ID: 1126348356

View in Genome Browser
Species Human (GRCh38)
Location 15:47718826-47718848
Sequence GCGGCTGCCGGCGCGAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 262}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126348356_1126348367 3 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG 0: 1
1: 1
2: 8
3: 104
4: 996
1126348356_1126348366 -1 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348366 15:47718848-47718870 CTGGCAGGGGCATGGTGAGGAGG 0: 1
1: 0
2: 4
3: 70
4: 601
1126348356_1126348365 -4 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348365 15:47718845-47718867 CCGCTGGCAGGGGCATGGTGAGG 0: 1
1: 1
2: 0
3: 23
4: 299
1126348356_1126348368 7 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348368 15:47718856-47718878 GGCATGGTGAGGAGGAAGGTAGG 0: 1
1: 0
2: 5
3: 58
4: 682
1126348356_1126348363 -9 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348363 15:47718840-47718862 GGCAGCCGCTGGCAGGGGCATGG 0: 1
1: 0
2: 7
3: 62
4: 549
1126348356_1126348369 8 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348369 15:47718857-47718879 GCATGGTGAGGAGGAAGGTAGGG 0: 1
1: 0
2: 2
3: 46
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126348356 Original CRISPR GCGGCTGCCGGCGCGAGCGG CGG (reversed) Exonic
900100605 1:960563-960585 GCGGCTGCGGGCGGGAGCGGCGG + Intergenic
900113826 1:1020395-1020417 GCGGCAGGCGTCGCGAGGGGAGG - Intronic
900165551 1:1243025-1243047 GGGGCTGCCGCCTGGAGCGGGGG + Intronic
900206913 1:1435580-1435602 ACGCCCTCCGGCGCGAGCGGAGG - Intronic
900349688 1:2228552-2228574 GCGGCGGCGGGCTCCAGCGGCGG + Intergenic
900366688 1:2314604-2314626 GCGGCTTCCGGCCCGGGCGAAGG - Intergenic
903115637 1:21176597-21176619 GCTGCTGCCGGCGGCGGCGGCGG - Intronic
904618879 1:31763906-31763928 GCGGGGGCCGGCGCTGGCGGGGG + Exonic
905308537 1:37034584-37034606 GCGGCGGGCGGCGCGGGAGGCGG - Intergenic
905584341 1:39105329-39105351 GCGGCTGCAGCGGCGGGCGGCGG - Intronic
906157532 1:43622533-43622555 GGGGCTGCCAGCCTGAGCGGAGG + Exonic
906263121 1:44407795-44407817 GCGGCTGCCCGCTGAAGCGGTGG + Intronic
908293275 1:62688514-62688536 GCTGCGGCCGGCGGGAGCCGAGG + Intergenic
908355698 1:63323389-63323411 GAGGAGGGCGGCGCGAGCGGCGG + Exonic
908555639 1:65254468-65254490 GCGGCGGCGGCGGCGAGCGGTGG + Intronic
912486665 1:110034701-110034723 GCGGCTGCCGGCGGCGGAGGTGG - Exonic
912715799 1:111982734-111982756 GCGGCTGCCGGCCCAAGAGCTGG - Exonic
913592567 1:120342422-120342444 TCAGCTCCCGGCGCGAGTGGAGG - Intergenic
913650781 1:120912708-120912730 TCAGCTCCCGGCGCGAGTGGAGG + Intergenic
