ID: 1126348367

View in Genome Browser
Species Human (GRCh38)
Location 15:47718852-47718874
Sequence CAGGGGCATGGTGAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1110
Summary {0: 1, 1: 1, 2: 8, 3: 104, 4: 996}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126348356_1126348367 3 Left 1126348356 15:47718826-47718848 CCGCCGCTCGCGCCGGCAGCCGC 0: 1
1: 0
2: 2
3: 20
4: 262
Right 1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG 0: 1
1: 1
2: 8
3: 104
4: 996
1126348354_1126348367 14 Left 1126348354 15:47718815-47718837 CCGGGAGGGAGCCGCCGCTCGCG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG 0: 1
1: 1
2: 8
3: 104
4: 996
1126348357_1126348367 0 Left 1126348357 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG 0: 1
1: 1
2: 0
3: 14
4: 133
Right 1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG 0: 1
1: 1
2: 8
3: 104
4: 996
1126348362_1126348367 -9 Left 1126348362 15:47718838-47718860 CCGGCAGCCGCTGGCAGGGGCAT 0: 1
1: 0
2: 2
3: 23
4: 213
Right 1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG 0: 1
1: 1
2: 8
3: 104
4: 996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126348367 Original CRISPR CAGGGGCATGGTGAGGAGGA AGG Exonic
900031160 1:373988-374010 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
900031162 1:374000-374022 GAGGGGGATGGAGAGGGGGATGG - Intergenic
900031195 1:374109-374131 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
900051728 1:602237-602259 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
900051730 1:602249-602271 GAGGGGGATGGAGAGGGGGATGG - Intergenic
900051749 1:602309-602331 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
900425621 1:2577181-2577203 CACAGGCATGGTGAGCAGCATGG - Intergenic
900475199 1:2873199-2873221 CAGGGAGTTGGGGAGGAGGAAGG - Intergenic
900497662 1:2983407-2983429 CAGGGGGATGGGGAGGAGATAGG - Intergenic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
900759614 1:4462076-4462098 CAGAGGCCAGGTGAGGAGAAGGG - Intergenic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
900944619 1:5822835-5822857 CAGAAGCATGGTGAGGACGGAGG - Intergenic
901123858 1:6915725-6915747 CACTGGCGTGGTGAGGAAGATGG + Intronic
901167293 1:7229620-7229642 GAGGGGGAAGGAGAGGAGGAAGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901403981 1:9033825-9033847 AAGGGGGTTGGGGAGGAGGAAGG - Intergenic
901670552 1:10853684-10853706 CAGGGCCATGGTGATGATGGTGG - Intergenic
901819329 1:11816671-11816693 CACTGGCCTGGTGAGGAGGCAGG + Exonic
901824168 1:11849761-11849783 CAGGGGCATGGGGAAGGTGAAGG - Intergenic
902231264 1:15029186-15029208 GAGCATCATGGTGAGGAGGAGGG + Intronic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
902644967 1:17791625-17791647 CATCAGCATGGTGAGGAGGCTGG + Intronic
902707025 1:18212689-18212711 CAGGGGCATGTTGAGCAGAGGGG - Intronic
902726693 1:18340941-18340963 GAGGGGGAGGGGGAGGAGGACGG - Intronic
903027745 1:20441781-20441803 TACAGGCATGGTGAGGAGGTGGG + Intergenic
903181254 1:21606036-21606058 CCGGGGCCTGGGGAGGGGGAGGG + Intronic
903391991 1:22971221-22971243 CAGCTGCATTTTGAGGAGGAGGG - Intergenic
903443514 1:23405968-23405990 TAGGGGTAAGGTGAGAAGGAGGG - Intronic
903463403 1:23534921-23534943 CATGGGGATGGAGGGGAGGAGGG - Intergenic
903529691 1:24020723-24020745 GAGGGGCAAGTTGGGGAGGAGGG - Intergenic
903865183 1:26392675-26392697 GAGGAACATGGTGAGGAGCACGG + Intergenic
903967307 1:27098950-27098972 CACTTGCATGGAGAGGAGGATGG + Exonic
904031319 1:27535147-27535169 CAGGTGCTGGGTGAGGAGGTGGG + Intronic
904200963 1:28818778-28818800 CATGGGGATGGTGAGAGGGAGGG + Intronic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904431782 1:30469009-30469031 GAGGGGCATGAGGGGGAGGAAGG + Intergenic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904557558 1:31375012-31375034 CAGGTGCCAGGAGAGGAGGAGGG + Intronic
904756551 1:32771489-32771511 CAGGGGCAGGGGGTGGGGGAGGG - Exonic
904772594 1:32888680-32888702 CAGGGAGATGGTGTGGAGCATGG + Intronic
904965118 1:34366181-34366203 CAGGGGCACAGGGAGGTGGAGGG - Intergenic
905018886 1:34795030-34795052 GTGGGGCATGGTGGGGATGAGGG - Exonic
905274383 1:36807544-36807566 CTGGGGCATGGGCAGGGGGATGG + Intronic
905295693 1:36953182-36953204 CAGGGGCAGGGGGAGGGGCAAGG - Intronic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
905591211 1:39165657-39165679 CAGCAGCATAGTGAGGATGAAGG - Intronic
906065223 1:42975651-42975673 CAGGGCTGTGGTGAGGATGAAGG + Intergenic
906515281 1:46435467-46435489 CAGGGTCATGGTCAGGACGAAGG - Intergenic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
907267253 1:53270354-53270376 TAGCTGCATGTTGAGGAGGAGGG + Intronic
907523600 1:55040551-55040573 CAGGGGCGGGGTGGGAAGGACGG + Intronic
907638234 1:56157966-56157988 CAGGTGCATGGGCAGGAGGTGGG + Intergenic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
907830486 1:58060123-58060145 GAGCAGCAGGGTGAGGAGGAAGG + Intronic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
908328621 1:63048537-63048559 CATGGGCAGGGTGTGGAGGATGG + Intergenic
908658802 1:66416547-66416569 CAGAGGCTGGGTGAGGAGGTGGG - Intergenic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
909170235 1:72284333-72284355 AAGGGGGATGGGGTGGAGGAAGG - Intergenic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
909822675 1:80086017-80086039 CAAGGTCTTGGTGATGAGGATGG + Intergenic
909840556 1:80316636-80316658 AAGGGGTATGGTGGGGAGTATGG - Intergenic
909935658 1:81547348-81547370 GAGGGGAATGGTGAGGGGAAAGG - Intronic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
911936469 1:103981438-103981460 ATGGGGCATGGGGCGGAGGAGGG + Intergenic
912046151 1:105460528-105460550 TATGGGCATCGTGAGCAGGAGGG + Intergenic
912342014 1:108925691-108925713 CAGTGGCATGGTGGGGACAAAGG + Intronic
912385304 1:109268472-109268494 GAGGGGCCTGGTGGGGAGCAGGG + Intronic
912688628 1:111786785-111786807 CAGGAGACTGGTGAGCAGGAAGG + Intronic
912775275 1:112502710-112502732 CAGGGGTTAGGAGAGGAGGAGGG + Intronic
912977846 1:114346243-114346265 AAGGGGGATGGAGGGGAGGATGG - Intergenic
913234163 1:116765719-116765741 AAGGAGCATGGAGAGGAGCATGG - Intronic
913669533 1:121083022-121083044 CAGAGTCATGGTGACAAGGACGG - Intergenic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
914971540 1:152311358-152311380 CGGGGTCAAGGAGAGGAGGAAGG - Exonic
915113282 1:153578434-153578456 AAGGGGCTTGCTAAGGAGGAGGG + Intergenic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
915931011 1:160061086-160061108 TGGGGGCATGGTGAGGGGAAGGG - Intronic
915967450 1:160323480-160323502 AAGGGGCATAGTGGGGTGGAAGG + Exonic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916713316 1:167431108-167431130 CAGGGGCATGGGAAGGTGGGCGG - Exonic
917495959 1:175540392-175540414 CTTGGGGATGGTGAGGAGAAGGG + Intronic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917747936 1:178028535-178028557 CAGGGGCTTTGTGAGGATCAAGG + Intergenic
919742794 1:200990837-200990859 CAGGGCCAGGGTGAGGAAGAGGG - Intronic
919905789 1:202077460-202077482 GACAGGCATGGTGAGCAGGAGGG + Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920199708 1:204252076-204252098 CAGGGGCAGGGAGAGGGGGCAGG - Intronic
920344027 1:205294407-205294429 GAAGAGAATGGTGAGGAGGATGG + Intergenic
920371040 1:205479532-205479554 CAGGACCATGGTGATGGGGAGGG + Intergenic
920415178 1:205794830-205794852 CAGGGGCATGGGAAGGAGCCAGG - Intronic
920631439 1:207656672-207656694 CAGGAGCAAGGTGGGGAGGACGG + Intronic
920641924 1:207760797-207760819 GAGGAGCAAGGTGGGGAGGACGG + Intronic
920867814 1:209767978-209768000 TAGGGGGTTGGTGGGGAGGAGGG - Intronic
921165185 1:212502011-212502033 CAGGGAGATGGTGGGGAGGTGGG + Intergenic
921276311 1:213524272-213524294 CTGGGTGATGGTGAGGAGCAGGG - Intergenic
921575580 1:216831010-216831032 AAGGGGCAAGGTGGGGAGGTTGG + Intronic
922071048 1:222193828-222193850 CAGGACCCTGGTGAGGGGGAGGG - Intergenic
922131832 1:222787604-222787626 CAAGGGCGTCCTGAGGAGGACGG - Intergenic
922167222 1:223126334-223126356 CAGGGGCTGGGAGGGGAGGATGG + Intronic
922496741 1:226063050-226063072 CAGGGGCGCGGGGAGGAGGAGGG - Intronic
922724884 1:227918179-227918201 GAGGGCCCTGGAGAGGAGGAGGG - Intergenic
922852779 1:228747900-228747922 CAGGGACATGGGGAGGAGTCAGG + Intergenic
922860993 1:228816164-228816186 CAAGGTCATGGTGAGGTTGATGG + Intergenic
922873402 1:228921056-228921078 CAGGAGCAGGGAGAGGCGGAGGG + Intergenic
922886207 1:229022841-229022863 CTGGTGCATGGGGAGGAGGCGGG + Intergenic
922887308 1:229030048-229030070 GAGGTGCCTGGGGAGGAGGAAGG - Intergenic
922895809 1:229099211-229099233 CTGGGACCTGGTGAGGTGGAAGG - Intergenic
922920711 1:229300530-229300552 GTGGGACAAGGTGAGGAGGAAGG + Intronic
923086070 1:230704313-230704335 TTGGGGCATGGTCAGGTGGATGG + Exonic
923407139 1:233673268-233673290 CAGGGACATGGTCAGCAGGGAGG - Intergenic
923526226 1:234775000-234775022 CAGGGGCATGGTGGGGAAGAAGG - Intergenic
923652638 1:235888414-235888436 GTGGGGGGTGGTGAGGAGGAGGG - Intergenic
923672302 1:236051247-236051269 GAGGGGCAGGGGGAGGGGGAGGG - Intronic
924230757 1:241959873-241959895 AAAGGGCACGGTGAGGAGCAAGG + Intergenic
924425205 1:243944258-243944280 TAGGGGGATGGGGTGGAGGAGGG - Intergenic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063121326 10:3106947-3106969 CAGGGGCAGGGTGAGGAGAGGGG - Intronic
1063169491 10:3494814-3494836 TAGGGGGAAGGTGGGGAGGATGG + Intergenic
1063828953 10:9930723-9930745 CAGGGGCTGAGTCAGGAGGATGG + Intergenic
1063849205 10:10164861-10164883 CTGGGGCATGGTGAGGGATAAGG + Intergenic
