTAGG + Intronic
930544699 2:52751555-52751577 ATATATATACATATAAAACATGG - Intergenic
930760844 2:55034014-55034036 ATAGAAAAACACATAAAACAAGG + Intronic
930902835 2:56528602-56528624 ATATACACACATATCAGGCATGG + Intergenic
931177442 2:59868213-59868235 ATAGAAACACACATACAACAAGG + Intergenic
931627063 2:64266094-64266116 ACAGAAACACACATAAAACAAGG - Intergenic
931799569 2:65745690-65745712 ACAGAAACACACATAAAGCAAGG - Intergenic
932079303 2:68697129-68697151 ATAGAAACATATATAAAACAAGG - Intronic
932476602 2:72010505-72010527 ATAGCAACACATTCCAAAGAAGG + Intergenic
933654023 2:84872794-84872816 GTAGAAGCACACATAAAACAAGG - Intronic
933670577 2:85003760-85003782 ATAAAAACATATATAAAATAGGG + Intronic
933850113 2:86359435-86359457 ATAGAAACACACATAAAGCAAGG + Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
935080817 2:99792039-99792061 ACAGAAACACACATACAACAAGG + Intronic
935103437 2:100018001-100018023 ACACACACACATATCAACCAAGG - Intronic
935873078 2:107472543-107472565 AGAGACACATATATCTAACAAGG - Intergenic
936098257 2:109550943-109550965 ATAGACAGACATATCAAATTGGG + Intronic
936441904 2:112561623-112561645 ACAGAAACACACAAAAAACAAGG - Intronic
936598321 2:113870898-113870920 ACAGAAACACACATAAAACAAGG + Intergenic
936605658 2:113950134-113950156 AAAGAAACACACATGAAACAAGG - Intronic
936632877 2:114222799-114222821 ATAAAAACAAATATCTAAGAAGG + Intergenic
937194200 2:120135546-120135568 AAAGAAACAAATAACATACAAGG + Intronic
937548456 2:123055282-123055304 ATAGAAACAAATATCAAAATAGG - Intergenic
937730906 2:125227744-125227766 ATAGAAACAAAAATGATACAGGG - Intergenic
938189278 2:129260612-129260634 AAATAAATACATATCAAAGATGG - Intergenic
938653212 2:133405206-133405228 ACAGAAACACACACAAAACAAGG - Intronic
938837013 2:135114627-135114649 ACAGAAACACACATAAAAGAAGG - Intronic
939201165 2:139036377-139036399 AAAGAAAAAAATATAAAACAAGG + Intergenic
939289460 2:140174982-140175004 ACAAAAACACATGTCAAAAATGG - Intergenic
939456453 2:142443374-142443396 ACAAAAACACATATAAAACAGGG + Intergenic
939676645 2:145080539-145080561 AAAGATCCAAATATCAAACAAGG - Intergenic
939722551 2:145672673-145672695 ATAGAAATCAATATCAATCAAGG - Intergenic
940069024 2:149664191-149664213 ACAGAAACACACATAAAACAAGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
940558233 2:155259839-155259861 ATAAAAACACTCATCAAACTAGG - Intergenic
940564472 2:155343326-155343348 ATAGCATCACATAACAAATAAGG + Intergenic
940623435 2:156143137-156143159 ATAAAAACACATATTACGCATGG + Intergenic
940952496 2:159692008-159692030 ATATAAACATAGATCATACATGG - Intergenic
941025920 2:160456053-160456075 AAAGAAATACAGATCAAACAGGG + Intronic
941038526 2:160594148-160594170 ATAAAAACACACAACAAACTAGG - Intergenic
941311644 2:163940084-163940106 AGAGAAACACACATGGAACAAGG + Intergenic
941658613 2:168171277-168171299 CAAGAAAGACATATCAAAGAAGG + Intronic
941973967 2:171383138-171383160 AAAGAACCATATATGAAACAGGG + Intronic
942168234 2:173263664-173263686 ATAGACACACATATATAAAATGG - Intronic
942341815 2:174957003-174957025 AGAGATACACATATAACACAAGG - Intronic
943040925 2:182803997-182804019 ACAGAAACACACATAAAACAAGG - Intergenic
943167718 2:184351539-184351561 ATAGAAATACAAAAGAAACAAGG + Intergenic
943445586 2:187983090-187983112 ACAGAAACACATATAAAACAAGG + Intergenic
944003440 2:194871420-194871442 ATGGAAACAAGTATCAAACTGGG + Intergenic
944072724 2:195691210-195691232 ATAGATACACATATATACCATGG - Intronic
944270302 2:197776398-197776420 ATGGAAAACCATATAAAACAAGG + Intronic
944275998 2:197838599-197838621 ATAGAAATACCTAGCATACATGG - Intronic
944437860 2:199710407-199710429 ACAGAAACACACATATAACAAGG + Intergenic
944519474 2:200549712-200549734 ATAAAAACACTTATCAAAATGGG + Intronic
944965038 2:204921789-204921811 ACAGAAAGAGATATCAAATAGGG + Intronic
945371823 2:209028017-209028039 ACAGAAACACACATAAAACAAGG - Intergenic
945680682 2:212910484-212910506 ATGGAAACACACATAAAAGAAGG + Intergenic
945741287 2:213665669-213665691 AAATAAACACACATAAAACAAGG - Intronic
945764935 2:213964024-213964046 ATGGAAGTACATATAAAACAAGG + Intronic
947306644 2:228755523-228755545 ACAAAAACAAAAATCAAACATGG + Intergenic
947479362 2:230483906-230483928 ACAGAAACACATATAAAACAAGG - Intronic
947788598 2:232848145-232848167 AAAGACACACACATAAAACAAGG - Intronic