914170331 1:145216359-145216381 TCAGCTCCCGGCGCGAGTGGAGG - Intergenic
914525449 1:148460325-148460347 TCAGCTCCCGGCGCGAGTGGAGG - Intergenic
914598225 1:149175505-149175527 TCAGCTCCCGGCGCGAGTGGAGG + Intergenic
914640952 1:149606803-149606825 TCAGCTCCCGGCGCGAGTGGAGG + Intergenic
918423740 1:184387612-184387634 GCGTCTGCCGGCCTGGGCGGAGG + Intronic
919650838 1:200147750-200147772 GCGGATGCCGGCGCGAATGCCGG + Intronic
920504510 1:206506971-206506993 GCGGCTGCGGGAGCGCGCGCGGG + Intergenic
921355566 1:214281445-214281467 GCGGCGGCGGGCGGGAGCCGGGG + Intronic
921432821 1:215083079-215083101 CCGGCAGCAGGCGCGCGCGGGGG + Intronic
922315085 1:224434698-224434720 GCGGCGGCGGGCGGCAGCGGAGG + Intronic
924778401 1:247126821-247126843 GGGGCTGCGGGCGCGGGCCGGGG - Intronic
924783257 1:247171599-247171621 GGGGCTGCGGGCGCGGGCCGGGG + Intronic
1063657791 10:8009208-8009230 GCGGCGGCCTGGGCGAGCAGCGG - Exonic
1064208927 10:13347650-13347672 GCGGCGGCCCGTGCGCGCGGCGG - Intronic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1067769874 10:49115461-49115483 GCGGCTGCTGGCACTGGCGGCGG - Exonic
1068560942 10:58513395-58513417 GCGGGCGCCGGAGCGCGCGGTGG - Intronic
1069280704 10:66650932-66650954 GAGGCTGCCCGAGCCAGCGGTGG - Intronic
1070610092 10:77926869-77926891 GGGGCGGGCGGCGCGCGCGGAGG - Intergenic
1071966571 10:90858043-90858065 GCGGCGGCGGGCGCGAGGGGCGG - Intergenic
1072654223 10:97319385-97319407 TCGGCTGCCGGCGGGCGCGGTGG - Exonic
1073147947 10:101292598-101292620 GCGGCCGCGGGCCGGAGCGGGGG - Intergenic
1073177699 10:101566516-101566538 GCGGCTGACAGCGGGAGGGGGGG - Intergenic
1075112478 10:119598203-119598225 GGGGATGCGGGCGGGAGCGGGGG + Intergenic
1075129579 10:119726362-119726384 GAGGCTGGCGGTGCGGGCGGGGG + Intronic
1075765075 10:124886801-124886823 GCTGCTGCCGGAGGGAGCAGAGG - Intergenic
1076909357 10:133379453-133379475 GCGGCCCCCGGCGCGGGCCGTGG - Exonic
1076993740 11:288818-288840 GCGGCCGGGGGCGCGGGCGGAGG + Intergenic
1079353755 11:19713887-19713909 GGGGCTGCAGGAGCCAGCGGGGG + Exonic
1080503773 11:32893174-32893196 GCGGCGGGGGGCGCGGGCGGCGG - Exonic
1081831600 11:46120384-46120406 GGGGCTGCGGGCGGGGGCGGGGG - Intronic
1083595532 11:63916936-63916958 CCGGCTGCCGTCGCGGGCAGGGG - Intergenic
1083617982 11:64035839-64035861 GGCGGTGCCCGCGCGAGCGGCGG - Intronic
1084636734 11:70398192-70398214 ACGGCTGAGGGCGCGCGCGGAGG + Intergenic
1085208068 11:74749051-74749073 GCCGCTGCCGCCGCGGCCGGAGG + Exonic
1092383601 12:8018760-8018782 GCGGCTGCGGGCGGGGCCGGCGG - Intergenic
1094147349 12:27244307-27244329 CCGGCCGCGGGCGCGACCGGAGG + Exonic
1094624091 12:32106700-32106722 GCGGCGGCCCGCGCGCCCGGCGG + Intergenic