1064370688 10:14749733-14749755 CAGCGGGATGGTAGGGAGGATGG - Intronic
1064432492 10:15283226-15283248 CAGGGGCAAGCTGTGGAGGTGGG - Intronic
1064458099 10:15507553-15507575 CTGGGGCATGGTGACGGGGGAGG - Intergenic
1064459248 10:15517733-15517755 CATAGGCAAGGTGAGCAGGAGGG + Intronic
1066074087 10:31855012-31855034 GAGGAGGATGGGGAGGAGGAGGG + Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1066481282 10:35798104-35798126 CAGGAGCCTGATGAGGAGGGCGG + Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067058623 10:43066439-43066461 GAGGAACATGGGGAGGAGGATGG + Intergenic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1069101668 10:64330104-64330126 CAGGGGCAGGGTGTGAGGGAAGG + Intergenic
1069659242 10:70112671-70112693 GAGGGGCAGGGTGGGGAGGTGGG + Exonic
1069671844 10:70212682-70212704 CCAGGGCCTGGAGAGGAGGAGGG + Intronic
1069752656 10:70754030-70754052 GAGGGGCTTGGGGAGGAGGTGGG + Intronic
1069833175 10:71293482-71293504 GTGGGGCATGGTGAGGATGACGG - Exonic
1069862361 10:71479704-71479726 CAGGGGCCCGGTGAGGATCAGGG + Intronic
1069889385 10:71643785-71643807 GAGAGGTATGGAGAGGAGGAAGG - Intronic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1070383236 10:75900609-75900631 CAGGGGCATGCTGCGGGGGCTGG - Intronic
1070390259 10:75964101-75964123 TAGTGACATGGTGGGGAGGAGGG + Intronic
1070824121 10:79380980-79381002 AGAGGGCATGGTGTGGAGGAGGG + Intergenic
1071377520 10:85024007-85024029 CAAGGGAATGGGGAGTAGGAGGG - Intergenic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1072223246 10:93345438-93345460 CAGGGGGATAGCGGGGAGGAGGG + Intronic
1072524777 10:96262063-96262085 CAGGAACATGGTGATAAGGAGGG - Intronic
1072604819 10:96971587-96971609 CAGGGACAGGGTGCTGAGGAGGG + Intronic
1072826581 10:98612922-98612944 CCGGGGCATGATGAGGAAGGGGG - Intronic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073080075 10:100854113-100854135 TAGGGCCATGGTGAGGGTGAGGG - Intergenic
1073091139 10:100940791-100940813 CAGGGGCAGGGGGAGGGGCAGGG - Intronic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1073799845 10:107029397-107029419 GAAGTGTATGGTGAGGAGGATGG - Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074618281 10:115092802-115092824 CAGGAGGATGGGGCGGAGGAAGG + Intergenic
1074746140 10:116534465-116534487 CAGGGGAATGGTGGGGGGCAAGG - Intergenic
1074780755 10:116800342-116800364 CAGAGGCTTGGTGAGGGGGTGGG + Intergenic
1074960164 10:118437442-118437464 CAGAGGGATGGTGAGAAGCAAGG - Intergenic
1075437913 10:122459126-122459148 CTGGGGCATGGTAAAGAAGACGG + Intergenic
1075549081 10:123378975-123378997 CAAGGCCATGCTGAGCAGGAGGG + Intergenic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076526942 10:131117935-131117957 CAGGGCCAGGGTTGGGAGGAGGG - Intronic
1076601286 10:131658568-131658590 CTCGAGCAGGGTGAGGAGGAAGG + Intergenic
1076682683 10:132182088-132182110 TAGGGGCTTTGTGAGGAGCATGG + Intronic
1076806278 10:132860716-132860738 CAGGTGCTTGGTGGAGAGGAAGG - Intronic
1076854509 10:133109264-133109286 CGGGGGCTGGGAGAGGAGGAGGG - Intronic
1076963699 10:133787274-133787296 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1077016301 11:400454-400476 GAGGGGCGCGGTGTGGAGGAGGG + Intronic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077294250 11:1817156-1817178 CAGGGGCTGGGGGAGGTGGAGGG + Intergenic
1077614621 11:3666143-3666165 CAGGGCCATGGAGAAGAAGATGG + Exonic
1077806489 11:5596076-5596098 GCGGGGCCTGGGGAGGAGGAGGG - Intronic
1077970588 11:7185001-7185023 CAAGGGAAGGGAGAGGAGGAGGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078329435 11:10407762-10407784 CGGGGGCAAGGAGAGCAGGAGGG - Intronic
1078464937 11:11543372-11543394 CAGGGACGTGGTGAGGACAAAGG + Intronic
1078528485 11:12118634-12118656 CAGGGGCATGTTGTGGATGCAGG + Intronic
1078561389 11:12376432-12376454 CACGTGCATGCTGAGGAGTAGGG - Intergenic
1079099770 11:17533908-17533930 CAGGGGCCTGGGGAGGGGGAAGG - Intronic
1080097251 11:28423714-28423736 CAGGGGAATGGAGAGTAGTAGGG + Intergenic
1080763291 11:35273208-35273230 TAGGGGCAGGGTGTGGAAGAGGG + Intronic
1081132948 11:39402860-39402882 CAGCGGGAAGGTGAGAAGGAGGG - Intergenic
1081442135 11:43092469-43092491 CAAGGGCATGGTGAGGAGCTGGG - Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081656832 11:44862878-44862900 CATGGCCCTGGGGAGGAGGAAGG + Intronic
1081683294 11:45023813-45023835 CTAGGCCATGGTGAGGAGGCTGG - Intergenic
1081735947 11:45404372-45404394 CAGGAGGATGGTGATGGGGAAGG - Intergenic
1081934682 11:46896523-46896545 CAGTGGGATGGTGAGGAATATGG + Intronic
1082899259 11:58228114-58228136 CAGGACCACGGTGAGGTGGAAGG + Exonic
1083175381 11:60946612-60946634 CGGGGGCTTGGTGATGAAGACGG + Exonic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083337320 11:61931146-61931168 CAGTGGCATGGAGTAGAGGAGGG - Intergenic
1083341638 11:61962119-61962141 CTGGGGCATGGTGAGGAAGACGG + Intronic
1083659371 11:64245191-64245213 CAGGGTCAAGGTGAGGGGGCTGG - Exonic
1083800939 11:65045908-65045930 CAGGGGGCTGGTGGGGAGGCAGG + Exonic
1083866276 11:65455207-65455229 GAGGGGCGTGGCGAGGAGGTGGG + Intergenic
1083964655 11:66035976-66035998 GAAGGGCATGGAGAAGAGGAAGG - Intergenic
1083988087 11:66230057-66230079 CAGTGGCTTGGGGATGAGGAAGG + Intronic
1084031051 11:66480684-66480706 CCGGGGCAGGGCGAGGAGGCTGG + Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084148109 11:67275637-67275659 AAAGGCCATGGTGAGGCGGAGGG - Intronic
1084274265 11:68043680-68043702 CAGGGGCCTGGGGAGCAGGGCGG - Intronic
1084534997 11:69751299-69751321 CTGTGGGCTGGTGAGGAGGATGG + Intergenic
1084617465 11:70246104-70246126 CAGGGGCTCTGTGAGGAGAATGG - Intergenic
1084863575 11:72038631-72038653 CAGGGGGAGGGTGGGGAGGATGG - Intronic
1085047966 11:73364251-73364273 CAGGGGCAGGGTGTGGGGGAGGG - Intronic
1085301695 11:75462586-75462608 CAGGGCTTTGGTGAGGAGGCTGG - Intronic
1085304581 11:75477824-75477846 CAGGGGAAGGGTGAGGAGTCAGG + Intronic
1085535046 11:77212559-77212581 CAGGAGTATGGTGAGGAGGCTGG + Intronic
1085609338 11:77933198-77933220 GAGGGGGATGGAGAGGGGGACGG - Intronic
1085733105 11:79016039-79016061 CTGGGGCATGGTGAGTAGAAGGG + Intronic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085961672 11:81469300-81469322 CAGGGGGACGGTGAGGGAGATGG + Intergenic
1086286950 11:85261860-85261882 CAGGGGGAAGGTGAGGGAGAAGG + Intronic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1086681646 11:89680433-89680455 GTGGGCCATGGTGAGGATGATGG + Intergenic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1088256932 11:107911771-107911793 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1088971224 11:114776136-114776158 CAGAGGCCTGGGGAGGATGAGGG + Intergenic
1089220954 11:116871204-116871226 CTGGGGCATGGTGATGATGTGGG - Intronic
1089289252 11:117427939-117427961 TGGGGGGAAGGTGAGGAGGAGGG + Exonic
1089309309 11:117547387-117547409 CTGGGCCTTGGGGAGGAGGATGG + Intronic
1089577673 11:119458156-119458178 CAGGGGGATTGTGGGGAGAATGG + Intergenic
1089634604 11:119804191-119804213 CAGGTGCAAGGAGAGGTGGAAGG + Intergenic
1089655469 11:119943940-119943962 GAAGGGCATGGTAAGGAGGTGGG - Intergenic
1089679298 11:120110436-120110458 CAGCAGCGTGGAGAGGAGGAAGG + Intergenic
1090776298 11:129968777-129968799 CAGGGGGATGGTGAGTGGGTAGG - Intronic
1090965594 11:131595260-131595282 GAGGCGCATGGTGATGTGGAGGG - Intronic
1091250746 11:134141779-134141801 CAGGTGGCTGGAGAGGAGGATGG + Intronic
1091457268 12:617394-617416 CAGGGGCAGGATTAGAAGGAAGG - Intronic
1091590900 12:1842541-1842563 AGGGGGCCTGGTGAGGAGGGAGG - Intronic
1092853873 12:12654921-12654943 GAGTTGCATGGTGGGGAGGATGG - Intergenic
1093092290 12:14935666-14935688 TAAGGGCAGGGTGAAGAGGAGGG - Intronic
1093247752 12:16761346-16761368 CAGGGCCATGGGGAGAAAGAAGG - Intergenic
1093670415 12:21867774-21867796 AAGGGGCCTGAAGAGGAGGATGG + Intronic
1094091041 12:26650271-26650293 CCAGGGGATGGTGAGGAGGTGGG + Intronic
1094108310 12:26835730-26835752 TAGGGACAGGGTGAAGAGGAAGG - Intergenic
1094555751 12:31497918-31497940 CAGGGGCAAGGGCAGGGGGAGGG + Intronic
1094627146 12:32135042-32135064 GAGGGGAATGGAGGGGAGGAGGG - Intronic
1095578305 12:43764725-43764747 CAGGGGCATTGTGATGGAGAAGG + Intronic
1095818762 12:46453677-46453699 AAGGGCCATGTTGAGGAGGTAGG + Intergenic
1096113599 12:49042442-49042464 CAAGGGAATGGGGAGGAGCAGGG + Intronic
1096114284 12:49046226-49046248 CAGGGCCAAAGTGAGGAGAAAGG + Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096217978 12:49808976-49808998 CAGGGGGAGGGAGAGAAGGAGGG + Intronic
1096420275 12:51451060-51451082 CAGGGGAATGGGGAGGCTGAGGG + Intronic
1096500371 12:52060916-52060938 CTGAGGCTCGGTGAGGAGGAGGG - Intergenic
1096618536 12:52848205-52848227 CAGGGGAAAGGTGAGGCTGATGG - Intronic
1096976787 12:55703870-55703892 CATGGACATGGGGAGAAGGAAGG - Intronic
1097240226 12:57569903-57569925 AAGGGGCATGGTGAGTGAGAAGG + Intronic
1097536868 12:60883325-60883347 CAGGGGAAAGGTTGGGAGGAGGG - Intergenic
1098074725 12:66716688-66716710 CAGAGTCATGGTGAGTGGGAGGG - Intronic
1098187802 12:67916466-67916488 CAGGGGCACAGTGAGGTGCAAGG - Intergenic
1098685641 12:73416419-73416441 CAGAGACATGGTGAGAAGGACGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098976579 12:76908491-76908513 GAGGGGGATGGTGAGGTGGGAGG - Intergenic
1099195270 12:79608299-79608321 CAGGGGGATGGCAGGGAGGATGG + Intronic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1100322596 12:93509880-93509902 CTGGGGGATGGTGATGAGGGAGG - Exonic
1101176680 12:102159055-102159077 CAGAAGCATGGTTAGGAAGATGG - Intronic