947942944 2:234074767-234074789 ACAGAAACACACATAAAGCAAGG - Intronic
948014776 2:234679211-234679233 ATAGAAACACACATAAAACAAGG - Intergenic
948289227 2:236812666-236812688 ACAGAAACACACATAAAACAGGG - Intergenic
948558445 2:238834445-238834467 ATATAAAAACATATCAAAGCAGG - Intergenic
1168759677 20:341318-341340 AAAGAAACACATTTCCAAGAAGG - Intergenic
1169516648 20:6323303-6323325 ACAGAAACACACATAAAACAAGG - Intergenic
1170171776 20:13421925-13421947 ACAGAAACACATATAAAATAAGG - Intronic
1170339494 20:15307457-15307479 ACAGAACAACATAACAAACATGG - Intronic
1170498485 20:16950278-16950300 GCAGAAACACAAATAAAACAAGG + Intergenic
1170721834 20:18888208-18888230 ACATAAACACATGTAAAACAAGG + Intergenic
1170834711 20:19874280-19874302 CTAGAAACACACATAAAGCAAGG + Intergenic
1170884863 20:20331521-20331543 TTTTAAACACATTTCAAACATGG + Intronic
1172012645 20:31854926-31854948 ACAGAAACACACAGAAAACAAGG - Intronic
1172524419 20:35589986-35590008 AAACAAACACACATAAAACAAGG + Intergenic
1172648802 20:36488552-36488574 ACAGAGACACACATAAAACAAGG - Intronic
1174135732 20:48377719-48377741 ACAGAAACACACATAAAACAAGG - Intergenic
1177030063 21:15971319-15971341 AAAGAAAGAAATATAAAACATGG - Intergenic
1177040873 21:16108992-16109014 ACAGAAGCACACATAAAACAAGG + Intergenic
1177477363 21:21641477-21641499 ATATAAACACACATAACACAAGG + Intergenic
1178072163 21:28980364-28980386 ACAGAAACACACATAAAACAAGG + Intronic
1178143521 21:29712015-29712037 ATAAATACACATAGCAAAAAAGG - Intronic
1178784855 21:35644013-35644035 ATAGAAACACCTACAAAAGAAGG - Intronic
1178906365 21:36640322-36640344 AGTGAAACACAAATCAAAAAGGG + Intergenic
1179038453 21:37780942-37780964 AGAGAAAGAAATAACAAACATGG + Intronic
1179516511 21:41912060-41912082 ACAGACACACATATCATCCAGGG - Intronic
1181974067 22:26715853-26715875 ACAGAAACACACATAAAACTTGG - Intergenic
1182179180 22:28327505-28327527 ACAGAAGCACATATAAAAGAAGG + Intronic
1182805316 22:33064786-33064808 ATAGATACACATTTCAAGCTGGG - Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
1184181966 22:42835071-42835093 ATAGAAACACATGTTAAATAAGG + Intronic
949264004 3:2135945-2135967 AGAAAAAAACAGATCAAACATGG - Intronic
949388908 3:3537276-3537298 GTATAAATACATATTAAACAGGG + Intergenic
949491945 3:4597751-4597773 ATAGGATCACATATCACACCAGG - Intronic
950769005 3:15295988-15296010 ACAGAAACACACATATAACAAGG + Intronic
951087909 3:18536543-18536565 ATAGAAACACACATAAAACAAGG + Intergenic
951142241 3:19176914-19176936 ATAGAAATACACATAAAACAAGG - Intronic
951178393 3:19629137-19629159 AAAGAAAAACAAATCAGACACGG + Intergenic
951642289 3:24849533-24849555 ACAGAAACACACATAAAACAAGG - Intergenic
951992497 3:28691248-28691270 ACACAAACACATACAAAACATGG + Intergenic
952168219 3:30775322-30775344 AGAGAATCACAAATCAAATAAGG - Intronic
952559202 3:34569973-34569995 AGAAATACTCATATCAAACAAGG - Intergenic
953180876 3:40594107-40594129 ACAAAAACACACATTAAACAAGG - Intergenic
953372650 3:42403179-42403201 ATAGTAATATATAACAAACATGG + Intronic
953751656 3:45613254-45613276 ATAGAAGCACACATAAAACAAGG + Intronic
953873616 3:46649507-46649529 ATAGAAACCAGTAACAAACATGG + Intergenic
955944424 3:64178815-64178837 AAAGAAACACACATGAAACAAGG - Intronic
956237283 3:67087741-67087763 ATGCAAATACATATCAAAAAAGG + Intergenic
956385755 3:68717279-68717301 ACAAAAACACACATAAAACAAGG + Intergenic
956456337 3:69424124-69424146 ACAGAAACACACTTAAAACAAGG + Intronic
956967251 3:74476170-74476192 AGAGAAACACACACAAAACAAGG + Intronic
957381549 3:79436334-79436356 AAAAAAATACAAATCAAACATGG - Intronic
957656724 3:83088225-83088247 ACAGAAACACATATAAAACAAGG - Intergenic
957662297 3:83175823-83175845 AAATAAACCCCTATCAAACAAGG - Intergenic
957795438 3:84999316-84999338 ATAGAAACACACATACAAAAAGG - Intronic
957965377 3:87315878-87315900 ATAGAAATACACATAAAACATGG + Intergenic
957968954 3:87358890-87358912 ACAGAAATACAAATAAAACAAGG - Intergenic
958124100 3:89333191-89333213 ATGGAAACAAGTATGAAACAGGG - Intronic
958850275 3:99316469-99316491 ACAGACACACACATTAAACAAGG + Intergenic
959025329 3:101234241-101234263 ACAGAAACACACAGGAAACAAGG + Intronic
959348105 3:105225050-105225072 ATAGAAACAAATAATAAAAATGG - Intergenic
959389124 3:105751875-105751897 ATAGAAACATATCTGAAAAAAGG + Intronic
