ID: 1126350754

View in Genome Browser
Species Human (GRCh38)
Location 15:47742698-47742720
Sequence TGGAATAGATGCAGCCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126350751_1126350754 -8 Left 1126350751 15:47742683-47742705 CCTCTCTACCCAGCTTGGAATAG 0: 1
1: 0
2: 0
3: 20
4: 253
Right 1126350754 15:47742698-47742720 TGGAATAGATGCAGCCCCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126350754 Original CRISPR TGGAATAGATGCAGCCCCTC AGG Intronic
903697119 1:25215966-25215988 TGGAACAGAAGCAGCACTTCAGG - Intergenic
906180125 1:43810881-43810903 TGGAATAGAGGGAGGCCATCGGG - Intronic
906888982 1:49686378-49686400 TGGCCTAGTTCCAGCCCCTCAGG + Intronic
909197858 1:72649390-72649412 GGGAAGAGCTGCAGCCCTTCAGG + Intergenic
909244813 1:73267891-73267913 TGGATTAGTTGCAGCTTCTCAGG + Intergenic
909883419 1:80909552-80909574 AGGAATAGATGCCGTCTCTCTGG + Intergenic
916806872 1:168268230-168268252 TGGAATAGGTGGACCCCCTTTGG + Intergenic
918428666 1:184436230-184436252 TGGGATAGATGCAGCCACATTGG + Intronic
919414458 1:197290346-197290368 TGGGATAGATGCAGAGTCTCAGG + Intronic
920728691 1:208462158-208462180 TGTAAGAGATGCAGAACCTCAGG + Intergenic
921282503 1:213581227-213581249 TGGAAGAGATGCAGCCTCGCCGG + Intergenic
922388647 1:225114671-225114693 TGGAATGGATGCTTACCCTCTGG + Intronic
922520388 1:226245545-226245567 TGGTATAGTTCCAGCTCCTCAGG - Intronic
922764114 1:228148811-228148833 TGGAGGAGATGCTGCCCCTGTGG + Exonic
923391428 1:233516631-233516653 GAGAAAAGATGCAGCCCTTCAGG + Intergenic
1063268865 10:4485031-4485053 TAGGATAGATGCAGGGCCTCTGG - Intergenic
1067486689 10:46657158-46657180 TGGACCACATGCAGCCCCACAGG + Intergenic
1067608059 10:47684504-47684526 TGGACCACATGCAGCCCCACAGG - Intergenic
1068311314 10:55280105-55280127 AGTAATAGATGCAGCCCATTTGG + Intronic
1068645264 10:59459074-59459096 TGAAATTGGTGCAGCCCCTTTGG - Intergenic
1071623658 10:87146211-87146233 TGGACCACATGCAGCCCCACAGG - Intronic
1073448835 10:103597478-103597500 TGGAGCAGAGGCAGGCCCTCGGG - Exonic
1076101975 10:127789251-127789273 TAGAACAGATGCAGACCCTCTGG - Intergenic
1076746932 10:132519242-132519264 TGGAGGAGACGCAGCCTCTCTGG + Intergenic
1077683803 11:4272100-4272122 TGGAATAATAGCAGCCCCTCAGG + Intergenic
1077686239 11:4294664-4294686 TGGAATAATAGCAGCCCCTCAGG - Intergenic
1077691387 11:4345828-4345850 TGGAATAATAGCAGCCCCTCAGG - Intergenic
1085884146 11:80502632-80502654 TGCAATTGACGAAGCCCCTCAGG - Intergenic
1087821610 11:102718808-102718830 TGGAATAAATGCAGCTTTTCTGG - Intronic
1090862064 11:130662932-130662954 TGTAAAATATGCAGCCCCTTTGG + Intergenic
1090910067 11:131110964-131110986 TAGAAGAGCTGCAGCCTCTCAGG - Intergenic
1092899112 12:13041859-13041881 TCCAATAGATGCAGCATCTCCGG - Intergenic
1093805171 12:23423273-23423295 TGGAAGAGATGCAGCCCCTTTGG + Intergenic
1094292793 12:28871210-28871232 TGTAATAGAGGCAAACCCTCTGG + Intergenic
1103244171 12:119441001-119441023 TAAAATAGTTGCAGCCACTCAGG - Intronic