1095310597 12:40692880-40692902 GAGGCTGCCGCCGCCAGCGCCGG + Intronic
1095439717 12:42228258-42228280 GGGGCGGCTGGCGCGGGCGGGGG - Intronic
1096495494 12:52037261-52037283 GCGGCTGCAGGAGCGCGAGGAGG + Intronic
1097981343 12:65741011-65741033 GGGGCTCCGGGCGCGGGCGGTGG - Intergenic
1098029011 12:66235299-66235321 GCGGCGGCGGGCGCGGGCGCGGG + Intronic
1101409510 12:104457120-104457142 GCGGCCGCCGGCGGGATCGGAGG + Exonic
1102026883 12:109718696-109718718 GCGGCGGGCGGCGCCCGCGGAGG - Intronic
1102115993 12:110403411-110403433 GCGGCCGCCGGCGCCAGCGGAGG - Intronic
1102197270 12:111034350-111034372 GCGGCTGCCGGGGCTCGCCGGGG + Intronic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103400644 12:120640908-120640930 GCGGCGGCGGCGGCGAGCGGGGG + Exonic
1103918432 12:124387712-124387734 GCTGCTGCTGGCGCGGGCGGAGG - Intronic
1105022000 12:132822994-132823016 GGGGCTGCCGGCAGGAGCCGTGG - Intronic
1105475067 13:20721782-20721804 ACGGCCGCCGGCGCAGGCGGGGG - Exonic
1107467548 13:40664828-40664850 GCGGGGGCGGGCGCGGGCGGTGG - Intronic
1114224200 14:20723449-20723471 GAGGCTGCGGGCGCAGGCGGGGG + Intergenic
1115028193 14:28766620-28766642 GCGGCAGCCGGCGGGCGGGGCGG + Intergenic
1115664553 14:35533783-35533805 CCGGGTCCCGGCCCGAGCGGAGG + Intergenic
1116835655 14:49767562-49767584 CCGGCTGGCGGCGGCAGCGGCGG + Intergenic
1117374430 14:55107957-55107979 GAGGCTGCAGGCGTGAGCTGGGG + Intergenic
1117565761 14:56991827-56991849 CAGGCTGCCGGCGCCAGCAGCGG + Intergenic
1117793097 14:59361694-59361716 GCAGCTGCCAGCGAGAGAGGGGG + Intronic
1119383156 14:74241081-74241103 CGGGCTGCCTCCGCGAGCGGCGG - Intronic
1121645872 14:95516720-95516742 GCGGGTCCCGGCGGGGGCGGGGG - Intronic
1122066259 14:99176015-99176037 ACGGCCTCCGGCCCGAGCGGCGG + Exonic
1122221150 14:100239704-100239726 GCGGCGGCCGGCAAGAGCGGCGG + Exonic
1122543347 14:102509648-102509670 GCTGCGGCGGGCGCGGGCGGCGG - Exonic
1124323631 15:28737837-28737859 CTGGCTGCCGGCGCGCGCCGCGG - Intronic
1124848072 15:33310986-33311008 GCGGCTGCCGGGGGAAGCAGAGG + Exonic
1126165402 15:45650577-45650599 CAGGCTGCCCGAGCGAGCGGTGG - Intronic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1126852343 15:52805115-52805137 TCCCCTGCAGGCGCGAGCGGGGG - Intergenic
1127165545 15:56243035-56243057 GCGGCGGGCGGGGGGAGCGGAGG - Intronic
1129676047 15:77632838-77632860 GCGGGAGCCGGAGCGGGCGGCGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130411696 15:83653716-83653738 GCGCCTGCCGGCGGCGGCGGTGG + Intergenic
1132398158 15:101489313-101489335 GCGGCCTCCGGCGCGCGCGAGGG - Intronic