959497378 3:107067283-107067305 TTAGTAACACAAATAAAACATGG - Intergenic
960216040 3:115038366-115038388 ATACAAGCACATACAAAACAAGG + Intronic
960366193 3:116775782-116775804 ACAGAAAAACACATGAAACACGG + Intronic
960570585 3:119181775-119181797 CTAGAAAGACAAATAAAACAGGG + Intronic
961056734 3:123795144-123795166 AGAAAAACACATATCTTACATGG + Intronic
961775818 3:129284433-129284455 ACAGAAACACACATAAAACAAGG + Intronic
961931937 3:130543369-130543391 ATAGAAACAAGTAACAAATATGG - Intergenic
962062926 3:131950183-131950205 AAAGAAGCACACATAAAACAAGG - Intronic
962237487 3:133718842-133718864 ATAGAGACACATGTAAGACAAGG + Intergenic
962595475 3:136938736-136938758 AGAGAAACACACATAAAACAGGG + Intronic
964181921 3:153898434-153898456 TTAGAAACCCATTTCAAACCAGG + Intergenic
964284946 3:155108057-155108079 ACAGAAACACACATAAAACAAGG + Intronic
964804920 3:160598353-160598375 ATAGAATAACATATCCACCATGG - Intergenic
964871890 3:161321422-161321444 AAAGAAACAAATAACATACAAGG + Intergenic
964911888 3:161792721-161792743 ATAGAAATAGATAACAAACATGG + Intergenic
965452326 3:168853330-168853352 ATAAAAATACTTAACAAACAGGG - Intergenic
965979991 3:174677650-174677672 ACAGAAACACACATAAAACAAGG - Intronic
966294023 3:178396644-178396666 ATAGTAAAACTTCTCAAACAAGG - Intergenic
966331259 3:178817414-178817436 AAAGAAGCACATCTCAAAAATGG + Intronic
966394166 3:179484872-179484894 ACAGAAACACACATTAAACAAGG + Intergenic
966479769 3:180393922-180393944 ATAGAATCAGATATAAAACCTGG - Intergenic
967005869 3:185381806-185381828 ACAGAAGCACACATAAAACAAGG + Intronic
967272890 3:187745240-187745262 ATAGATACACATAGAAAACTTGG + Intronic
967460443 3:189739939-189739961 CCAGTAAAACATATCAAACAAGG - Intronic
967656729 3:192059290-192059312 ACAGAAACAAATATAAAACAAGG - Intergenic
968010239 3:195269812-195269834 TCAGAAACACATCTCAGACAAGG + Intronic
968032721 3:195515396-195515418 ATAGATACATATATGAAAGAAGG - Exonic
970413237 4:15831668-15831690 AAAGAAACAAATAGCATACAAGG - Intronic
971136157 4:23871046-23871068 ATTGAAAGACAAATTAAACAGGG + Intronic
971235766 4:24840844-24840866 ACAGAGACACACATAAAACAAGG + Intronic
971427184 4:26527823-26527845 ACACAAACACACATAAAACAAGG + Intergenic
971491898 4:27221575-27221597 ATAAAAACACTCAACAAACAAGG - Intergenic
971766355 4:30836969-30836991 CTTGAGACACATATAAAACATGG + Intronic
972064409 4:34922594-34922616 ACAGAAACACACATAAAACAAGG + Intergenic
972233127 4:37098424-37098446 ATAGAAACATACATAAAACAAGG - Intergenic
972477458 4:39464481-39464503 ATAGAAACACAACTGAAAAATGG - Intronic
973067552 4:45815894-45815916 ACAGAAACAAATATCCAAAATGG + Intergenic
973067622 4:45816665-45816687 ACAGAAACAAATATCCAAAATGG - Intergenic
973113177 4:46420849-46420871 ATAGAAAAAAATTTAAAACATGG - Intronic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
973181393 4:47273139-47273161 ATAGAGGCATATATTAAACAGGG - Intronic
973745282 4:53957994-53958016 ACAGAAACACACACAAAACAAGG + Intronic
973760638 4:54111957-54111979 ATAGAGACACACATAAAACAAGG - Intronic
974358813 4:60848376-60848398 ACTGGAATACATATCAAACATGG + Intergenic
974805530 4:66875219-66875241 ATAGAAATACATATAAAACAAGG - Intergenic
974829360 4:67171570-67171592 AAAAAAACACATCTCAAATATGG + Intergenic
975335219 4:73168735-73168757 ACAGAAACACACGTAAAACAGGG - Intronic
975719629 4:77237217-77237239 ATATAAACACAAACCAAACTGGG + Intronic
975814562 4:78204137-78204159 GTAGAAACACACATAAAACAAGG + Intronic
975828070 4:78340561-78340583 ATATAAAGACAAATCAAATATGG + Intronic
975846139 4:78527093-78527115 ACAGAAACAGACATAAAACAAGG + Intronic
975924677 4:79434370-79434392 ATAGAATCAGTTAACAAACAAGG - Intergenic
975928137 4:79484492-79484514 ATAGAAACACAAATTACACTGGG - Intergenic
976252055 4:83062798-83062820 ACAGAAACACACATAAAACAAGG + Intronic
976472766 4:85448715-85448737 AAAGAAACTCATATTACACAAGG + Intergenic
976511774 4:85919059-85919081 ATACACACACATATCACATATGG + Intronic
976740346 4:88349913-88349935 ACAGAAACACACATAAAACCAGG - Intergenic
976766182 4:88600407-88600429 ACAGAAACACACATAAAAAAAGG - Intronic
976835929 4:89373925-89373947 ACAGAAACACACACAAAACAAGG + Intergenic
977857777 4:101914654-101914676 ACAGAAACACACATAAAGCAAGG - Intronic
978181424 4:105800851-105800873 ATAGAAGCACATATAAAATAAGG - Intronic
978389484 4:108210038-108210060 ACAGAAACACATAGGAAACAAGG + Intergenic