1104744318 12:131201579-131201601 TAAAATGGCTGCAGCCCCTCCGG + Intergenic
1104790061 12:131475644-131475666 TAAAATGGCTGCAGCCCCTCCGG - Intergenic
1106775840 13:33008735-33008757 TGGAAGAGATGCAGCCACCCAGG + Intergenic
1110131935 13:72020707-72020729 TGGAATAGGTGGACCCCTTCTGG - Intergenic
1110155726 13:72314019-72314041 TGGAATAGCTGTGGCCCCTCAGG - Intergenic
1113976889 13:114234721-114234743 TGGAATCGCTGCGGCGCCTCTGG - Intergenic
1116504896 14:45665819-45665841 TGGTTTAAATGCTGCCCCTCTGG + Intergenic
1117881233 14:60315537-60315559 TGGAATGACAGCAGCCCCTCTGG - Intergenic
1118511647 14:66481129-66481151 TGGAAAAGCTGCATCTCCTCAGG - Intergenic
1118696278 14:68388794-68388816 TGGACCAGATGCAGCCACGCTGG - Intronic
1120366635 14:83579855-83579877 TGGAAAAGTTGCACCTCCTCCGG - Intergenic
1121322897 14:93002913-93002935 GGGAAGAGATGCAGAGCCTCTGG - Intronic
1124702797 15:31931341-31931363 TGTAATGGATGCAGCCCGCCGGG - Intergenic
1125176352 15:36826544-36826566 TGGGATTGATGCAGCAACTCAGG - Intergenic
1126350754 15:47742698-47742720 TGGAATAGATGCAGCCCCTCAGG + Intronic
1128666249 15:69540355-69540377 TGGAATAAATGCAGATTCTCAGG - Intergenic
1131946382 15:97626750-97626772 TGGAGTAAGTGCAGCCCCTGTGG + Intergenic
1134336258 16:13302436-13302458 AGGAATAAATGGAGCCCCTCTGG + Intergenic
1136716326 16:32286581-32286603 TGAAAGAGATGCGGCCCCTGGGG - Intergenic
1136834712 16:33492859-33492881 TGAAAGAGATGCGGCCCCTGGGG - Intergenic
1137784515 16:51126988-51127010 TGGAACAGATTCTGCCCTTCAGG + Intergenic
1138122872 16:54414554-54414576 TAGAACAGATGCAGCCTCTCAGG + Intergenic
1139183190 16:64771165-64771187 GAGAATAGCTGCAGCCCTTCGGG + Intergenic
1140020061 16:71230303-71230325 TGGAAGCGAGGCAGCACCTCAGG + Intronic
1203010091 16_KI270728v1_random:231173-231195 TGAAAGAGATGCGGCCCCTGGGG + Intergenic
1203144882 16_KI270728v1_random:1793147-1793169 TGAAAGAGATGCGGCCCCTGGGG - Intergenic
1146650167 17:34601697-34601719 TGTAATGGCTCCAGCCCCTCTGG + Intronic
1151036109 17:70802052-70802074 TGCAAGCAATGCAGCCCCTCAGG - Intergenic
1151528424 17:74687541-74687563 TGCAAGAGTTGCAGACCCTCAGG + Intronic
1152086625 17:78223580-78223602 TGGAAGTGGTGCAGCCACTCTGG - Exonic
1152282894 17:79395890-79395912 TGGCCTAGCTGCAGCCCCGCTGG - Intronic
1152589646 17:81205302-81205324 TTGAAAAGATGCTGCTCCTCAGG + Intronic
1153187891 18:2505306-2505328 TGCCATTGATGCAGTCCCTCAGG + Intergenic
1156479733 18:37428543-37428565 TGGAGTAGGTGCAGCCCCTTTGG - Intronic
1160062224 18:75542348-75542370 TTGAAATGGTGCAGCCCCTCTGG + Intergenic
1160464424 18:79064433-79064455 TGGAGTAGATGCAGGCCAGCTGG - Intergenic
1168156011 19:54473236-54473258 TGGAAAAGCTGAGGCCCCTCTGG + Exonic
925038266 2:708909-708931 TGGAATGGAGACAGCACCTCTGG + Intergenic
926784475 2:16506996-16507018 TGGAATGTATGCAGGCTCTCCGG + Intergenic
927888463 2:26732902-26732924 GGGGATAAATGCAGCCCCTTAGG - Exonic
932781324 2:74560418-74560440 TGAAATAGATGCTGTCCCCCTGG + Intronic