1101979517 12:109393507-109393529 CAGATGCGTGGTGAGAAGGAAGG - Intronic
1102201295 12:111059651-111059673 GAGGGCTATGGTGAGGAGGTGGG + Intronic
1102416229 12:112765201-112765223 CATGGGAGTGGTGGGGAGGAAGG + Intronic
1102427094 12:112852363-112852385 CATGTGCATGCAGAGGAGGAAGG + Intronic
1102767098 12:115443053-115443075 CAAGGGCATGGAGAGGAAAAAGG - Intergenic
1102887911 12:116535415-116535437 CCGAGGCTTGGAGAGGAGGAGGG - Intergenic
1103056357 12:117824248-117824270 AAGGGGCAGGGGGAGGGGGAGGG + Intronic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103722653 12:122982814-122982836 CAGGGGCAGGGGGTGGAGGTTGG + Exonic
1103851872 12:123938634-123938656 CAGGGGCCAGGCAAGGAGGATGG - Intronic
1104276530 12:127333608-127333630 CAGGGGCAGGGTGGGCAGAACGG + Intergenic
1104707436 12:130958061-130958083 GAGGGGAACAGTGAGGAGGAAGG - Intronic
1104946155 12:132415715-132415737 CAGGGGCCTGGTGGGGAGCCTGG - Intergenic
1104974175 12:132544854-132544876 GAGGGTGATGGTGATGAGGATGG + Intronic
1105211201 13:18258160-18258182 CTCGGGCATGGTGAGATGGATGG - Intergenic
1105575803 13:21650556-21650578 GAGGGGGCTGGGGAGGAGGAGGG - Intergenic
1105654456 13:22420797-22420819 CATGGGCATGGTGAGATGAATGG + Intergenic
1105898040 13:24734356-24734378 CAGGGCCTTGGTGAGCAGCACGG - Intergenic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1106653191 13:31714567-31714589 CATAGGCATGGTAAGGATGAGGG - Intergenic
1106679960 13:31999451-31999473 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1107684972 13:42887550-42887572 CTGGGGGACGGTGAGGCGGAGGG + Exonic
1107718556 13:43224885-43224907 CAGGAGCAGGGAGAAGAGGAAGG - Intronic
1108082341 13:46749373-46749395 CAGGGGCTGGGTGGGGAGGTGGG + Intronic
1108283356 13:48881460-48881482 AAGGAGAATGGAGAGGAGGAAGG + Intergenic
1111986329 13:95070341-95070363 CAGGTGCTTGGGGAGAAGGAGGG + Intronic
1111995146 13:95158277-95158299 CAGAAGCATGATGAGGGGGATGG + Intronic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1112415667 13:99201296-99201318 ATGGGGCATGGTAAGGGGGACGG - Intronic
1112576191 13:100638810-100638832 CAGGGCCGTGGTGTGGAGGACGG + Intronic
1112577112 13:100645564-100645586 CAGGGACATGGAGAGGTGCACGG - Intronic
1113492349 13:110702482-110702504 AAGGAGCATGGTGATGAGAATGG - Intronic
1113660470 13:112103852-112103874 CGGGGGCGCGGGGAGGAGGAGGG + Intergenic
1113868264 13:113543174-113543196 GAGGGGCAGGGGGAGGAGGTGGG - Intronic
1113868309 13:113543295-113543317 CGGGGGCAGGGGGAGGAGGTGGG - Intronic
1113868377 13:113543452-113543474 CATGGGCAGGGGGAGGAGGTGGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114183571 14:20384004-20384026 CAGGGGCCTGGGCAGGAGGGAGG - Intronic
1114619679 14:24087943-24087965 CAGGAGCCTGGGGAGGATGAGGG + Intronic
1114646262 14:24258250-24258272 CAGGGGCATGGTGGGGAGTGGGG + Intronic
1114971120 14:28029906-28029928 CAGGGGTATAGAGTGGAGGAGGG + Intergenic
1115375831 14:32674189-32674211 CAGGGGCATGGTGATCAAGAGGG + Intronic
1115511051 14:34138178-34138200 CAGGGGCATGGGAAGGAGAGTGG + Intronic
1115716854 14:36115191-36115213 CATCTGCATAGTGAGGAGGAAGG - Intergenic
1115906668 14:38209417-38209439 CTGGGGCTAGGAGAGGAGGAAGG - Exonic
1116256431 14:42562316-42562338 CAGGAGGAAGGTAAGGAGGAAGG - Intergenic
1116606462 14:47003001-47003023 TGGGGACAAGGTGAGGAGGAAGG - Intronic
1116663534 14:47744823-47744845 CAGGGCCATGGTGAGGATTAAGG - Intergenic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1117461472 14:55949447-55949469 CAGGGGCAGGGTGGTGGGGAAGG - Intergenic
1117541037 14:56746732-56746754 GAGGTGGATGATGAGGAGGAGGG + Intergenic
1118157444 14:63255582-63255604 CAGGAGCATGGAGTGGGGGAGGG - Intronic
1118255114 14:64199098-64199120 CAGGTGCCTGGGGAGGAGGCTGG - Intronic
1119115655 14:72018776-72018798 CAGGATCATGGTGAGGGAGAAGG - Intronic
1119500812 14:75126273-75126295 CAAGGTCGGGGTGAGGAGGAGGG - Intronic
1119859778 14:77927786-77927808 CCAGAGCGTGGTGAGGAGGACGG + Intronic
1119871299 14:78020295-78020317 CAGGGGCATTGTAAGAAGAATGG + Intergenic
1119975216 14:79017420-79017442 TAACGGCATGGGGAGGAGGAGGG - Intronic
1120047911 14:79829013-79829035 GAGGGTGATGGTGAGGAAGAAGG - Intronic
1120381854 14:83790556-83790578 CAGAGGCATGGTGAGGACCTTGG - Intergenic
1120743652 14:88134479-88134501 CAAGGATATGGTGAGTAGGAGGG + Intergenic
1121060895 14:90908624-90908646 GAGTGGCGTGGTGAGGAGAAAGG + Intronic
1121210982 14:92207741-92207763 CTGGGGCATGGTATGGAGTATGG + Intergenic
1122646937 14:103201105-103201127 CAGGGGGATAGTGGGGAGGGGGG - Intergenic
1122920631 14:104878550-104878572 CGGGAGCATGGTGGGGAGGATGG - Intronic
1123443016 15:20304015-20304037 CAGGGCCAGGGTCAGGAGCAAGG - Intergenic
1124607712 15:31183944-31183966 GAGGGGGAGGGAGAGGAGGAGGG - Intergenic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1125531417 15:40415956-40415978 CAGGGGCATGGAGAGGAGATGGG - Intronic
1125609533 15:40961112-40961134 CCAGGGCAGGCTGAGGAGGAAGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126397333 15:48232885-48232907 GATGGGGATGGTGATGAGGAGGG - Intronic
1126414271 15:48401620-48401642 CAGTGGTATGGAGAGGAGGCAGG + Intergenic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126688489 15:51268253-51268275 CAGGGGATGGGTGTGGAGGAAGG - Intronic
1126849585 15:52789125-52789147 CGTGGGGATGGTGCGGAGGAAGG + Exonic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1127960648 15:63887927-63887949 CAGGGGTAGGGTCAGGAGGAAGG - Intergenic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128249104 15:66152376-66152398 GAGAGGAAGGGTGAGGAGGAGGG - Intronic
1128390850 15:67181473-67181495 CAGGGGCAGGGTGGGGGGGCGGG - Intronic
1128671672 15:69578452-69578474 TGAGGGCAAGGTGAGGAGGAGGG + Intergenic
1128744417 15:70103509-70103531 CAGGTGCGGGGTGAGGGGGAAGG - Intergenic
1129288157 15:74541770-74541792 CAGGGGAATGGTCAGCAGGCCGG + Intronic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129336630 15:74855962-74855984 CAGGGGCACAGTAAAGAGGATGG - Intronic
1129352216 15:74962731-74962753 CTGAGCCATGGTGAGGAGGTTGG - Intronic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1129672837 15:77616614-77616636 CAGGTGCAGGGGGAGGAGGGAGG - Intronic
1129700176 15:77763304-77763326 CTGGGGCCTGGAGAGGAGGAGGG + Intronic
1129717252 15:77859659-77859681 CAGGAGCCTGGAGAAGAGGAGGG + Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1130195524 15:81777147-81777169 CTGGGGCATGGTCAGGACGGTGG - Intergenic
1130533050 15:84762303-84762325 GAGGGGTTTGGTGGGGAGGAAGG + Intronic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130868541 15:87952496-87952518 CCGGGGCAGGGAGAGGAGGTGGG - Intronic
1130959901 15:88652557-88652579 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
1131261062 15:90888033-90888055 CAGGGCCATGGTGAGGACTTTGG + Intronic
1131536047 15:93238901-93238923 CATCAGGATGGTGAGGAGGAAGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132481674 16:169393-169415 CTGGGGCAGGGAGGGGAGGAGGG - Intergenic
1132626494 16:894092-894114 CAGGGGCATGGGTGGGCGGACGG - Intronic
1132789150 16:1675444-1675466 AAGAGGAATGGTGGGGAGGAGGG - Exonic
1132839402 16:1971719-1971741 CAGGGGCAGGGTCAGGTTGACGG + Intergenic
1132957081 16:2600035-2600057 AAGGGGCTGGGTGAGGAGAAAGG - Exonic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133020147 16:2963565-2963587 GCGGGGCAGGGGGAGGAGGAGGG + Intergenic
1133109210 16:3535768-3535790 CAGGGGCTTGGAGAGAGGGAAGG - Intronic
1133427222 16:5703229-5703251 CAGGGGCATGGAGCTGAGTATGG + Intergenic
1133592179 16:7256497-7256519 AAGGGGAATGGTGATTAGGAAGG - Intronic
1133613019 16:7450819-7450841 CAGGGGTCTGGTGGGGTGGATGG + Intronic
1133854060 16:9533187-9533209 CACGGGCGGGGTGAGAAGGACGG - Intergenic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134810846 16:17165986-17166008 CAGGAGCATGGGGAGGAAGAAGG + Intronic
1134955761 16:18381500-18381522 CAGGGGCTAGGTGAGGGGGGAGG + Intergenic
1135309119 16:21391638-21391660 CAAGGGCATGGGTAGGGGGAAGG - Intergenic
1136011037 16:27363528-27363550 CAGTGTCATGGCCAGGAGGATGG + Exonic
1136228565 16:28874098-28874120 CCGAGGCAGGGTGAGGGGGAAGG + Exonic
1136233873 16:28903092-28903114 CAGGGACATGGAGAGGCAGATGG - Exonic
1136251638 16:29009372-29009394 GAGGGGCAGGGAGAGGAGGAGGG - Intergenic
1136305863 16:29370769-29370791 CAAGGGCATGGGTAGGGGGAAGG - Intergenic
1136344299 16:29664983-29665005 CAGTGGGATGGTGAGAGGGAAGG - Exonic
1136362688 16:29790943-29790965 CAGGGGCGGGGAGAGGGGGACGG + Intronic
1136390017 16:29958092-29958114 CTTGAGCATGGTGAGGAGGGAGG + Intronic
1136544404 16:30947587-30947609 CAGGGGCTGGGGGAGGTGGAAGG + Exonic
1136591627 16:31221261-31221283 GAAGGGCATTGTGAGGAGAAAGG + Intronic
1136775617 16:32870306-32870328 GGGGGTCCTGGTGAGGAGGAGGG + Intergenic
1136777484 16:32879572-32879594 CTGGGGCATGGTGGCGGGGAAGG - Intergenic
1136867546 16:33769432-33769454 CAGAGCCACAGTGAGGAGGACGG - Intergenic
1136893140 16:33981942-33981964 CTGGGGCATGGTGGTGGGGAAGG + Intergenic
1136895000 16:33991206-33991228 GGGGGTCCTGGTGAGGAGGAGGG - Intergenic
1137257526 16:46789453-46789475 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1137564025 16:49522124-49522146 CAGTGGCATGGGGATGAGGGAGG + Intronic
1138161204 16:54756516-54756538 CTGGGGCATGGTGAGGAAAAGGG - Intergenic
1138182055 16:54948026-54948048 CAAGGGCTTGGAGAGGAGGAAGG - Intergenic
1138535893 16:57660212-57660234 CAGGGGCATGCGGAGGTTGAGGG - Intronic
1138610000 16:58115365-58115387 CATGGGCATGGTGCAGATGAAGG + Exonic
1138680158 16:58678371-58678393 GAGGGGCAGGATGAAGAGGAAGG + Exonic