1132729098 16:1351873-1351895 GCGGCTGCCAGCGCTTGCGCCGG + Exonic
1132729177 16:1352173-1352195 CGGGCTGGCGGCTCGAGCGGGGG + Intronic
1132873233 16:2124758-2124780 GAGGCGGCCAGCGCGGGCGGGGG - Intronic
1133046255 16:3089895-3089917 GCGGCTGCCGGAGCCTTCGGAGG + Exonic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133801944 16:9091760-9091782 GCGGCGGCCGAGGCGAGGGGCGG + Exonic
1134656115 16:15949632-15949654 CCGGCTGCTGGCGCTAGCGCTGG - Exonic
1134656130 16:15949682-15949704 CCGGTTGCTGGCGCGGGCGGCGG - Exonic
1136447850 16:30335084-30335106 GCGGCGGCCGGTTCGGGCGGCGG - Intergenic
1136458497 16:30395623-30395645 GCGGCCGGCGGCGCGGGCAGGGG + Intronic
1139365190 16:66428284-66428306 GCGGGTGCCGGCGTGGGTGGCGG + Intronic
1139750364 16:69106217-69106239 GCGGCAGTCGGAGCGCGCGGCGG + Intronic
1140442573 16:74999083-74999105 GCGGCTGGCGGGGCCGGCGGCGG + Exonic
1141132394 16:81445061-81445083 GCGGGGGGCGGCGCGTGCGGCGG - Intergenic
1141608542 16:85169140-85169162 GCGGCGGCGGGCGGGAGGGGCGG - Intergenic
1143150068 17:4802263-4802285 GCGGGTGCCGGAGGCAGCGGGGG - Intergenic
1143483403 17:7239472-7239494 GCGGCCGGCGGCGCGGGGGGAGG - Exonic
1143519414 17:7437122-7437144 GCTGCTGCAGGCGCACGCGGCGG + Exonic
1143633658 17:8152371-8152393 TCGGCTGCGGGCTGGAGCGGCGG - Exonic
1144109800 17:12020890-12020912 GCGGCTCCGAGCCCGAGCGGCGG + Exonic
1146445371 17:32928310-32928332 CCGGCTGCCGGGGAGAGGGGAGG + Intronic
1147193433 17:38749795-38749817 GTGGCTGCAGGCTCGAGCTGGGG - Exonic
1147907642 17:43833195-43833217 GCGGCTGCCGCGCCGGGCGGGGG + Intergenic
1148122674 17:45222035-45222057 GAGGCTCCCGGCCCGGGCGGGGG - Exonic
1148157666 17:45432778-45432800 GCGCCTGCCGGGGCAAGTGGAGG - Intronic
1148591122 17:48817308-48817330 AGGGCTGCGGGAGCGAGCGGCGG - Intergenic
1149296279 17:55265039-55265061 GCGGCCGCCGGCGCGGGGAGGGG + Exonic
1149461880 17:56834921-56834943 GCAGCTGCCGGCGCGACCGCTGG - Exonic
1149614748 17:57988282-57988304 GCGGCGGCGAGCGCGGGCGGGGG + Intergenic
1149626349 17:58083344-58083366 GCGGACGGCGGCGCGCGCGGCGG + Intergenic
1149849323 17:60026015-60026037 GCGGCGGCCGGCGCTGGCAGTGG - Intergenic
1149860845 17:60120509-60120531 GCGGCGGCCGGCGCTGGCAGTGG + Intergenic
1150790093 17:68196426-68196448 GCGCCTGCCGGGGCAAGTGGAGG + Intergenic
1152307804 17:79531330-79531352 GAGGCTGCCTGCGTGTGCGGAGG + Intergenic
1152718552 17:81911408-81911430 GCGCCTGGCGGGGCGGGCGGCGG - Intronic
1152721894 17:81927493-81927515 GCGGCGGCGGGCCCGGGCGGTGG - Intronic
1153480690 18:5543661-5543683 GCGGCGGGCGGAGCGGGCGGGGG + Intronic
1155218404 18:23662855-23662877 GCTGCTGCCGGGCCGGGCGGCGG - Exonic