978874862 4:113627472-113627494 ACAGAAACACACATAAAACTAGG - Intronic
979586603 4:122426792-122426814 ATAAAAACACTGAACAAACAAGG + Intronic
980409278 4:132394303-132394325 ATAAAAACAGATATTAAATATGG - Intergenic
980626370 4:135379900-135379922 ATCGCAACACCTCTCAAACAAGG - Intergenic
980652005 4:135728685-135728707 ATAGAAAAATATATATAACATGG + Intergenic
981223639 4:142266192-142266214 ATAGAACTACAAAACAAACAAGG + Intronic
981237663 4:142436866-142436888 ATAGCAACACCTCTCCAACAAGG + Intronic
981811894 4:148784798-148784820 ATAGAAAAACAAATCTTACATGG - Intergenic
981862274 4:149371104-149371126 ATATAATCCCTTATCAAACAGGG + Intergenic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
982561681 4:156935659-156935681 ACAGAAACACACATAAAATAAGG + Intronic
982892235 4:160869583-160869605 AAAGAACCACATAGCAAAAAGGG - Intergenic
983322956 4:166217155-166217177 ATTGAAACACAAAGAAAACAAGG - Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984135069 4:175926172-175926194 ATTCAAACACATTTAAAACATGG + Intronic
986080659 5:4389285-4389307 AAGGAAACACATAGGAAACATGG + Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986833090 5:11603870-11603892 AGAGAAGCAGATATCAAATATGG - Intronic
987131531 5:14864866-14864888 ATATACACACATATAAAAAATGG - Intronic
987401662 5:17484274-17484296 AAAGAAGCCCATATCAAACATGG + Intergenic
988060811 5:26166914-26166936 ATGAAAACACATATCTATCATGG + Intergenic
988113617 5:26855042-26855064 ATAAAAATATATATCAAAAAAGG + Intergenic
988150175 5:27367010-27367032 ATAAAAACACATTACATACAGGG + Intergenic
988432826 5:31139397-31139419 ACAGAAACACCTGTAAAACAAGG + Intergenic
988942280 5:36158619-36158641 ATGGAAACAGAAATCAATCAGGG - Intronic
989267566 5:39495356-39495378 AAAGAAACAAATATGAAGCATGG - Intergenic
989645223 5:43623584-43623606 ATCAAAACACATTTCAAAGATGG - Intronic
989691489 5:44150355-44150377 ACAAAAACACACATAAAACAAGG - Intergenic
990056016 5:51579389-51579411 ATATATATACATATTAAACAAGG + Intergenic
990227865 5:53676408-53676430 ACAAAAACACATATAAAACAAGG - Intronic
990441573 5:55851213-55851235 ACAGAAACACACACAAAACAAGG - Intergenic
990488563 5:56282347-56282369 AAAGACACACATATAAAACAAGG + Intergenic
991708028 5:69378666-69378688 ATAAAAACACATATACAACAAGG - Intronic
991732127 5:69599546-69599568 AAAAAAACAAATCTCAAACATGG + Intergenic
991808560 5:70454689-70454711 AAAAAAACAAATCTCAAACATGG + Intergenic
992524060 5:77588769-77588791 ACAAAAACACACATAAAACAAGG - Intronic
992643006 5:78785653-78785675 ATAGAAAGAAGTATAAAACAGGG + Intronic
993013981 5:82514870-82514892 ATAGAAGCTGATGTCAAACAAGG + Intergenic
993377968 5:87172047-87172069 ATAGAAAGACATATGAAAGTAGG + Intergenic
993651486 5:90528421-90528443 ATAGAAACAAGTATCTAAAATGG - Intronic
993722339 5:91334050-91334072 ACAGAAAAACACATAAAACAAGG + Intergenic
993980072 5:94533748-94533770 ATTCAAACACATATCAAAATAGG - Intronic
994587493 5:101728296-101728318 ATATCAACACATTCCAAACAAGG + Intergenic
994812832 5:104544247-104544269 ATAGAAACACACATAAAAAGTGG - Intergenic
994980570 5:106870824-106870846 ATAGAAGCAGATATTAAAGAGGG - Intergenic
995205027 5:109469819-109469841 AAAGAAACACAACTCAAACTGGG + Intergenic
995332528 5:110961147-110961169 AGAGAAGCACATAGCAAAGAGGG + Intergenic
995418854 5:111939892-111939914 AAAGAAACACATATAAGACAAGG + Intronic
995548411 5:113255539-113255561 ACAGAAACCCAAATCAAACTGGG - Intronic
995915928 5:117244754-117244776 ACAGAAACACACATAAAACAAGG + Intergenic
996048122 5:118899340-118899362 ACAGAAACACATGTAAAACAAGG + Intronic
996171550 5:120298697-120298719 ACAGAAACACACATAAAACAAGG + Intergenic
996592936 5:125168419-125168441 AGAGAAACAAATATAAAACAGGG + Intergenic
996768332 5:127058431-127058453 ATAGAATCACACATAAAATAAGG + Intronic
997018552 5:129967356-129967378 ATATATACACATATCTAAAATGG - Intronic
997058707 5:130476231-130476253 AAAGAAAAACAAATCAGACATGG - Intergenic
997106164 5:131021267-131021289 ACAGAAACACATGTAAAAGAAGG - Intergenic
997126899 5:131235993-131236015 ATATGAACACATATAAAAAACGG - Intergenic
997606859 5:135181200-135181222 ACAGTAACACACATAAAACAAGG - Intronic
997801940 5:136872374-136872396 ATACAAACACATATTAAAGCAGG + Intergenic
998429716 5:142060509-142060531 AGAGAAAGACTTATGAAACATGG - Intergenic