1139327803 16:66165566-66165588 CAGTGGCATGGTGAGAGGGGAGG - Intergenic
1139394571 16:66630298-66630320 GAGGGGGAGGGTGAGGGGGAGGG - Intronic
1139435215 16:66932919-66932941 CAAAGGCATGATTAGGAGGAAGG - Intronic
1139562157 16:67749959-67749981 GAGGGGCAGGGGTAGGAGGAGGG - Intronic
1139649266 16:68354057-68354079 GAGGGGCAGGGTGAGGAGCATGG + Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139857363 16:69991513-69991535 CAGGGGCCTGGTGACCAGGACGG + Intergenic
1139962819 16:70727757-70727779 CAGGAGCATGGGGAGGATGGAGG + Intronic
1140962898 16:79933903-79933925 AAGGAGCCTGGTGAGGGGGAAGG + Intergenic
1141033741 16:80610994-80611016 CTGGGGCCTGGTGAGGATGGTGG - Intronic
1141166705 16:81665684-81665706 CAGGGGCATGGTGTGGAGACAGG - Intronic
1141204922 16:81926146-81926168 CAGGGGCATGATAGGGACGACGG + Intronic
1141372444 16:83500487-83500509 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1141441324 16:84031511-84031533 CAGGGGAACAGTGAGGAGGCCGG - Intronic
1141570222 16:84929596-84929618 GAGGGGCATGGAGAGGAGGAAGG + Intergenic
1141608862 16:85170212-85170234 CAGGGGCGCGCGGAGGAGGAGGG + Intergenic
1141712764 16:85709667-85709689 CAGGGAGAGGGTGAGGAGGTGGG - Intronic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141888761 16:86912076-86912098 GAGGGGCAGGGTGATGATGATGG - Intergenic
1141928085 16:87182342-87182364 CATGGGGATGGTGATGAGGAGGG - Intronic
1142128594 16:88422161-88422183 CAGGTGGATGGGCAGGAGGATGG + Intergenic
1142256281 16:89015276-89015298 CAGGGGCTGGATGAGGAGGGGGG + Intergenic
1142263369 16:89052645-89052667 CGGAGGCACGGGGAGGAGGAAGG - Intergenic
1203078035 16_KI270728v1_random:1132415-1132437 GGGGGTCCTGGTGAGGAGGAGGG + Intergenic
1203079897 16_KI270728v1_random:1141681-1141703 CTGGGGCATGGTGGCGGGGAAGG - Intergenic
1203104615 16_KI270728v1_random:1346771-1346793 CAGAGCCACAGTGAGGAGGACGG + Intergenic
1203128899 16_KI270728v1_random:1615597-1615619 CAGAGCCACAGTGAGGAGGACGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142603636 17:1069931-1069953 CAGGGGCACGGGGCGGGGGAGGG - Intronic
1142643839 17:1299814-1299836 CAAGGGCCTGGAGAGGAGGCAGG - Exonic
1143101322 17:4506316-4506338 CAGGGGCCTGGGGAAGAGGGTGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143884411 17:10055249-10055271 ATGGGGCATGGTGGGAAGGAAGG + Intronic
1143971669 17:10800276-10800298 CAAGGCCATGGGGTGGAGGAGGG + Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144657015 17:17043086-17043108 CTGGGGCATGGGGACGGGGACGG + Intronic
1144721911 17:17476942-17476964 CAGGGGCGGGGTGTGGAGGAAGG - Intergenic
1144812064 17:18006850-18006872 CAGGGGCAGGGAGTCGAGGAAGG + Intronic
1145783691 17:27580552-27580574 CGGGGGCAAGGTGGGGAGCACGG + Intronic
1146004893 17:29154952-29154974 CAGGGACATGGCGAGGGGAAGGG - Intronic
1146268625 17:31469996-31470018 CAGGCACATGGTGTGAAGGAAGG - Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146673378 17:34756990-34757012 CAAGGGCAAGGCGTGGAGGAAGG + Intergenic
1147258637 17:39196430-39196452 AAGGGGCCTGGGGTGGAGGAAGG + Intronic
1147510812 17:41067488-41067510 CAAGGGTATGCTGAGGTGGAGGG - Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148367507 17:47067429-47067451 CAGGGGCTTGGGCAGGAGCAAGG - Intergenic
1148553570 17:48564641-48564663 CAGGGGCACGGCGAGGCGTAGGG + Intronic
1148614671 17:48991221-48991243 CAGGGGCAGGGGGAGGGGCAGGG + Intergenic
1148745710 17:49916852-49916874 CGTGGGCCTGGTGGGGAGGAGGG - Intergenic
1149107099 17:52982639-52982661 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1149270295 17:54969472-54969494 CAGGGCCATGGTGAGGACCCGGG - Intronic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149561195 17:57609104-57609126 CAGGGAGATGGTGAAGAGGAGGG - Intronic
1149649775 17:58269463-58269485 CAGAGACCTGGTGAGGAGGCAGG - Intergenic
1149691343 17:58579473-58579495 CATGAGGTTGGTGAGGAGGAAGG + Intronic
1149748082 17:59118918-59118940 CACGAGCATGGGAAGGAGGAAGG - Intronic
1149833573 17:59892740-59892762 CATGCGCATGGTGAGTAGGTTGG - Exonic
1150023933 17:61651943-61651965 CAGGGGAATGATGAGAATGATGG + Intergenic
1150293063 17:63992972-63992994 CAGGGGCAGAGTCAGGAGGGAGG + Intergenic
1150317597 17:64182624-64182646 CAGGGGGATGGGGAGGAGTTGGG - Intronic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1151522429 17:74640017-74640039 CATGGGCGTGGTGAGGTGGGGGG - Intergenic
1151756956 17:76080502-76080524 CAGGGGCAGGGTGCGGGGCAAGG + Intronic
1151954290 17:77373008-77373030 CCGGGCCATGGCGAGGAGGGCGG - Intronic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152059775 17:78063375-78063397 GAGGAGCAGGCTGAGGAGGAAGG + Intronic
1152234840 17:79133154-79133176 CAGGAGCAGGGTGGGGAGCAAGG + Intronic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1152342134 17:79731153-79731175 CAGAGCCACAGTGAGGAGGACGG - Exonic
1152345914 17:79751595-79751617 CAGGGGCTGGGGGAGGAGGGTGG + Intergenic
1152470435 17:80488017-80488039 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470465 17:80488126-80488148 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470483 17:80488198-80488220 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470502 17:80488270-80488292 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470557 17:80488486-80488508 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470576 17:80488558-80488580 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470606 17:80488667-80488689 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470624 17:80488739-80488761 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470643 17:80488811-80488833 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470707 17:80489028-80489050 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152470726 17:80489100-80489122 GAGGGACATGGTGGAGAGGATGG + Intergenic
1152497486 17:80683950-80683972 GAGCGGCATGTTGAGGATGAGGG - Intronic
1152572982 17:81128598-81128620 CAGGGGCCGGGTGAGGAAGCTGG - Intronic
1152586426 17:81191450-81191472 CAGGGGTCTGGAGAGGGGGAAGG - Intronic
1152659502 17:81535756-81535778 GAGGGGGATGGGGATGAGGATGG - Intronic
1152678398 17:81653297-81653319 CAGGTTCATGGTGAGGCTGACGG + Exonic
1152691494 17:81720186-81720208 CAGGGGCCTGCTGCGGAGGACGG - Exonic
1152696569 17:81800615-81800637 CAAGGGGCTGATGAGGAGGAGGG - Intergenic
1152715991 17:81901030-81901052 CATGTGCAAGGTGAGGAGCAAGG + Intronic
1152763025 17:82119462-82119484 CAGGGGCATGGTCTGCAGGTGGG - Intronic
1152948458 17:83211604-83211626 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1152948491 17:83211713-83211735 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1152948493 17:83211725-83211747 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153534504 18:6086575-6086597 CAGGGGCATGGAGAGGATCTGGG - Intronic
1153574643 18:6508399-6508421 CAGGGGCAGGGTGCTGAGGCAGG - Intergenic
1153820468 18:8827250-8827272 CATGGGCAGGGAGAGGAGGAAGG + Intronic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1155068223 18:22287317-22287339 CAGGGGCAGGGAGAGGAAGGTGG - Intergenic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1156462099 18:37326822-37326844 CAGAGGGATGGGGAGGGGGAAGG - Intronic
1156497527 18:37535964-37535986 CAGGGGCGTGGGGAGGGAGATGG - Intronic
1156521362 18:37724688-37724710 CAGGGTCCTGGTGAGGAGCAGGG - Intergenic
1156858608 18:41811945-41811967 CAGGGGGATGTTGAGAAGGGTGG + Intergenic
1157192051 18:45589828-45589850 CTGGGGCAGGGAGGGGAGGAGGG + Intronic
1157199946 18:45651600-45651622 CAGGAGCAGGGTGTGGAGGCCGG + Intronic
1157273015 18:46290981-46291003 CCTGGGCGTGGTGTGGAGGAAGG - Intergenic
1157706673 18:49813434-49813456 GAGGGGCGAGGAGAGGAGGAGGG + Intronic
1158252115 18:55500336-55500358 CAGGGGAAAGGAGTGGAGGAGGG + Intronic
1159009274 18:63042928-63042950 TGGGAGCATGGGGAGGAGGATGG + Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160297501 18:77651246-77651268 GAGGAGCATGGTGACGAGCATGG + Intergenic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160786122 19:900859-900881 CAGGAGCAAGGCGCGGAGGAGGG - Exonic
1160819764 19:1052490-1052512 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
1160819783 19:1052533-1052555 GAGGGGAAGGGAGAGGAGGAGGG + Intronic
1160900244 19:1424338-1424360 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
1160929145 19:1561484-1561506 GAGGGGTCTGGTGGGGAGGAGGG + Intronic
1160965748 19:1746234-1746256 AAGAGGGAGGGTGAGGAGGAGGG + Intergenic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161479889 19:4505230-4505252 CAAGGCCATGGTGAGGAGCTGGG - Intronic
1161536886 19:4824968-4824990 AAGGGTGGTGGTGAGGAGGAGGG + Intronic
1161852562 19:6745181-6745203 CGGGGGCAGGGTGGGGAGGTGGG + Intronic
1161866654 19:6837290-6837312 CATGGGTATGGTAGGGAGGAAGG + Intronic
1161958585 19:7509839-7509861 CCAGGGCATGGTGAGGAGAAAGG + Intronic
1162038146 19:7953485-7953507 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162359784 19:10211963-10211985 CAAAGGCATGGTCAGGCGGATGG + Intronic
1162443415 19:10707450-10707472 CAGGGGCCTGGTGAGGGGGTAGG - Intronic
1162740836 19:12772711-12772733 CAGGGGTGAGGTGGGGAGGAAGG + Intronic
1162974224 19:14199071-14199093 CAGGGGCATGGTGCCTAGCAGGG + Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1163165950 19:15498384-15498406 CAGGGGCTTGGCGGGGAGTAGGG - Intronic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1163630656 19:18416628-18416650 CCGGGGCAGGGTGAAGAAGAGGG - Intergenic