1156008514 18:32470687-32470709 GCGGCTGCGGGCGGCGGCGGCGG + Intergenic
1156994372 18:43448098-43448120 GCTGCTGCTGGCGCAAGCTGAGG - Intergenic
1157609980 18:48950165-48950187 GCGGGCGCCGGCGCGGCCGGGGG - Exonic
1158976563 18:62715926-62715948 GCCGCTGCCGGGCAGAGCGGGGG + Exonic
1160499717 18:79395749-79395771 GCGGCTGCCGCGGCGCGGGGAGG + Intergenic
1160517480 18:79486585-79486607 GTGGCTGCCCGGGCGAGCCGGGG - Exonic
1160543308 18:79637606-79637628 GCGGCTTCCAGCGCGGGAGGAGG - Intergenic
1160730557 19:639958-639980 GCTGCTGCTGGCGCGGGCGCCGG + Exonic
1160745373 19:708926-708948 GCGGCGGCGGGCGCGGGGGGTGG - Intergenic
1160861212 19:1237885-1237907 GGGGAGGCCGGCGCGAGAGGAGG + Exonic
1160930624 19:1568106-1568128 GCGGAGGGCGGCGCGGGCGGCGG - Intergenic
1160939737 19:1614672-1614694 GCAGCCGCCAGCGCCAGCGGGGG + Intronic
1161358186 19:3831430-3831452 GAGCCTGCAGGCGCGGGCGGCGG + Exonic
1161379936 19:3959581-3959603 GCGGCCGCAAGCCCGAGCGGCGG - Exonic
1161495013 19:4581738-4581760 GCGGCGGCCGCGGCGGGCGGAGG - Intergenic
1162778755 19:12995916-12995938 CCGGCCGGCGGCGCGGGCGGAGG + Intronic
1163478302 19:17539731-17539753 GCGGCAGCGGGCGCGTGTGGCGG + Exonic
1165089263 19:33374034-33374056 GAGGCTGGAGGCGCGGGCGGCGG + Intronic
1165738807 19:38193742-38193764 GCCGCTGCCGGCGGCAGGGGTGG - Exonic
1166762598 19:45234418-45234440 GCGGCTCCCGGGGCGCCCGGGGG - Intronic
1166888254 19:45973947-45973969 GGGGCGGCGGGCGCGGGCGGCGG + Intergenic
1167466140 19:49651896-49651918 GCGGCGGCCGGGGCGGGCGCGGG - Exonic
1167551346 19:50163032-50163054 GCAGCTGCAGGCGCGCGCCGGGG - Exonic
925386175 2:3463382-3463404 GTGGCTGCCGGCGGGTGCAGGGG + Intronic
927713985 2:25341302-25341324 GCGGCGGCCCGGGGGAGCGGGGG - Intronic
929126602 2:38528222-38528244 GCGGCGGCCGGCGGGGGAGGAGG - Intergenic
932231529 2:70087665-70087687 GCGGCTGGCGGGGGGAGGGGAGG - Exonic
932591592 2:73071029-73071051 GCGAGTGCCGAGGCGAGCGGCGG - Intronic
932780214 2:74554640-74554662 GCGGCTGCCGGCGGGGGCCGGGG + Exonic
935622784 2:105143999-105144021 GCGGCGGCCAGGGAGAGCGGGGG - Intergenic
935820164 2:106886458-106886480 GCAGCTGCAAGCGCGGGCGGCGG + Exonic
936433256 2:112482215-112482237 GCGGTAGCCGGCGCGGGCGGCGG + Exonic
937045286 2:118848021-118848043 GCGGGTGCGGGCGCGGGTGGGGG - Intergenic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
938397757 2:130963615-130963637 GCGGCGGCGGGCGCGGGCGCGGG - Intronic
941020932 2:160407550-160407572 GCGGGTGCGGGCGCGGGCGCGGG + Intronic
941686845 2:168456317-168456339 GCGGCGGCGGGCGGGAGCAGCGG + Exonic
942150922 2:173075689-173075711 GCGGGTGCCGGGGCGCGGGGCGG + Intronic