998563705 5:143196486-143196508 GCAGAAATACATATAAAACAGGG - Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
998733739 5:145110932-145110954 ATAACAACAAATACCAAACAAGG - Intergenic
998948927 5:147372045-147372067 ATGGTAACACATGTCAGACATGG - Intronic
999050561 5:148520015-148520037 GCACAAACACACATCAAACAAGG + Intronic
999083238 5:148863957-148863979 ATAGAAGCACAAGTCAAAAATGG + Intergenic
1000020386 5:157313245-157313267 ACAGAAGCACATATAAAACAAGG - Intronic
1001405329 5:171472705-171472727 ACAGAAACACACATACAACAAGG - Intergenic
1001411113 5:171512723-171512745 ATAGAAACACATCCCTGACATGG + Intergenic
1003756188 6:9123280-9123302 AGGGAAACACACATAAAACAAGG + Intergenic
1004064555 6:12230344-12230366 ACAGAAATACACATAAAACAAGG - Intergenic
1004109581 6:12703345-12703367 ATAGAAGCATACATCAAAAAGGG - Intergenic
1004303386 6:14478352-14478374 ATAGATACAGAATTCAAACATGG - Intergenic
1004769691 6:18768236-18768258 ATAGAAAAACATTTCAAGAAAGG + Intergenic
1005132606 6:22527303-22527325 ATAAAAACATATATAAAACAAGG + Intergenic
1005881602 6:30066791-30066813 AGAGAAACCCAGACCAAACAAGG + Intronic
1005967606 6:30738589-30738611 ACAGAAACACATATAAAGCAAGG - Intronic
1006203065 6:32314095-32314117 ATAGGAACACATATAAAGAAAGG - Intronic
1006900467 6:37497319-37497341 ACAGAATCACACATGAAACAAGG - Intronic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008169340 6:48183286-48183308 ATAAAAATACATATAAAATAAGG - Intergenic
1008169967 6:48192648-48192670 AGAGAAACATACATAAAACAAGG - Intergenic
1008272806 6:49509332-49509354 AACAAAACACATATAAAACAAGG - Intronic
1008307447 6:49920796-49920818 ATGGAAACAAATAACAAATATGG - Intergenic
1008540126 6:52538964-52538986 ACAGAAACACACATAAAACAAGG - Intronic
1009424234 6:63496982-63497004 ATAAAAACATATTTCAATCAAGG - Intergenic
1009487059 6:64237922-64237944 ATAGTAAAACAAATCATACAAGG + Intronic
1010143940 6:72644240-72644262 ACAGAAACACACATAAAATAAGG - Intronic
1010344592 6:74796826-74796848 AAAGCAACACATAACACACAAGG + Intergenic
1010367559 6:75069391-75069413 ATAAAAACACACAACAAACTTGG - Intergenic
1010550210 6:77212460-77212482 AACTAAACACTTATCAAACATGG + Intergenic
1011300757 6:85870921-85870943 ATAGAAACACTCAACAAACTAGG - Intergenic
1011300920 6:85872757-85872779 ATAGAAACACTCAACAAACTAGG - Intergenic
1011492770 6:87909743-87909765 ATAGAAAGAAAAATCAATCAAGG - Intergenic
1011513687 6:88128743-88128765 ATACAAACACATAGCAAATCTGG - Intergenic
1013023714 6:106247629-106247651 ACAGAAACACACATAGAACAAGG - Intronic
1014245827 6:119067608-119067630 ACAGAAACACACATAAAACAAGG + Intronic
1014379302 6:120719583-120719605 ATATAAACAGATTTAAAACATGG - Intergenic
1014889795 6:126830079-126830101 ACAATAACAAATATCAAACAAGG + Intergenic
1014945863 6:127496587-127496609 ATAAAAACATATATCCACCAAGG + Intronic
1015041062 6:128719379-128719401 ATAGGACTACATATCATACATGG - Intergenic
1015153394 6:130063584-130063606 ACAGAAACACACATAAAACAAGG - Intronic
1015595476 6:134862124-134862146 ACAGATACACACATAAAACAAGG - Intergenic
1015639152 6:135312203-135312225 AATGAAACAAATACCAAACAGGG + Intronic
1015688534 6:135894232-135894254 ATAGAATCACATAATAAACTAGG - Intronic
1015817896 6:137229457-137229479 ATAGAAACAGATATGAAGGATGG + Intergenic
1015895395 6:138011856-138011878 AAGGAAACACATAGCATACAGGG - Intergenic
1015934815 6:138398260-138398282 GCAGAAACACACATAAAACAAGG + Intergenic
1015955392 6:138592761-138592783 ATCGTAAGACATATGAAACAGGG + Intronic
1016230065 6:141792378-141792400 ATAGAAACACATAGAAATTAAGG + Intergenic
1016315699 6:142783994-142784016 ATAGAAACAAATTTACAACAAGG - Intronic
1016676814 6:146780234-146780256 ATACAAACAAATAAAAAACAAGG + Intronic
1016697276 6:147011822-147011844 ATAAAAACTCTTATCAAACTAGG + Intergenic
1017207199 6:151816111-151816133 ACAGAAAAACATATAAAACAAGG + Intronic
1017319810 6:153077216-153077238 ACAATAAGACATATCAAACATGG + Intronic
1017347422 6:153400461-153400483 CCAGAAACACATACAAAACAAGG + Intergenic
1017399956 6:154049056-154049078 ACAGAAACACACATAAAACAAGG - Intronic
1017815601 6:158014367-158014389 ATAGAAAAACACATAAAACAAGG + Intronic
1017823118 6:158063065-158063087 ATGGAAACATACATAAAACAAGG + Intronic
1018306032 6:162456734-162456756 ACAGAAACACACATAAAACAAGG - Intronic
1018512350 6:164538758-164538780 ATAGAAACAGATGACAAAAACGG - Intergenic