1163752037 19:19083882-19083904 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1163752074 19:19084002-19084024 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1163815623 19:19462944-19462966 CAGGGGCAGAGTGGGGAGCATGG + Intronic
1163827843 19:19533547-19533569 CAGGAGGAGGGGGAGGAGGAGGG - Intronic
1164210531 19:23093800-23093822 CAGGGGCATGGTGGGAAGGAAGG + Intronic
1164477748 19:28588206-28588228 CAGGGGCAGGGAGAGCTGGAAGG - Intergenic
1164591931 19:29512145-29512167 AAGAGGGAGGGTGAGGAGGAAGG + Intergenic
1164601001 19:29563105-29563127 CAGGGGCATGGAGGGGATGCCGG + Intronic
1164868744 19:31626014-31626036 GAGGGGGAGGATGAGGAGGAAGG - Intergenic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165081628 19:33310265-33310287 GATGTGCATGGTGAGGTGGAGGG - Intergenic
1165113263 19:33514157-33514179 CAGGGGCAGGGTGTGCAGGAGGG + Intronic
1165149688 19:33753518-33753540 CAGGTGGATGGTGAGGAGATGGG - Intronic
1165149771 19:33753730-33753752 CAGGTGGATGGTGAGGAGACGGG - Intronic
1165160229 19:33811609-33811631 CAGGGGCAGAGTGAGCTGGAGGG + Intronic
1165763521 19:38336317-38336339 AAGGGGCAGGGCGAGGAGGAGGG + Intronic
1165792930 19:38502798-38502820 CAGGGGCAGGGGGAGGAGCAGGG + Intronic
1165796594 19:38523511-38523533 GAGGGAGATGGAGAGGAGGAGGG - Intronic
1165939870 19:39409720-39409742 GAGGGGCCGGGTGGGGAGGACGG + Intergenic
1165988776 19:39793465-39793487 CAGGGGCCTGGGGAGGCAGAGGG + Intergenic
1165992600 19:39825280-39825302 CAGAGGCATGGTGGGGAAGGGGG - Intergenic
1166141726 19:40808766-40808788 CAGGTGCAGGCAGAGGAGGAAGG - Intronic
1166566804 19:43770424-43770446 CAGGAGCATTGGGAGAAGGAAGG - Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166860030 19:45804730-45804752 GAGGCGCACGGCGAGGAGGAGGG - Exonic
1167253807 19:48415507-48415529 CAGGGGCGGGGTTTGGAGGAGGG + Intronic
1167382409 19:49146252-49146274 CAGGGGCAGGGCTCGGAGGAGGG - Intronic
1167404245 19:49293789-49293811 CAGGGTCATTGTTAGGAGTAGGG + Intronic
1167461363 19:49626142-49626164 CAGGGGCTTGGGGAGGTGGAGGG + Exonic
1167576263 19:50319391-50319413 TAGGGGCTTGGGGAGGAGGCAGG - Intronic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167909336 19:52689502-52689524 CAGGGTGAGGGAGAGGAGGAGGG - Intronic
1167991819 19:53366666-53366688 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1167999469 19:53432912-53432934 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168003841 19:53469673-53469695 CAGGGTGAGGGAGAGGAGGAGGG + Intronic
1168246485 19:55115235-55115257 CAGGGCTGTGGTGAGGAGGGGGG - Intronic
1168301794 19:55408888-55408910 GAGGGGCTTAGAGAGGAGGAGGG + Intergenic
924989096 2:295866-295888 CTGGGGCATGGAGATGAGGATGG + Intergenic
925034292 2:673896-673918 CAGGGGGAAGGTGGGGAGGGTGG + Intronic
925364531 2:3302904-3302926 CAGGGCCAAGGTCAGCAGGAGGG + Intronic
925447998 2:3944170-3944192 CAGGGACGAGGGGAGGAGGAAGG - Intergenic
925593734 2:5535088-5535110 GAGGGGGAAGGTGGGGAGGAGGG + Intergenic
925831646 2:7902253-7902275 CAGGGCCATGGTTATGAAGATGG + Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926889434 2:17626556-17626578 CAGGGGCAGGGTGGGTGGGAAGG - Intronic
927217484 2:20676172-20676194 CATGGGCATGGTGGTGAGGAGGG - Intergenic
927651061 2:24914053-24914075 CCTGGGCTGGGTGAGGAGGAAGG - Intronic
927716477 2:25356312-25356334 CCGGGGCATGCTCAGGAGGCAGG + Intergenic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928399777 2:30969408-30969430 CAGGGGCAAGTTGGGGAGGGAGG + Intronic
928613123 2:33010107-33010129 GGGGGACATGGGGAGGAGGAGGG + Intronic
928706249 2:33952765-33952787 CGGGGGCAGGGTGTGGAGGGTGG + Intergenic
929083254 2:38142422-38142444 CAGGGGCAGGGTGTGGTGGGGGG - Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
930485186 2:52002472-52002494 CAAGGTGATGGTGAGGAGGTGGG - Intergenic
931999430 2:67870781-67870803 CAGAGGAATGGTGATGAGGATGG - Intergenic
932115455 2:69042732-69042754 CAGGTGAAGGGTGGGGAGGAGGG - Intronic
932671105 2:73738530-73738552 CAGGGGCAGGGGGAAGAGGTGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
934871404 2:97869702-97869724 ACGGAGGATGGTGAGGAGGAAGG - Intronic
935308412 2:101759666-101759688 GAGGGGAATGGGGAGGGGGAGGG - Intronic
935366166 2:102293115-102293137 CAGGTGGAGGGTGGGGAGGAGGG + Intergenic
935606599 2:104977735-104977757 CTGACACATGGTGAGGAGGAAGG + Intergenic
936315724 2:111422708-111422730 CAGGGGGATGGAGCGGGGGATGG - Intergenic
936998566 2:118440358-118440380 GAGGTGAATGGTGAGAAGGACGG - Intergenic
937147946 2:119663445-119663467 GGGGCTCATGGTGAGGAGGAAGG - Intergenic
937573354 2:123390973-123390995 AAGGAGAATGGGGAGGAGGAAGG - Intergenic
937760334 2:125593154-125593176 CAGGGGCCCTGTGAGAAGGAGGG + Intergenic
937826014 2:126369229-126369251 TAAGGGCATGGGGAAGAGGAGGG + Intergenic
937912029 2:127080419-127080441 CAGGAGTTGGGTGAGGAGGAGGG + Intronic
937953750 2:127408005-127408027 GAGGGGCAGGGGGAAGAGGAGGG - Intergenic
938163622 2:129008181-129008203 CAGGAGCATGGTGGGGCTGATGG - Intergenic
938800540 2:134759546-134759568 AAGGGGGAGGGGGAGGAGGAAGG + Intergenic
938811032 2:134852820-134852842 TAGGGGGATGGGGAGGAGAATGG + Intronic
939341750 2:140905220-140905242 CAGGGGCTTGGGGAGGGGGGCGG - Intronic
939490846 2:142874431-142874453 CAGGGATATGGTGAGGGGAAAGG + Intergenic
940044354 2:149393057-149393079 CAGGTGCATGGTGAAGTGTATGG + Intronic
942515533 2:176748525-176748547 CAAAGGCATGGGAAGGAGGATGG + Intergenic
942655874 2:178213491-178213513 AAAGGGCAGGGTGATGAGGATGG - Intronic
942744823 2:179220183-179220205 AAGGGACAGAGTGAGGAGGATGG - Intronic
943783147 2:191846816-191846838 CTGGGGCTTGGTGTGGAGGAAGG + Exonic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945569095 2:211441712-211441734 CACTGACATGGTAAGGAGGATGG - Intronic
945923243 2:215777772-215777794 TAGGGGTAGGGTGAGGATGAAGG + Intergenic
946138243 2:217665842-217665864 CAGGAACATGGAGAGGAAGAAGG + Intronic
946371854 2:219285925-219285947 CAGCGGCAAGCTGTGGAGGATGG - Exonic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
946888362 2:224247158-224247180 CAAAGGCATGGGGAGGAAGATGG - Intergenic
947550442 2:231041668-231041690 CAGGAGCATGGTGGGGTGCATGG + Intronic
947817734 2:233049161-233049183 GAGGGGCATGGGGAGGACAAAGG + Intergenic
948241499 2:236440704-236440726 CAAGGGCCTGCTGAGGAGGTGGG + Intronic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948667564 2:239545995-239546017 CAGGGGCATGGCGCTGGGGAGGG - Intergenic
948803576 2:240443535-240443557 CAGGGCTGTGGTGGGGAGGAGGG + Intronic
948824059 2:240565950-240565972 CAGTGGCTTGGAGAGGAGGGAGG + Intronic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
948887656 2:240892189-240892211 CAGGGCCATCGTCAGGAGGTAGG - Intronic
1168810502 20:701607-701629 CAGCTGTAGGGTGAGGAGGATGG - Intergenic
1169592121 20:7156223-7156245 TAGGTGCAGGGTGAGGAGGCAGG + Intergenic
1170518875 20:17162333-17162355 GAGAGGCCTGGTGTGGAGGAAGG + Intergenic
1171262720 20:23747973-23747995 CAGAGCCTGGGTGAGGAGGATGG + Intronic
1171373165 20:24674603-24674625 GAGGGGCATGGTGCGGAGGGAGG + Intergenic
1171893636 20:30740803-30740825 GGGGGGCAAGGTGAGGAGGGGGG + Intergenic
1172181160 20:33004380-33004402 CTGGGAGCTGGTGAGGAGGAAGG + Exonic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172292109 20:33784056-33784078 GAGGGAGATGGGGAGGAGGAGGG - Intronic
1172292123 20:33784092-33784114 GAGGGAGATGGGGAGGAGGAAGG - Intronic
1172834013 20:37861226-37861248 CATGGGGTGGGTGAGGAGGAGGG - Intronic
1173002086 20:39111749-39111771 GAGGGGCAGGGGGAGGAAGAGGG + Intergenic
1173123368 20:40314604-40314626 CAGGGGCTTGGTGATGGAGATGG - Intergenic
1173314002 20:41927329-41927351 CAGAGGGATAGTGAGAAGGAAGG - Intergenic
1173320910 20:41986125-41986147 CAGGTCCAGGGTGAGGATGAAGG - Intergenic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1173729819 20:45320267-45320289 CGGGGGGATGCTGAGGAGGGAGG + Intergenic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1173798424 20:45878909-45878931 CAGGGGCTGGGGGAGGAAGAGGG - Exonic
1174163471 20:48568100-48568122 CAAGGCCATGGTGAGGAGCTTGG + Intergenic
1174338693 20:49882838-49882860 CAGAGACATGGTGAGGACAAGGG - Intronic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174832220 20:53823394-53823416 AAGGGCCATGGGGAGGAGGCTGG + Intergenic
1174838731 20:53881573-53881595 CAGGGGCCTAGTCAGGAGGCTGG - Intergenic
1174963387 20:55183730-55183752 CAGGTGCATGGGGAAGGGGATGG + Intergenic
1175657831 20:60787111-60787133 GAGGGGGATGAAGAGGAGGAGGG - Intergenic
1176409119 21:6438232-6438254 CAGGGGCCTGCTGAGGACGGAGG - Intergenic
1178410315 21:32358334-32358356 CTGGTGGATGGTGAGCAGGAGGG + Intronic
1178617674 21:34147577-34147599 CAGTGTGATGGTGAGAAGGATGG + Intergenic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179253867 21:39698297-39698319 CAGGGACGAGGTGGGGAGGAGGG + Intergenic
1179484927 21:41704107-41704129 CGGGGGCATGGTGGGGTGGGGGG - Intergenic
1179628380 21:42661388-42661410 CAGGGGCTGGGGGAGGGGGATGG - Intronic
1179684612 21:43046554-43046576 CAGGGGCCTGCTGAGGACGGAGG - Intergenic
1179900445 21:44390635-44390657 CCAGGGCATGGCCAGGAGGAGGG + Intronic
1179968142 21:44818409-44818431 CAGGGACCTGGGGCGGAGGAGGG + Intronic
1180082634 21:45493761-45493783 GAGGGGCAGGGAGAGGACGAGGG - Intronic
1180082640 21:45493779-45493801 CAGGGGTAGGGAGAGGACGAGGG - Intronic
1180129266 21:45816482-45816504 GAGGGGGAAGGGGAGGAGGAGGG - Intronic
1180184856 21:46134455-46134477 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1180733942 22:18001720-18001742 CAGGGGGACGGAGAGGACGAAGG - Intronic
1180765035 22:18341277-18341299 CTCGGGCATGGTGAGATGGATGG + Intergenic