942241346 2:173965583-173965605 GCGGCAGCCGGCGAGGGAGGCGG - Exonic
944656644 2:201882324-201882346 GAGGCTGCCTGCACTAGCGGGGG + Intronic
944831205 2:203535301-203535323 GCGGGCGGCGGCGGGAGCGGGGG + Exonic
946019877 2:216633689-216633711 GCGGCGGGCGGCGCAACCGGCGG - Exonic
946280017 2:218659779-218659801 GTGGCTGGAGGCGCGAGCTGGGG + Exonic
946395454 2:219441932-219441954 GCGGGAGCCGGCGCGGGTGGCGG - Intronic
1169059951 20:2653921-2653943 GAGGTTGCAGGCGCGAGCGACGG + Intronic
1169316237 20:4592958-4592980 GGGGATGCCGGGGAGAGCGGAGG - Intergenic
1170150505 20:13221723-13221745 GCGGCGGCCGGCGGCGGCGGCGG - Intergenic
1170890173 20:20369222-20369244 GCGGCGGCGGGCGCGGGCCGCGG - Exonic
1171431058 20:25083370-25083392 GCGGCTGCCTGCGCGCACGCAGG + Intergenic
1171457770 20:25281579-25281601 GCAGCAGCCGGCGGGAGCGGAGG + Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1176156921 20:63626744-63626766 GCGGTGGCGGGCGCGGGCGGCGG - Intronic
1178914945 21:36700936-36700958 GCGGCAACCGGCGTGGGCGGCGG - Intronic
1178992676 21:37367806-37367828 GGAGCGGCGGGCGCGAGCGGAGG + Intronic
1179998106 21:44983162-44983184 GTGGCTGCCGGCGGGCGGGGAGG + Intergenic
1183380003 22:37485958-37485980 GCAGCTCCAGGCGCAAGCGGTGG + Exonic
1183744791 22:39686145-39686167 GGGGCTGGCGGCGGGGGCGGCGG - Exonic
1185037912 22:48489404-48489426 GCGGGCGCGGGCGCGAGCGCGGG + Intergenic
1185279106 22:49962355-49962377 GCGCCTGCCTGCGGGAACGGGGG - Intronic
950316369 3:12004858-12004880 GCGGCTGCGGGCGCGGGAGCGGG - Exonic
951717386 3:25664251-25664273 GCGGGAGCCGGCGTGGGCGGCGG - Exonic
952942653 3:38455421-38455443 GCGGCTGCCACCGAGGGCGGCGG - Intronic
955769446 3:62373467-62373489 GCGGCGGCCGGCAGGCGCGGGGG - Exonic
955911601 3:63864020-63864042 GCCGCGGCCGGCGCGAGTTGGGG + Intergenic
961012936 3:123448186-123448208 GCGGCAGCCGCCGGCAGCGGCGG - Exonic
961389082 3:126541798-126541820 GGCGCTGCCGGCGTGAGTGGCGG - Exonic
961663907 3:128484774-128484796 GCGGGTGCTGGGGCCAGCGGGGG + Intronic
962738908 3:138348811-138348833 GCGACGGCCGGGGCGAGAGGCGG - Intronic
963061734 3:141231826-141231848 GCTCCTCCCGGCGCGAGGGGAGG - Exonic
963228753 3:142888976-142888998 GCTGCTGCCAGTGTGAGCGGCGG - Exonic
968603159 4:1519984-1520006 CCGGCTGCCGGCTAGAGCCGTGG + Intergenic
968702619 4:2064094-2064116 GCAGCTGCAGGCGGTAGCGGTGG - Exonic
971351914 4:25862919-25862941 GCGGCGGCCGGCCCGGCCGGGGG - Exonic
972396919 4:38664985-38665007 GCGGCGGGGGGCGCGGGCGGAGG - Intronic
975986180 4:80202906-80202928 GCCGCAGGCGGCGCGGGCGGGGG + Exonic
976475251 4:85475613-85475635 GCGGCTGCCTGCGCCAGGGGAGG + Intronic
977574070 4:98658689-98658711 GCTGCGGGCGGCGCGGGCGGAGG - Intergenic