1018817519 6:167345242-167345264 ATAGACACACATACAAAAAAAGG + Intronic
1019225848 6:170507313-170507335 ACAGAAACATACATAAAACAAGG - Intergenic
1020342541 7:7127679-7127701 ATAGAAAGCCAAATCAAAAAAGG - Intergenic
1020632422 7:10655379-10655401 ACAAAAATACAGATCAAACATGG + Intergenic
1020703962 7:11518870-11518892 ATAGAAACATATTTCATTCATGG + Intronic
1021469578 7:20985970-20985992 ACAGAAACACACATAAAACAAGG - Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1022180709 7:27916470-27916492 ACAGAAACACACCTAAAACAAGG - Intronic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1022476153 7:30711338-30711360 TTAGAAACACATATTACCCATGG - Intronic
1022518314 7:30989351-30989373 ACAGAAACAGACATAAAACAAGG + Intronic
1022518562 7:30990820-30990842 ACAGAAACAGACATGAAACAAGG - Intronic
1023151511 7:37205354-37205376 ACAGAAACACACATAAAAGAAGG - Intronic
1023431703 7:40099594-40099616 ATAGAAGCAAAAAGCAAACAAGG - Intergenic
1023433545 7:40118871-40118893 AAAGAAACACAAATCATCCATGG + Intergenic
1024916495 7:54505814-54505836 ATAGAAACACACATAAAACAAGG - Intergenic
1024954866 7:54906834-54906856 ACAGAAACACACATCAAACAGGG - Intergenic
1024979988 7:55149880-55149902 TTAAAAACCCATATAAAACATGG - Intronic
1026476756 7:70743153-70743175 AAAGAAACAAAAATAAAACAAGG - Intronic
1026673918 7:72413434-72413456 ATAGACTCACATACCACACATGG + Intronic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1027409366 7:77898669-77898691 ACAGAAACACACATAAAACAAGG - Intronic
1027713953 7:81645354-81645376 ACAGAATCACCTATAAAACAAGG - Intergenic
1027847956 7:83408552-83408574 ATAGATACACATATTAAATTTGG - Intronic
1028311802 7:89347779-89347801 AAAGACACACATATCACTCAGGG - Intergenic
1028343383 7:89750213-89750235 AATGAAACACACATAAAACAAGG - Intergenic
1028809170 7:95064226-95064248 AAAGAAACACACGTGAAACATGG - Intronic
1029047901 7:97650488-97650510 AGAGAAATACATATAAAACAAGG + Intergenic
1029233601 7:99092796-99092818 ACAGAAGCACACATAAAACAAGG + Intronic
1030041187 7:105451641-105451663 ATGGGAGCACATAACAAACATGG - Intronic
1030302488 7:107988496-107988518 CTAGAAAAACGTATCAACCAGGG + Intronic
1030405280 7:109102984-109103006 ATAGAAAAAAATACCAAAAATGG - Intergenic
1030424322 7:109354331-109354353 ATAGCAACACAAAACAAAGACGG + Intergenic
1030483126 7:110129587-110129609 ACAGAAACACACACAAAACAAGG + Intergenic
1030767160 7:113424503-113424525 ACAGAAACACACATAAAACAAGG + Intergenic
1030917396 7:115332636-115332658 AAAGAAAAATATATCAAGCAGGG - Intergenic
1031117687 7:117685946-117685968 ATAAAAACCCATGGCAAACATGG + Intronic
1031287831 7:119894321-119894343 ATACAAACAAGTATCAAACTTGG - Intergenic
1031434579 7:121716614-121716636 GTAAAAACACATAACAAACTGGG - Intergenic
1031509437 7:122630892-122630914 ATAGAAACTCCTATATAACAAGG - Intronic
1031712735 7:125069263-125069285 ATTGAAACTCATATTAAATAGGG + Intergenic
1032479926 7:132238228-132238250 ACAGAAACACACACAAAACAAGG + Intronic
1032568647 7:132975368-132975390 ATAGAAACACATAGCCAAAAAGG + Intronic
1032971856 7:137173934-137173956 ACAGAAACAAACATAAAACAAGG + Intergenic
1033044704 7:137951392-137951414 ACAGAAGCACACATAAAACAAGG + Intronic
1033051635 7:138009712-138009734 ACAGAAACACACATAAAACCAGG - Intronic
1033289899 7:140074779-140074801 ATAGAAAAACACATAAAACAAGG - Intergenic
1033380378 7:140811131-140811153 ACAGAAACACACACAAAACAAGG + Intronic
1033891898 7:146023652-146023674 ATAAAAACAAAAATGAAACATGG + Intergenic
1033991257 7:147290155-147290177 ACAGAAACACACACAAAACAAGG - Intronic
1034106231 7:148492805-148492827 ACAGAAACACACATAAAACAAGG - Intergenic
1034327707 7:150251890-150251912 ATAGAAATAAATATAAAGCAAGG + Intronic
1034765504 7:153717539-153717561 ATAGAAATAAATATAAAGCAAGG - Intergenic
1034857440 7:154565160-154565182 AAAGAAAGACACATAAAACAAGG + Intronic
1034906522 7:154952636-154952658 ACAGAAACACACATAAAACAAGG + Intronic
1035038790 7:155912640-155912662 ACAAAAACACAGATGAAACAAGG + Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035588493 8:795248-795270 GCAGAAACACAAATAAAACAAGG - Intergenic
1035996512 8:4553186-4553208 ACAGACACACATGTGAAACATGG - Intronic
1036124230 8:6048349-6048371 GCAGAAACACAGGTCAAACATGG + Intergenic
1036417931 8:8567619-8567641 AAAGAAAAACACATAAAACAAGG - Intergenic
1037278373 8:17206350-17206372 GTAGAAACACACATAAAACAAGG + Intronic