1180813994 22:18778407-18778429 CTCGGGCATGGTGAGATGGATGG - Intergenic
1180855891 22:19044532-19044554 CAGAGGCATGGTGAGGTGTTTGG - Intronic
1180938290 22:19640292-19640314 CAGGGGCAAGGGGAGGAGAATGG - Intergenic
1181200179 22:21212742-21212764 CTCGGGCATGGTGAGATGGATGG - Intronic
1181508999 22:23380545-23380567 GAGGGGCAGGGGCAGGAGGAGGG - Intergenic
1181701558 22:24624217-24624239 CTCGGGCATGGTGAGATGGATGG + Intronic
1181780470 22:25189263-25189285 CAGGAGAATGGTGTGGAGGCAGG - Intronic
1182026156 22:27120894-27120916 CTGGGGCCTGGGGAGCAGGAGGG - Intergenic
1182110344 22:27718632-27718654 CAGGTGCAAAGTGTGGAGGAGGG - Intergenic
1182329834 22:29543373-29543395 GAAGGGGATGGGGAGGAGGAAGG + Intronic
1182737924 22:32544350-32544372 CAGGAACATGTTGAGGAGAATGG - Intronic
1183080545 22:35453043-35453065 CAGGGGCAGGGGGAGGGTGACGG + Intergenic
1183231273 22:36583683-36583705 CATGGTGATGGTGAGAAGGAAGG - Intronic
1183349207 22:37325213-37325235 CAGAGGCAAGGAGGGGAGGAGGG + Intergenic
1183375013 22:37458252-37458274 CAGGGGGCTGGGGAGGAAGATGG + Intergenic
1183683939 22:39350851-39350873 CAGGTGCATGCTGAGTGGGAGGG - Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184404810 22:44293743-44293765 CAGCGGCATGATGAGGTTGAGGG + Intronic
1184405988 22:44301096-44301118 CAGGGGCCGGGTGCGGACGATGG + Intronic
1184428275 22:44425760-44425782 GAAGGGAATGGTGAGGAGGAAGG + Intergenic
1184503211 22:44886147-44886169 CAGGGCCCTGGTGATGAGCAGGG - Intronic
1184519690 22:44985978-44986000 CATGGTGATGGTGATGAGGATGG - Intronic
1184561823 22:45268281-45268303 AAGGGGCAGGGGGTGGAGGATGG - Intergenic
1184592789 22:45496334-45496356 CAGGGACTTGGTCAGGATGATGG + Intergenic
1184939144 22:47748169-47748191 AAGGGGCAGAGGGAGGAGGATGG + Intergenic
1185056948 22:48586106-48586128 CAGAGGCTTCCTGAGGAGGAAGG + Intronic
1185060721 22:48605254-48605276 GAGGGTGATGGTGAGGATGATGG + Intronic
1185065005 22:48627784-48627806 CAGGGCCATGGCCAGGACGAGGG + Intronic
1185243952 22:49763403-49763425 CAGGGGCTGGGGGAAGAGGAAGG + Intergenic
1185280254 22:49966832-49966854 CAGGGCCCTGGCCAGGAGGAGGG + Intergenic
1185280692 22:49968680-49968702 CAGGGACCTGGCCAGGAGGATGG - Intergenic
1185419895 22:50729343-50729365 CAGGGGCAGGGAGAGGGGGTGGG + Intergenic
1203264093 22_KI270734v1_random:4094-4116 CTCGGGCATGGTGAGATGGATGG - Intergenic
949719110 3:6967882-6967904 CTGGGGTGTGGAGAGGAGGAGGG + Intronic
950120987 3:10482507-10482529 CAGGCTGATGGTGAGGAGAAGGG + Intronic
950492600 3:13315009-13315031 CAGGGGCATGAGGAGGGTGAGGG + Intergenic
952450026 3:33422742-33422764 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
952702633 3:36342526-36342548 CAGGGGGAAGGTGAGGGAGAAGG + Intergenic
953300916 3:41775060-41775082 CAGGGACGTTGTGAGGTGGAGGG + Intronic
953493766 3:43369673-43369695 CAGGGCCATGGTATGGAGGGGGG + Intronic
953793475 3:45965914-45965936 CGGGGGCAAGGTGAGGACGCAGG + Intronic
953856142 3:46500440-46500462 CAGGGGCCAGGTGAAGATGAGGG + Exonic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
953978683 3:47402067-47402089 CAGGTGCACAGTGAGGGGGATGG - Intronic
954094961 3:48318932-48318954 AAGGGGAATAGTGAGGAGCAGGG - Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954688945 3:52385646-52385668 CAGGGGGTCGGTGAGGAGCAAGG + Intronic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
955031268 3:55222341-55222363 CAGAGGCCTGGTGAGGAGCCAGG - Intergenic
955537751 3:59942330-59942352 CAGGAGTGTGGGGAGGAGGAAGG - Intronic
956145058 3:66183824-66183846 CAGGGTGAGGGTGAGGATGAAGG - Intronic
956145314 3:66185994-66186016 CAGGGTCATGGTGAGGGTCAGGG - Intronic
956380593 3:68660708-68660730 CATGGGCCTGGGTAGGAGGATGG + Intergenic
956749154 3:72332543-72332565 CTGGGTCATTGTGAGTAGGAAGG - Intergenic
958145796 3:89622910-89622932 CAGGGGGATGGTGGGGGGGTGGG + Intergenic
958822285 3:98989173-98989195 CAGTGGCAGGGTCAGGAGGGAGG - Intergenic
958860482 3:99439201-99439223 CAGGGGCATGGTGATTAGAAGGG + Intergenic
958957905 3:100481035-100481057 CAGGAGCTTGGTGAGGTGGTGGG - Intergenic
958983565 3:100753903-100753925 CAGTGGCATGGTGAAGATGATGG + Intronic
959737166 3:109672771-109672793 GAGGGGCATGGAAAGGAGGGGGG - Intergenic
960519231 3:118636396-118636418 CAGGGACAAGGTGAGTGGGAAGG - Intergenic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961644774 3:128387044-128387066 CAGGGCCCAGGTGAGGAGGATGG + Intronic
961812884 3:129531933-129531955 CAGAGGGTTGGTGAGGAGGTGGG - Intronic
962845195 3:139267693-139267715 AAGGGGCATAGTGAGGAGAGTGG + Intronic
964139325 3:153378959-153378981 AAGAGCCATGGTGGGGAGGAGGG + Intergenic
964541313 3:157782725-157782747 GATGGGCATGTTGAGGAGTAAGG - Intergenic
965972234 3:174573675-174573697 AGGGGGCAAGGTGAGGGGGAGGG + Intronic
966092886 3:176161099-176161121 CAGGCACATAGTCAGGAGGAAGG + Intergenic
966350807 3:179031959-179031981 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350823 3:179031989-179032011 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966350833 3:179032007-179032029 GAGGGGGAGGGGGAGGAGGAGGG - Intronic
966555185 3:181251167-181251189 CAGAGGAATGGTGAGAATGAGGG - Intergenic
967040371 3:185686401-185686423 GAGGGGGGTAGTGAGGAGGAAGG + Intronic
967049447 3:185769205-185769227 CATGGGGAGGCTGAGGAGGATGG + Intronic
967213705 3:187192109-187192131 CAGAGGCATTGTGGAGAGGAAGG + Intergenic
967781461 3:193444905-193444927 CAGGGGCCTGCTGTGGAGCATGG - Intronic
967991133 3:195131681-195131703 CAGGGCCAGGGTGATGAGGCAGG + Intronic
968657671 4:1785655-1785677 CAGGGGCACAGTGAAGGGGATGG - Intergenic
968689686 4:1984125-1984147 CCGGGGCCTGGTGAGGGGGCTGG + Intronic
968793817 4:2688540-2688562 CAGGGCTTTGGTGAGCAGGAAGG + Intronic
968816237 4:2823349-2823371 AAGGGGCAAGGTGGGGAGGGAGG - Intronic
968889374 4:3359380-3359402 GAGGGGGAGGGGGAGGAGGAAGG - Intronic
969146704 4:5130382-5130404 CTAGGCCATGGTGAGGAGCATGG + Intronic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
969458969 4:7317571-7317593 CAGGCCCATGGGGAAGAGGAAGG - Intronic
969463461 4:7341080-7341102 GATGTGCATGGTGGGGAGGATGG + Intronic
969713509 4:8857802-8857824 CAAGGGCAAGGGGAGGAGGAGGG - Intronic
969713817 4:8859011-8859033 CAGGAGCAGAGTGGGGAGGAAGG + Intronic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
969853103 4:9977551-9977573 CAGGAGCAGGGGGAGGGGGAGGG - Intronic
971139084 4:23904123-23904145 CAAGGGCATGGTGACGTGGGAGG + Intergenic
972436295 4:39038746-39038768 CAGGAGAATGGTGTGGAGGGAGG - Intergenic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
974017792 4:56664777-56664799 CTGGGGAATGGTGGTGAGGAAGG - Intronic
974897812 4:67960161-67960183 GAGGGGCAAGGTTGGGAGGAGGG + Intronic
976344509 4:83985065-83985087 CTGGGGCCTGGTGAGGTTGAGGG + Intergenic
976402727 4:84625431-84625453 CAGGAGCATGAAGAAGAGGAAGG + Intronic
976426173 4:84905711-84905733 AAGGGCCATGGTAAGGAGTATGG - Intronic
976454811 4:85234031-85234053 CAAGTGGATGGTGTGGAGGAAGG + Intergenic
977106582 4:92893385-92893407 CAGGGGCATGGTGGGGAAATAGG + Intronic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977908423 4:102502119-102502141 CTGGGGGATGGTGAGAAGGTTGG + Intronic
978702322 4:111662613-111662635 GAGGGGGATGGGGAGGGGGAGGG + Intergenic
980507491 4:133741436-133741458 CAGGGTGAAGGTTAGGAGGAGGG - Intergenic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
981354038 4:143766486-143766508 CCGGGGTTTGGTGTGGAGGAGGG - Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982498741 4:156127436-156127458 CTGGGGTATGGGGAGAAGGAGGG + Intergenic
982763918 4:159321586-159321608 CAGAGCCATGGTGAGGAGTAAGG + Intronic
984957543 4:185060401-185060423 AAAGGGAGTGGTGAGGAGGAGGG - Intergenic
985561276 5:587366-587388 TAGGGTTATGGTGAGCAGGAAGG + Intergenic
985692397 5:1320678-1320700 CGTGGGCATGGTGATGATGAAGG + Exonic
985730349 5:1543969-1543991 CGGGGGCTCAGTGAGGAGGAAGG - Intergenic
985780694 5:1869393-1869415 CAGGGGCCTGGGCAGGAGCAGGG + Intergenic
986104342 5:4645411-4645433 CAGAGCCATGCTGAGGAGCAGGG + Intergenic
986183619 5:5416953-5416975 GAGGAGGAGGGTGAGGAGGAGGG + Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
990168766 5:53023659-53023681 CATGGGCATGGTTTGGAGGAAGG + Intronic
990363692 5:55047555-55047577 TGCTGGCATGGTGAGGAGGAGGG + Intergenic
990509919 5:56480971-56480993 CAGGGGCGGGGTGGGGAGGGGGG + Intronic
990524182 5:56608382-56608404 CAGGGGCAGGGAGCGGGGGATGG + Intergenic
991240098 5:64448551-64448573 CAAAGGAATGGGGAGGAGGAAGG - Intergenic
991348359 5:65694106-65694128 TAGGGGCATGGTCAGGAGGTTGG + Intronic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992674125 5:79088651-79088673 GCAGGGCATGGTGAGGATGAAGG - Exonic
994051760 5:95369959-95369981 CAGTGACATGGTGAGGAGTCTGG + Intergenic
995189148 5:109302371-109302393 CAGGGGTATGATGTGGAGGAGGG - Intergenic
997180094 5:131819428-131819450 GAGGGGGAGGGAGAGGAGGAGGG + Intronic
997269648 5:132526072-132526094 GAGGGGCAGGGTGAGAAGGCAGG + Intergenic
997692091 5:135833920-135833942 GAAGGGTATGGTCAGGAGGAAGG - Intergenic
997823851 5:137089106-137089128 CAGGTGCAAGGGGAGGAGGAGGG + Intronic
997872373 5:137516956-137516978 CAGAGGCAAGTTCAGGAGGAGGG + Intronic
997879864 5:137579914-137579936 CTGGGCCATGGTGAAGAGGCTGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998208100 5:140173773-140173795 CAGAGGCATGGTCAGAAGGTTGG - Intergenic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
998543116 5:143002035-143002057 AAGGGGCATTGTGGGGATGAAGG + Intronic
998695931 5:144639591-144639613 TAGGGGCATGGTGGGGTGGGAGG - Intergenic