977908224 4:102501445-102501467 GCGGCTGGCGGCCCGACCGACGG - Exonic
984778403 4:183504271-183504293 GCGGCTCCCGGCATGCGCGGCGG - Intergenic
985805180 5:2038530-2038552 GCGGCGGCCGTCGCGGGCCGTGG - Intergenic
989983047 5:50666441-50666463 TCAGCTCCCGGCGCGAGTGGAGG + Intronic
991298161 5:65103015-65103037 GCGGCCGCCGAGGCGAGGGGCGG - Intergenic
996185261 5:120465572-120465594 GCGGCTCCGGGCGGGGGCGGGGG + Intronic
996765463 5:127030781-127030803 GTGGCTGCCGGCGGGCGCTGCGG + Exonic
999462912 5:151772169-151772191 ACGGCCGCAGGCGCGCGCGGCGG + Intronic
1002888171 6:1313419-1313441 GGGGCGGCGGGCGCGGGCGGCGG - Exonic
1004070177 6:12290425-12290447 GCGTCTGCAGGCGCACGCGGCGG - Exonic
1005040334 6:21595141-21595163 GTGGCGGGCGGCGCGGGCGGTGG + Exonic
1005712139 6:28512607-28512629 GCGGCTGCCGGAGCCAGCAGTGG + Intronic
1008920823 6:56843308-56843330 GGGGCTGCCGGCGCCAGGGCCGG + Intronic
1010032866 6:71288725-71288747 GCGGGTTCAGGCGCGCGCGGCGG + Intergenic
1010781155 6:79947352-79947374 GCGGCCGACGGGGCGAGCGGCGG + Exonic
1013155878 6:107490561-107490583 GCTGCTGCCGCCGCCGGCGGTGG - Exonic
1019444861 7:1066096-1066118 CCGGCTGCCGGCGAAAGCCGTGG - Intronic
1019473379 7:1232928-1232950 GCGGCGGGAGGCGCGGGCGGCGG - Exonic
1019474639 7:1238201-1238223 GCGGCTGCGGGCAGGGGCGGGGG - Intergenic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1021452780 7:20798066-20798088 GCGGCCGCGGGCGCGGGAGGCGG + Intergenic
1021510503 7:21428003-21428025 GCGGCGCGCGGCGCGGGCGGCGG - Intergenic
1021827937 7:24573344-24573366 GCGGCTGGCTGCGCGCGCGGAGG + Exonic
1022100146 7:27164643-27164665 GCGGCTGCTGCAGCGAGAGGGGG - Intronic
1022106282 7:27199911-27199933 GCGGCTGCCGGGGCCGGGGGCGG - Exonic
1022629363 7:32070853-32070875 GCGGGAGCCGGCGCGGGCGGTGG + Intronic
1026909427 7:74083799-74083821 GCGGCTTGGGGAGCGAGCGGAGG - Intronic
1027421158 7:78019499-78019521 GCGTTTGCCGGCCCGGGCGGCGG - Exonic
1027421194 7:78019613-78019635 GCGTCTGCCGCCGCGAGCCCGGG + Exonic
1030820511 7:114086495-114086517 GCAGCTGCTGCCGCGAGTGGGGG - Intronic
1031966529 7:128031574-128031596 CCGGCTGCCGGCACGCGGGGCGG + Intronic
1032344362 7:131105948-131105970 GCGGCGGCGGGCGCGCGCGGGGG + Intergenic
1033165514 7:139035797-139035819 GCGGCGGCCGGCGCGGTGGGCGG - Exonic
1034494152 7:151410110-151410132 GAGGCTGCAGGCGCGCGGGGTGG - Intronic
1036561437 8:9903284-9903306 GCGGCCGCGGGCGCGAGGGGAGG - Intergenic
1037529192 8:19757276-19757298 GCGGCTGCCGGAGCGGGAGGTGG - Intronic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1039864597 8:41490325-41490347 GCTGCGGCCGGGGCGAGCTGTGG - Intergenic