1037710561 8:21352092-21352114 ATTGAAAAACATTGCAAACACGG + Intergenic
1037792507 8:21958359-21958381 ACAAAAACACAAATAAAACATGG - Intronic
1037828654 8:22175583-22175605 AAAGAAACACTCATAAAACAAGG - Intronic
1037872977 8:22516962-22516984 ACAGAAACACATCTGAAACAAGG + Intronic
1038058353 8:23883809-23883831 ATATAAACACATATTATAAATGG + Intergenic
1038143036 8:24866990-24867012 ACAGAAACACACATAAAACAAGG + Intergenic
1038278848 8:26144330-26144352 ACAGAAACACACATAAAGCAAGG - Intergenic
1038511553 8:28140917-28140939 ACAGAAACACACATAAAACAAGG + Intronic
1038512678 8:28154216-28154238 ACAGAAACATGCATCAAACAAGG + Intronic
1038893071 8:31749180-31749202 AGAAAAATACATATAAAACAAGG + Intronic
1039327353 8:36500157-36500179 ATAGATACAGATATAGAACAAGG + Intergenic
1039677533 8:39685721-39685743 AAAGAAAGAAATATTAAACACGG - Intronic
1039772635 8:40703047-40703069 ACAGAAACACACACAAAACAAGG + Intronic
1039813119 8:41067409-41067431 AAAGAAACACAAATCAGACTAGG + Intergenic
1039818047 8:41112050-41112072 AGAGAAACACACATAAAACAAGG - Intergenic
1040080383 8:43277810-43277832 ATAAAAACATGTATTAAACATGG + Intergenic
1040732637 8:50468658-50468680 ATAGAGAAACATTACAAACATGG - Intronic
1040940546 8:52828380-52828402 ATAGAAACAAATCTCCAAAATGG + Intergenic
1041054596 8:53971044-53971066 CTAAAAACAAATATCCAACAGGG + Intronic
1041288955 8:56290172-56290194 ACAGAAACACACATAAAACAAGG + Intergenic
1041756101 8:61314732-61314754 TTAGAAAGACTTATAAAACATGG - Intronic
1041791843 8:61704983-61705005 ATAAAAACATATGTCAAAAAAGG + Intronic
1042209498 8:66365624-66365646 ACAGAAACACACATAAAACAAGG + Intergenic
1042429087 8:68683560-68683582 ATATATACACATTTGAAACATGG + Intronic
1042567567 8:70128065-70128087 ACAGAAACACACATAAAACAAGG + Intronic
1042568418 8:70136042-70136064 TTAGAGATACATTTCAAACAGGG + Intronic
1042685097 8:71430030-71430052 TTACAAACACCTATCAAGCAAGG + Intronic
1043076526 8:75708109-75708131 AAAAAAACACATATGAATCAAGG + Intergenic
1043098923 8:76014842-76014864 TCAGAAACACACATAAAACAGGG - Intergenic
1043539871 8:81249103-81249125 ACACAAACACATACCATACATGG + Intergenic
1044211809 8:89559488-89559510 ACAGAAACACACATTAAACAAGG - Intergenic
1044340631 8:91042217-91042239 AAAGAAAAACATATAAAACATGG - Intergenic
1044471205 8:92570702-92570724 ACAGAAAGACACATAAAACAAGG - Intergenic
1044617602 8:94158248-94158270 ATAGAACCACATATAAAGTAAGG + Intronic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1044722323 8:95162362-95162384 ATAGAAAAAAACAGCAAACAGGG + Intergenic
1044748179 8:95391389-95391411 ACAGAAACACACATAAAACAAGG - Intergenic
1044848283 8:96403143-96403165 ACAGAAACACACATAAAATAAGG + Intergenic
1045008759 8:97938839-97938861 ACAGAAACACACATAAAACAAGG - Intronic
1045456270 8:102382471-102382493 GTAGAAAAACATTTCAAAAAAGG + Intronic
1045943837 8:107771564-107771586 ATAAAAACATATATTAAGCAAGG + Intergenic
1046113984 8:109763617-109763639 AAAGAAACAAATAACATACAAGG - Intergenic
1046162287 8:110382609-110382631 ATATATACACATTTCAAAAATGG - Intergenic
1046455180 8:114450047-114450069 ATAGAAACACATAATATGCAGGG + Intergenic
1046989779 8:120439434-120439456 ACAGAAACACACATAAAACAAGG + Intronic
1047513130 8:125530624-125530646 ATAAAAACACATCACAACCAGGG - Intergenic
1047550115 8:125861754-125861776 AAAGAAACACATATAATTCAGGG + Intergenic
1049942280 9:558452-558474 ACAGAAACACATGCAAAACAAGG - Intronic
1050361793 9:4837461-4837483 AAGGAAACACATCTCAAATAAGG - Intronic
1050458505 9:5856753-5856775 TCAGAAACACACATAAAACAAGG - Intergenic
1050712715 9:8483848-8483870 ACAGAAAAACATATAGAACATGG - Intronic
1051026504 9:12619085-12619107 ACAGAAACACACATAAAACAAGG - Intergenic
1051030031 9:12662960-12662982 ATAAAAACACTTAAGAAACAGGG + Intergenic
1051449583 9:17180055-17180077 AAAGAAACTCATTTCAAATATGG - Intronic
1051525767 9:18042659-18042681 AAAGAAACACACACCAAATAAGG - Intergenic
1052279182 9:26713960-26713982 ATAGTAACACATTAAAAACAGGG - Intergenic
1052333019 9:27289983-27290005 ACAGAAACACACATAAAACAAGG - Intronic
1052540283 9:29802779-29802801 ATAGATACACATATCTATAAAGG + Intergenic
1052620629 9:30904631-30904653 ACAGAAACACATATAAAATAAGG + Intergenic
1053450593 9:38191247-38191269 ATAGAAACACAAAACAGACTAGG - Intergenic
1055472408 9:76626063-76626085 ACAGAAACACACATAAAAAAAGG + Intronic