999198415 5:149798949-149798971 CAGGGGCTGGGTGCTGAGGAAGG + Intronic
999234742 5:150083624-150083646 CAGGGGCATGGTGTGTGGGAGGG - Intronic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
999424105 5:151471978-151472000 AAGGGGCAGGGTGGGGAGGAGGG - Intronic
999871917 5:155761433-155761455 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871922 5:155761457-155761479 GAGGGTGATGGTGAGGATGATGG - Intergenic
999871936 5:155761539-155761561 GAGGGTGATGGTGAGGATGATGG - Intergenic
1000280777 5:159780123-159780145 CTGGGCCATGGAGAGGAGGCAGG - Intergenic
1000903693 5:166937382-166937404 CAGGGGCATGGTGACAAGAGAGG + Intergenic
1001024584 5:168213478-168213500 CAGGGGCTGGGAGAGGTGGAGGG - Intronic
1001597419 5:172907104-172907126 GATGGGAATGGAGAGGAGGAGGG - Intronic
1001835355 5:174826656-174826678 CAGGGCCCGGGTGAGGAGGGAGG + Intergenic
1002059158 5:176616193-176616215 CAGGGGCATGGTAGGGTGCATGG + Intergenic
1002100124 5:176853478-176853500 CAGGGGCCTGGTCACAAGGACGG - Intronic
1002419796 5:179139596-179139618 CACGGGCATGGAGGAGAGGAGGG - Intronic
1002742625 5:181444759-181444781 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1002742658 5:181444868-181444890 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1002742660 5:181444880-181444902 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1003266036 6:4565679-4565701 CAGGGACCAGGTGAGGAGCAAGG + Intergenic
1003553482 6:7119923-7119945 GAGGGGCTTGGCGATGAGGAAGG + Intronic
1003990995 6:11486426-11486448 CAGGGGTATGGTAAGTGGGAAGG + Intergenic
1004292126 6:14377176-14377198 CTGGGGCACGCTGAAGAGGAAGG - Intergenic
1004627447 6:17390200-17390222 CAGGAGCAAGGGGAGGAGGGAGG - Intergenic
1004794341 6:19064418-19064440 AAAGAGCATGGTGTGGAGGATGG - Intergenic
1004814144 6:19294205-19294227 CAGGGGCATACTGAGTGGGAGGG + Intergenic
1005390944 6:25332578-25332600 GAGGGACATGTTGAGGAAGAAGG + Intronic
1005840155 6:29739264-29739286 TAGGGGCTCGGTGAGGGGGATGG + Intergenic
1005912971 6:30326915-30326937 CGGGGGCGAGGGGAGGAGGAAGG + Exonic
1006071985 6:31505132-31505154 CATGGGCATGGTGGGGACAAGGG - Intronic
1006388305 6:33744639-33744661 CAGTGGCTGGGTGAGGAGGTGGG - Intronic
1006458749 6:34145964-34145986 CACGCGCACGGGGAGGAGGAAGG - Intronic
1006840126 6:37023093-37023115 CATGGGCCTGGTGAGGTGGTGGG - Intronic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007294961 6:40814594-40814616 CAGGGGCATGGTGGAAAGGTGGG + Intergenic
1007418392 6:41705393-41705415 CAGCAACCTGGTGAGGAGGATGG - Intronic
1007596070 6:43052184-43052206 GAGGGGCAGTGTGGGGAGGAAGG - Exonic
1007654817 6:43445687-43445709 CAGGAGGATGTTGAGGATGAAGG - Exonic
1008051236 6:46902245-46902267 CTGGGGCCTGGTGGGGAGGAGGG + Intronic
1010776141 6:79888028-79888050 AGGGGGCAGGGAGAGGAGGATGG + Intergenic
1011626797 6:89289689-89289711 AAGGGGAAGGGTGAGGAGGAGGG + Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1013459252 6:110358955-110358977 CAGCGGGTTGGTGAGGAGGGGGG + Intergenic
1014625769 6:123722551-123722573 CAGGGGCCTGGAGAGGAGTAAGG - Intergenic
1014930103 6:127325649-127325671 CAGGGGCTTGGTGGTGGGGATGG - Intronic
1015227589 6:130875461-130875483 CAGGGGCTTGGTGAGCAAGGGGG - Intronic
1015731187 6:136349826-136349848 CAGGAGTAAGGTGAGGAGTAGGG + Intronic
1016472594 6:144390219-144390241 CTGGGACGTGGTGAGGTGGATGG - Intronic
1016984813 6:149887234-149887256 AAGGGGATTGGTGAGTAGGAAGG - Intronic
1017055680 6:150433792-150433814 CAGGGGTATGGTGAGGATAAGGG - Intergenic
1017079977 6:150658749-150658771 TAAGGGCAGGGTGAGGAGCAGGG - Intronic
1017362532 6:153592861-153592883 CAGTGCCATGGTGAAGACGAGGG - Intergenic
1017460552 6:154645878-154645900 AAGGGGCTTGGGGAGAAGGATGG - Intergenic
1017637368 6:156456211-156456233 GAGGGGGATGGGGAGGAGGGGGG - Intergenic
1017637465 6:156456398-156456420 GAGGGGGATGGGGAGGAGGGGGG - Intergenic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1017859472 6:158382061-158382083 CAGGAGTATGGGGAGGAGGTAGG + Intronic
1017861153 6:158398403-158398425 CAGTGGGTGGGTGAGGAGGAGGG - Intronic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1017981514 6:159404474-159404496 CAGAGGCATGGGGTGGAGGTGGG + Intergenic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018441803 6:163820568-163820590 CAGGTGCATGGGGATGAGGGAGG - Intergenic
1018491116 6:164294540-164294562 CACTGGCATGGTGAGGATGGGGG - Intergenic
1018699562 6:166415980-166416002 GAGGAGGATGGTGAGGATGATGG - Intronic
1018853630 6:167659423-167659445 CAGGGCCAAGGAGAGGAGCAAGG - Intergenic
1018903779 6:168063802-168063824 CAGGGGGCTGGCAAGGAGGAAGG - Intronic
1018960953 6:168448303-168448325 CAGGAGGCTGGGGAGGAGGATGG + Intronic
1019030007 6:169001798-169001820 ATGGGGCATGCAGAGGAGGAGGG + Intergenic
1019247760 6:170720498-170720520 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1019247793 6:170720607-170720629 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1019247795 6:170720619-170720641 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1019473717 7:1234015-1234037 CAGGGGCGAGGAGGGGAGGAGGG + Intronic
1019551774 7:1606761-1606783 GAGGGACAGGGAGAGGAGGAAGG - Intergenic
1019554825 7:1624026-1624048 CAGGGACTGAGTGAGGAGGAGGG - Intergenic
1019632605 7:2057940-2057962 AAGGGGCATGGAGAGAAGCAGGG + Intronic
1019746283 7:2701986-2702008 CAGGGGCCGGGTCAGGAGGTGGG + Intronic
1020931910 7:14407893-14407915 TAGGGGCATGGAGAGGATCATGG - Intronic
1021580039 7:22142779-22142801 GATGGGGATGGTGAGAAGGAGGG + Intronic
1022026037 7:26448771-26448793 TAGGGGTGTGGGGAGGAGGAAGG + Intergenic
1022060764 7:26792175-26792197 CAGGGGCTGGGTGTGGAGGCAGG + Intronic
1022375474 7:29807290-29807312 CAGGGGCTTGGAGATGAGCACGG - Intronic
1023042075 7:36180852-36180874 CAGGTGCATGATGAGGGGGTGGG - Intronic
1023803562 7:43855231-43855253 CAGGGTCATGGTGAGGATAAGGG + Intergenic
1023803761 7:43856651-43856673 CAGGGGCATGGTGAGGGTCAGGG + Intergenic
1023990180 7:45124096-45124118 CAGGGGGGTGGTGGGGAGGAGGG + Intergenic
1024505168 7:50156625-50156647 CTGGGATATGGAGAGGAGGAGGG - Intronic
1024626685 7:51213774-51213796 CAGAGCCACAGTGAGGAGGACGG + Intronic
1025108664 7:56194249-56194271 CTGGGGCTTGGTGAGGAGGCAGG + Intergenic
1025943888 7:66092103-66092125 CAGGGGGAGGGTGAGGAGATGGG + Intronic
1026164482 7:67897843-67897865 CAGGGGCTTGTTCAGAAGGATGG + Intergenic
1026371306 7:69702360-69702382 CAGAGGCAGGGTGAGAAGGAAGG + Intronic
1026840732 7:73668731-73668753 CAGGGGCAGGGAGGGGAGGTTGG + Intronic
1027265974 7:76495482-76495504 CAGAAGCCTGGAGAGGAGGAGGG - Intronic
1027317348 7:76993599-76993621 CAGAAGCCTGGAGAGGAGGAGGG - Intergenic
1028475020 7:91244028-91244050 CAGGGTCATGGAAAGGAGAAGGG + Intergenic
1028535461 7:91886856-91886878 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1029156009 7:98518517-98518539 CAGTGGAATGGTGGGGAGGCGGG - Intergenic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1030384077 7:108847445-108847467 GAGGGGAATGGAGGGGAGGAGGG - Intergenic
1031595076 7:123640666-123640688 GAGGGGGAGGGGGAGGAGGAGGG + Intergenic
1031866085 7:127039891-127039913 GAGGGGGAAGGTGAGGGGGAAGG + Intronic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1031990196 7:128192634-128192656 GAGGGGGATGGTGGGGAGGAGGG - Intergenic
1032086019 7:128884388-128884410 CATGGGCCTGGGGAGGAGGATGG - Intronic
1032129309 7:129215722-129215744 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1032509382 7:132459930-132459952 GAGGGGCATGGGGAAGAGAAGGG - Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1032860854 7:135878050-135878072 GATGGGCATGGCGGGGAGGATGG - Intergenic
1033344051 7:140513486-140513508 CAGGAGAATGGTGTGGAGGCAGG + Intergenic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033590164 7:142802202-142802224 GATGGCCATGGTAAGGAGGAGGG + Intergenic
1033722057 7:144071149-144071171 CAGGGGTATTGGGAGGAGGTGGG - Intergenic
1033740891 7:144274972-144274994 AAGTGGCATGGGGAGGAGGGTGG - Intergenic
1033753015 7:144374641-144374663 AAGTGGCATGGGGAGGAGGGTGG + Intronic
1033820707 7:145131124-145131146 GTGGGGGATGGTGAGGAGGGGGG + Intergenic
1034202220 7:149289816-149289838 GAGGGGCATGGAGAGTAGGGTGG - Intronic
1034412172 7:150947399-150947421 GAGGGGGATGTTGAGGAGGCTGG + Exonic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1034498219 7:151434280-151434302 CAGGGGCTTGTTGAGAACGAAGG - Intronic
1034908763 7:154974378-154974400 TAGGGCCATAGTGAGGAGTATGG - Intronic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035500322 8:87245-87267 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
1035500324 8:87257-87279 GAGGGGGATGGAGAGGGGGATGG - Intergenic
1035500376 8:87438-87460 GAGGGGGATGGAGAGGAGAAAGG - Intergenic
1035652672 8:1280674-1280696 CATGGGCATGGAGGGGAGGTAGG + Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036125385 8:6057435-6057457 CAAGGGCATGGTGATGGGGGTGG - Intergenic
1036645340 8:10608870-10608892 CAGGGGCCTGGAGTGGACGAGGG - Exonic
1036680107 8:10865720-10865742 CAGGGCCTTGGTGGGGAGGTAGG + Intergenic
1037809031 8:22075298-22075320 AAGGGGGAGGGGGAGGAGGAGGG - Intronic
1037903693 8:22703148-22703170 CGGGGGCAGGGTGCGGAGGGTGG + Intergenic
1038253554 8:25928803-25928825 CAGGGAAATGGAGAGGAGAAAGG + Intronic
1038395506 8:27242948-27242970 CAGAGGGATGGTGGTGAGGACGG - Intronic