1041673634 8:60516913-60516935 GCGGCCGCCGGCGCCGCCGGAGG - Exonic
1042611788 8:70608207-70608229 GCACCTGCAGGCGCGGGCGGCGG - Exonic
1043873897 8:85463982-85464004 GCTGGTGCCGGCGCGACCCGCGG + Exonic
1044973874 8:97644721-97644743 GCGGGCGCCGGCGCAAGCCGCGG - Exonic
1047254605 8:123206254-123206276 GAGGCTGTCGGGGCGAGGGGTGG - Intronic
1047951531 8:129939608-129939630 GCGCCTGGAGGCTCGAGCGGAGG - Exonic
1048981691 8:139705921-139705943 GCGGCTTCCGGACCGCGCGGAGG - Intergenic
1049194558 8:141308196-141308218 GCGGCTGCGGGTCCGGGCGGGGG + Intronic
1049714347 8:144082842-144082864 GGGGCCGCCGGCGCGAGCCCAGG - Intronic
1049766649 8:144358234-144358256 GCGGCTGCCGGGGAGTGCGGCGG + Exonic
1049798361 8:144506623-144506645 GCAGCTGCCCCCGCGGGCGGTGG + Exonic
1050090714 9:2015219-2015241 GCGTCTTCCGGCGCCCGCGGAGG + Exonic
1054775656 9:69121691-69121713 GCGGCCGCCGCCGCGGCCGGCGG - Intronic
1056475291 9:86946788-86946810 GCGGCGGCCGCCGGGAGAGGAGG + Exonic
1057054178 9:91949080-91949102 GAGGCTGGCGGCGGGAGGGGCGG - Intronic
1057643788 9:96854193-96854215 CCGGAGCCCGGCGCGAGCGGCGG - Exonic
1057996574 9:99824954-99824976 GCGGCTGATGGGACGAGCGGAGG - Intronic
1058053324 9:100427358-100427380 GCGGCAGCCGCGGCGACCGGGGG - Intronic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1059470938 9:114504722-114504744 TCGGCGGCCGGGGCGGGCGGCGG - Exonic
1060856051 9:126915309-126915331 GCGGCTGCAGGTGCGGGGGGCGG + Intronic
1060952326 9:127612205-127612227 CCCGCCGCCGGCGCGCGCGGGGG - Intergenic
1061293659 9:129666026-129666048 GCGGCTGGCGGCGCGCCCCGGGG + Exonic
1061317114 9:129803257-129803279 GCTGCTGGCGGCCCGAGTGGTGG + Exonic
1061347944 9:130042456-130042478 GGGGCGGCCGGGGCGAGCGCCGG - Intronic
1061386539 9:130293977-130293999 GGGGCTGCCTGCGGGAGGGGTGG + Intronic
1061975883 9:134067888-134067910 GCGGCGGGCGGCGCGGGCGGCGG - Intronic
1062575507 9:137205487-137205509 GCGGCGGCAGGCGCGGGCGAGGG - Exonic
1062659179 9:137619286-137619308 GCGGCTGGGGGAGCGGGCGGGGG + Intronic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1187154621 X:16712017-16712039 GCGGGCGCTGGCGCGGGCGGAGG + Exonic
1189821323 X:44872776-44872798 CCCGCGGCGGGCGCGAGCGGCGG - Intergenic
1195210738 X:102651167-102651189 GCGGCTGCGGGGCCGGGCGGAGG - Intergenic
1197709374 X:129654781-129654803 GAGGCGGCCAGCGGGAGCGGCGG - Exonic
1200129034 X:153830993-153831015 CCGGCTGCGGGAGGGAGCGGCGG + Intergenic
1200292501 X:154886384-154886406 GCGGCTGCAGGCCTGGGCGGCGG + Exonic
1200339345 X:155382124-155382146 GCGGCTGCAGGCCTGGGCGGCGG + Exonic
1200347125 X:155458569-155458591 GCGGCTGCAGGCCTGGGCGGCGG - Exonic