1055497287 9:76868218-76868240 ATAGTAACTTATATCAAAAATGG + Intronic
1055684940 9:78762174-78762196 ATATAAACAAATATCACAAAAGG - Intergenic
1056081689 9:83101813-83101835 ACAGAAACACACATAAAACAAGG - Intergenic
1056145806 9:83728214-83728236 ATAGAAACACACATAAAAGAAGG + Intergenic
1056420349 9:86419922-86419944 ACAGAAACACACATAACACAAGG - Intergenic
1056544151 9:87599870-87599892 ACAGAAACACACATAAAACAAGG - Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1056925637 9:90832056-90832078 ATAGAAATACACATAAAACAAGG + Intronic
1057028834 9:91757828-91757850 ACAGAAACACACATAAACCAAGG - Intronic
1057776338 9:98013333-98013355 CTAAAAACACATTTAAAACATGG - Intronic
1057887009 9:98837465-98837487 ACAGAAACACATAGAAAACAAGG - Intronic
1058344023 9:103937065-103937087 ATAGAAACATATTTAAAACATGG + Intergenic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1059583678 9:115581388-115581410 ATAGCAACACCTATTAAAAAGGG - Intergenic
1185885993 X:3783451-3783473 ACAGAAACACACCTAAAACAAGG + Intergenic
1186057217 X:5662623-5662645 ACAGAAATACACATAAAACAAGG - Intergenic
1186158862 X:6755188-6755210 ACAGAAACACACAGAAAACAAGG + Intergenic
1186308246 X:8288668-8288690 AGACAAAGACATAACAAACAAGG + Intergenic
1186823776 X:13317247-13317269 ATAGAAATACCTACCAGACATGG - Intergenic
1186887322 X:13926851-13926873 ATAGAAACAATTTTAAAACAAGG + Intronic
1187124253 X:16438783-16438805 ACAGAAACATATATAAAACAGGG + Intergenic
1187193778 X:17061310-17061332 ATACAAAGACAGATGAAACAGGG + Intronic
1187252860 X:17614603-17614625 AAACAAACACATATCAAGCATGG - Intronic
1187287513 X:17919889-17919911 ACAGAAACACACATAAAACAAGG - Intergenic
1188144447 X:26592777-26592799 ATATAAACACATATGAGAGAGGG - Intergenic
1188607982 X:32057076-32057098 ATAAAAACACACAACAAACTAGG + Intronic
1189140257 X:38597571-38597593 AAACAAACACATATAAAACAAGG + Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189445001 X:41072708-41072730 ATAGAAACCAGTAACAAACATGG - Intergenic
1189459378 X:41225702-41225724 GTAGAAACACACATACAACAAGG - Intronic
1189529093 X:41859789-41859811 ACAGAAGCACACATAAAACAAGG + Intronic
1189633927 X:42984914-42984936 CCAGAAACACATAGTAAACAAGG + Intergenic
1189941220 X:46123585-46123607 ATAAAAACACTTAGCAAACTGGG - Intergenic
1190637756 X:52452994-52453016 ATAGCAACATTTATCAACCATGG + Intergenic
1190678890 X:52807465-52807487 ATAGCAACATTTATCAACCATGG - Intergenic
1191098764 X:56702372-56702394 ATAGAAACAAGGATCAAACATGG + Intergenic
1192123612 X:68479736-68479758 TTAGAGACACATATAAAACATGG - Intergenic
1192346102 X:70307607-70307629 ATAAAAACACTTAACAAACTAGG - Intronic
1192667744 X:73105672-73105694 AAAGAAACACATTACAGACAGGG + Intergenic
1192728665 X:73779672-73779694 ACGGAAACACACATAAAACAAGG - Intergenic
1192746958 X:73948885-73948907 ATATAAACATATAATAAACAAGG + Intergenic
1193082380 X:77418578-77418600 ACAGAAACACACACAAAACAAGG - Intergenic
1194561726 X:95429727-95429749 AAAGAAACAAATAACATACAAGG + Intergenic
1195165116 X:102212149-102212171 AGACAAACACACATCAAAAAAGG - Intergenic
1195193742 X:102474942-102474964 AGACAAACACACATCAAAAAAGG + Intergenic
1195506445 X:105663357-105663379 ATACAAACACAGATCATACATGG + Intronic
1195571011 X:106398714-106398736 ACAAAAACACATATAAAACAAGG + Intergenic
1195796932 X:108660514-108660536 AAAGCAACAAATATCAAAAAGGG - Intronic
1195957814 X:110351826-110351848 ATACAAGTACTTATCAAACATGG - Intronic
1196187759 X:112762735-112762757 AGAGAAGCACATATCAGACAAGG + Intergenic
1196772252 X:119306570-119306592 ACAGAAACACATATAACACACGG - Intergenic
1196980291 X:121205642-121205664 ATAGAATCAGAGATAAAACAAGG - Intergenic
1197665641 X:129220560-129220582 ATATACATACATATAAAACAGGG + Intergenic
1197669256 X:129257892-129257914 ATATAAACATATAAAAAACAGGG + Intergenic
1198049644 X:132938271-132938293 AAAGAAACACTCATCAAACTAGG + Intronic
1199308118 X:146291908-146291930 ATAGCAACACCTATCCAGCAAGG - Intergenic
1199564183 X:149197068-149197090 ATAAAAACACATAACAAAAAGGG + Intergenic
1200664355 Y:6001834-6001856 ATAGAGGGACAAATCAAACAAGG + Intergenic
1201267192 Y:12218975-12218997 TGAGAAACACATGTCAAACAGGG - Intergenic
1201787152 Y:17797293-17797315 ATACAAAAACACATCACACATGG + Intergenic
1201814401 Y:18108695-18108717 ATACAAAAACACATCACACATGG - Intergenic