1038700596 8:29846215-29846237 AAGGGACTTGGTGAGGAGGAGGG - Intergenic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039433648 8:37545131-37545153 AAGGGGAAGGGTGGGGAGGAAGG + Intergenic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1039564675 8:38542512-38542534 GAGGGGAATGGAGAGGGGGAGGG - Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039920902 8:41893931-41893953 AAGGGGCCTGGTGAGGCAGAGGG - Intronic
1039968162 8:42298927-42298949 CAGGGGCAGGGAGGGAAGGACGG - Intronic
1040042882 8:42934547-42934569 CTGGGGCCTGGTGCGGGGGAGGG - Intronic
1040103549 8:43525738-43525760 GAGGAGCATTGTGAGGAGTATGG + Intergenic
1040341867 8:46445135-46445157 CAGGGGGATGTTGAGGCAGAAGG - Intergenic
1040484241 8:47855009-47855031 CAGAGGCAAGCTGAGGCGGAGGG + Intronic
1041614796 8:59893751-59893773 GCAGGGCATGGTGAGGATGAAGG + Intergenic
1042467557 8:69145138-69145160 CAGGGGCATAGTGATAAAGAAGG + Intergenic
1043467669 8:80528488-80528510 CAGGGACAAGGTGCGGGGGAAGG - Intergenic
1044020770 8:87103208-87103230 AAGAGGTATGGTGAGTAGGATGG + Intronic
1044058730 8:87605714-87605736 CAGGGGGAAGGTGGGGGGGAGGG + Intronic
1044626356 8:94237808-94237830 CAGGGTCATGGTGGGTGGGAGGG - Intergenic
1044799653 8:95941012-95941034 GGGGGGCATGGAGAGGAAGAAGG - Intergenic
1045245739 8:100440358-100440380 CAAGGGCAGGTTGAGAAGGATGG + Intergenic
1046129883 8:109954228-109954250 CAGTGGCAGGGTGAGGTGGGGGG + Intergenic
1046915297 8:119672831-119672853 CAGGGGCTTGGCAAGAAGGACGG - Intronic
1047204292 8:122791040-122791062 CAGGTGCATGGAGGGCAGGAGGG - Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047750327 8:127875762-127875784 CAAGGGAAGGGTGGGGAGGAAGG + Intergenic
1048329615 8:133463005-133463027 CAGGGGCCTGCTGGGGAAGATGG + Intronic
1048345648 8:133572454-133572476 CGGGGGCACGGTGGGGAGAAGGG + Intergenic
1048496304 8:134939014-134939036 ATGGGGCATGGAGAGGATGAGGG - Intergenic
1048548790 8:135414339-135414361 GAAAGGCATGGGGAGGAGGAAGG + Intergenic
1048906651 8:139095622-139095644 ACGGGGCATGGAGAGGAGGGAGG + Intergenic
1048950148 8:139489889-139489911 CAGGGGCTTTGTCAGGGGGAAGG - Intergenic
1048992945 8:139772019-139772041 CTGCGGCCTGGTGTGGAGGATGG + Intronic
1049431511 8:142567434-142567456 GAGGGGCATGGTGATGGGGAGGG - Intergenic
1049562225 8:143317541-143317563 CAGAGTCCTGGGGAGGAGGAGGG - Intronic
1049576260 8:143391319-143391341 AGGGGGCAGGGTGAGGTGGAGGG - Intergenic
1049684935 8:143935562-143935584 GAGGGGCCTGGTGGGGAGGGTGG - Intronic
1049778284 8:144416229-144416251 CAGGGGCCTGGGGAGACGGAAGG - Intronic
1050287445 9:4118082-4118104 CATGGGCATGGTAAGGGGGTGGG + Exonic
1050743506 9:8849746-8849768 CAGGGCTATGGTGAGGGAGAAGG + Intronic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051708843 9:19909319-19909341 CAGGGGCCTGTTGTGGGGGACGG + Intergenic
1052816424 9:33105626-33105648 CAGGGGCATGGGGAAGGGAAGGG - Intronic
1052918114 9:33939755-33939777 GAGGGGGAGGGGGAGGAGGAAGG + Intronic
1053154891 9:35770591-35770613 CAGGGGCAGGTAGAGAAGGAAGG + Intergenic
1054159400 9:61663479-61663501 CAGGGGCAGGGCGAGGAGCATGG + Intergenic
1054479172 9:65594484-65594506 CAGGGGCAGGGCGAGGAGCATGG + Intergenic
1054663186 9:67716127-67716149 CAGGGACAGGGTGAGGAGCGTGG + Intergenic
1054823646 9:69548810-69548832 AAGGGGCTTTGTGGGGAGGAGGG - Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1054947364 9:70810192-70810214 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947398 9:70810326-70810348 CAGGGTGATGGAGAGGAGGGTGG - Intronic
1054947414 9:70810393-70810415 CAGGGCGATGGAGAGGAGGGTGG - Intronic
1055780908 9:79820592-79820614 CAGGTGTTTGGTGAAGAGGAGGG - Intergenic
1056287194 9:85101448-85101470 TAGGGTCATGGGTAGGAGGAAGG - Intergenic
1056293448 9:85167481-85167503 CAGGTGCTGGGGGAGGAGGAAGG + Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1056765581 9:89442793-89442815 CTGGGAAATGGTGAGAAGGATGG - Intronic
1057278093 9:93686881-93686903 CAGGGGCATGGTCAGGTAGCAGG + Intergenic
1057281329 9:93713751-93713773 CAGGGACAGGGTGAGAAGGAAGG - Intergenic
1057387136 9:94614183-94614205 GAGGAGCAGGGGGAGGAGGAGGG + Intronic
1057454923 9:95199370-95199392 AGGAGGCATGGTGAGTAGGAGGG - Intronic
1057664349 9:97032925-97032947 CTGATGGATGGTGAGGAGGAAGG - Exonic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1058049444 9:100392189-100392211 AAGGGGGATGGGGAGGGGGAGGG - Intergenic
1058139542 9:101342591-101342613 GAGGGGCAGGGGGAGGGGGAGGG + Intergenic
1058707214 9:107647512-107647534 CAAGGGCATGGCTAGGAGGAGGG + Intergenic
1059343508 9:113612933-113612955 AAGGGGCTTTGTGAGGAAGAGGG + Intergenic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059761320 9:117340360-117340382 AAGTGTCATGGAGAGGAGGAGGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1060034636 9:120244230-120244252 AAGGTGCATGGTGAGGTGCAGGG - Intergenic
1060105108 9:120868758-120868780 GAGGGGCGGGGTGGGGAGGAGGG - Intronic
1060171332 9:121463781-121463803 CAGGTGCCTGGTGATGACGAAGG + Intergenic
1060338386 9:122749936-122749958 CAGGTACATGATGAGGAAGATGG - Exonic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1060819100 9:126651367-126651389 CAGCTGCCTGCTGAGGAGGATGG - Intronic
1060952578 9:127613044-127613066 CAGGAGGGTGGGGAGGAGGAGGG - Intronic
1061043120 9:128151004-128151026 CAGGCGCAGGGTGAAGAGGCAGG + Intronic
1061429507 9:130522457-130522479 CAGGGTCAGGGTGTGGGGGAGGG - Intergenic
1061492957 9:130956370-130956392 CAGGGGTGAGGCGAGGAGGAAGG + Intergenic
1061569453 9:131467815-131467837 GTGGGGCATGGGGACGAGGAGGG - Intronic
1061988109 9:134142162-134142184 CAGGGGCATGGGGCGGGGGTGGG + Intronic
1062080791 9:134622417-134622439 GAGGAGGATGGAGAGGAGGAAGG - Intergenic
1062282189 9:135757072-135757094 GAGGGGCAGGGTGGGGAAGAGGG - Intronic
1062338362 9:136082391-136082413 CACAGGCATGGTGGGGAGGCAGG - Intronic
1062469737 9:136697070-136697092 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1062562070 9:137146178-137146200 GAGGGGCATGGGCAGGAGGAGGG - Intronic
1203608531 Un_KI270748v1:75978-76000 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1203608565 Un_KI270748v1:76087-76109 GAGGGGGATGGAGAGGGGGATGG + Intergenic
1203608567 Un_KI270748v1:76099-76121 GAGGGGGATGGAGAGGAGAAAGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1186193896 X:7093159-7093181 CAGGGGCTGGGGGAGGGGGATGG - Intronic
1186971825 X:14854344-14854366 AAGGGGCATGTTAAGGAGGAAGG - Intronic
1187575771 X:20553079-20553101 CAGGGGCTGGGTGTGGGGGAAGG - Intergenic
1187700856 X:21963259-21963281 CAGGAGGAAGGTGAGGATGAAGG + Intronic
1187768431 X:22668828-22668850 CAGGGACATGGTGAGGATTCTGG - Intergenic
1189187531 X:39066952-39066974 CAGAGGCATGGAGAGGAGAAAGG + Intergenic
1189272457 X:39760897-39760919 CAGGGGGTTGGTGAGGGGTATGG - Intergenic
1189373070 X:40445407-40445429 CTAGGGCATGGTGGGGAGGCTGG - Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1189847596 X:45151116-45151138 CAGGGCCATAGGGAGCAGGAAGG + Exonic
1190252436 X:48737388-48737410 CGGGGGTGGGGTGAGGAGGAAGG - Intergenic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1190793442 X:53721108-53721130 GAGGGGGATGGGGAGGGGGAGGG - Intergenic
1190881344 X:54494969-54494991 AAGGGACGTGGGGAGGAGGAGGG + Intronic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255784 X:58279016-58279038 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256187 X:58280654-58280676 CAGGGGGAGGTTGAGGAGGTGGG - Intergenic
1191256396 X:58281419-58281441 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256448 X:58281602-58281624 CAGGGGCAGGTTGAGGAGACTGG - Intergenic
1192260632 X:69504337-69504359 AAGAGGCACGGAGAGGAGGAGGG - Intergenic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192671187 X:73143724-73143746 GACGGGGATGGTGATGAGGAAGG - Intergenic
1193054923 X:77139718-77139740 CTGTGGCATGGGGAGGAGAATGG - Intergenic
1193583669 X:83294607-83294629 CATGGGCATGGTGAGTAGTAGGG - Intergenic
1194002363 X:88446271-88446293 CAGGGGCTTGGGGTGGGGGATGG + Intergenic
1195067413 X:101250354-101250376 CCGGAGAATGGTGAGGAGAAAGG - Intronic
1195119717 X:101738364-101738386 GAGGGGGAGGGGGAGGAGGAGGG - Intergenic
1195169659 X:102253922-102253944 CAGGGTCGGGGTGGGGAGGAGGG - Intergenic
1195189198 X:102433177-102433199 CAGGGTCGGGGTGGGGAGGAGGG + Intronic
1195605733 X:106803426-106803448 CGCGGGGATGGTGAGGAGAAAGG + Intronic
1195898231 X:109770806-109770828 CCAGGGGATAGTGAGGAGGAAGG + Intergenic
1196198104 X:112856323-112856345 ATTGTGCATGGTGAGGAGGAGGG - Intergenic
1196411865 X:115428117-115428139 CAGGGGCAACGGGAGTAGGAAGG + Intergenic
1196870447 X:120108513-120108535 AAGGGGCAAGGTGGTGAGGATGG + Intergenic
1196913298 X:120506206-120506228 CGGGGGCCTGGTGGGGAGGTGGG - Intergenic
1197918603 X:131563400-131563422 CAGGGGCAAGGTGAAGGGCAGGG - Intergenic
1199435962 X:147812913-147812935 CAGCAGCTTGGTGAGGAGGTTGG + Intergenic
1199669254 X:150128432-150128454 CAGGGGTATAGTGATTAGGAAGG - Intergenic
1199876398 X:151932280-151932302 AAGGGGAATGGTGAGTTGGAGGG - Intergenic
1200104292 X:153703746-153703768 GAGGGTCCGGGTGAGGAGGAGGG - Intronic
1200142746 X:153909999-153910021 CAGGAGGATGGTGAGGGCGATGG - Exonic
1200152195 X:153956707-153956729 CATGGGCACAGTGCGGAGGATGG + Exonic
1200162395 X:154016271-154016293 TAGGTGCAGGGTGAGGAGGAGGG + Intronic
1200814029 Y:7513219-7513241 CAGGGGAATGGTAAGCGGGATGG + Intergenic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic
1201335618 Y:12878097-12878119 GAGGGGCAGGGGGAGGGGGAGGG - Intergenic
1202369647 Y:24188175-24188197 CAGGGGGCTGGTGGGGTGGAGGG - Intergenic
1202501138 Y:25481942-25481964 CAGGGGGCTGGTGGGGTGGAGGG + Intergenic
1202583217 Y:26403060-26403082 CAGGAGCAGGGTCAGGAGCAGGG + Intergenic