934615409 2:95767753-95767775 AGGAAGTGGTGCAGCCCCTCTGG + Intergenic
934645493 2:96056805-96056827 AGGAAGTGGTGCAGCCCCTCTGG - Intergenic
934838897 2:97612894-97612916 AGGAAGTGGTGCAGCCCCTCTGG - Intergenic
941151479 2:161919827-161919849 GGGAAGAGCTGCAGCCCTTCAGG + Intronic
942064351 2:172256287-172256309 TGTAATAGCTGAAGCCTCTCTGG - Intergenic
943932240 2:193868687-193868709 GAGAATAGCTGCAGCCCTTCGGG + Intergenic
948307170 2:236956890-236956912 GGGCCAAGATGCAGCCCCTCAGG - Intergenic
1171436366 20:25127715-25127737 TGGAATACATGCAATCCCTTAGG + Intergenic
1172211517 20:33202001-33202023 TGGGTCAGATGCAGCCCCTGGGG - Intergenic
1175840294 20:62022298-62022320 CAGAATAAAGGCAGCCCCTCTGG + Intronic
1178436962 21:32568026-32568048 TAGAAAAGATGCAGACCCTGAGG - Intergenic
1180282533 22:10716406-10716428 TGAAATAGATTCAGTACCTCAGG - Intergenic
1182946873 22:34332492-34332514 TGGAATAGGTGGACCCCCTTTGG + Intergenic
1184864733 22:47195800-47195822 AGCAATAGCTTCAGCCCCTCGGG - Intergenic
949216633 3:1577528-1577550 TGGAAAAGATGCAACAGCTCAGG + Intergenic
949693802 3:6670484-6670506 TAAAATAGATGCAGCTACTCGGG - Intergenic
949795751 3:7848814-7848836 TGGAAGAGATGGAGCTCCACAGG + Intergenic
951182211 3:19671831-19671853 GGGAAGAGCTGCAGCCCTTCAGG - Intergenic
953931368 3:47007462-47007484 TGGAAGAGACCCAGGCCCTCAGG - Intronic
954290126 3:49645292-49645314 TAGAATAGCTGCAGGCCCTCTGG - Intronic
955452596 3:59085863-59085885 AAGAATAGATGCAGCCCCCAGGG - Intergenic
955648907 3:61171780-61171802 TGTTATAAATGCAGACCCTCAGG + Intronic
956601050 3:71022903-71022925 AGGAATGAATGAAGCCCCTCAGG + Intronic
961615957 3:128181192-128181214 TGGAAAAGATGGGGCCCCTTAGG - Intronic
962754836 3:138459265-138459287 TGGAACAGAGGCAGCCCCACCGG - Intronic
962843931 3:139259045-139259067 AGGAATAGAAGCAGCAGCTCTGG + Intronic
964432619 3:156622561-156622583 TGGAATAGGTGGACCCCTTCTGG - Intergenic
964606614 3:158566823-158566845 TGGACTAGAGGCAGCCCTACTGG + Intergenic
965322363 3:167265767-167265789 TGGAATGGATGATTCCCCTCTGG + Intronic
966764420 3:183447424-183447446 CGGAGTAGATGCAGACCCCCAGG + Intergenic
968237608 3:197045328-197045350 GGGAATAGCTGAAGCCCCTGAGG + Intronic
969106021 4:4807684-4807706 TGGAGCAGATCCAGCCCCTTGGG + Intergenic
973148680 4:46861077-46861099 AGGAATAAATGAACCCCCTCGGG - Intronic
976453940 4:85223866-85223888 TGGAATGGATGATTCCCCTCTGG + Intergenic
977324233 4:95554572-95554594 TAGGCTAGATGCAGCCCCTCAGG - Intergenic
980692935 4:136319763-136319785 TGGAATAGATGATTCCCCTTTGG - Intergenic
983945195 4:173578248-173578270 TAGAATAAGTGCAGCCCCTCCGG + Intergenic
984225290 4:177027578-177027600 TGGAATAAATGAAACCCTTCAGG - Intergenic
984679676 4:182593195-182593217 TGGAATAAATGAAAACCCTCTGG - Intronic
984873069 4:184344428-184344450 TGCAATATATCCAGCCCCTTGGG - Intergenic
985780818 5:1869903-1869925 GGGAATACATGCAGGCACTCAGG - Intergenic
990791558 5:59486189-59486211 TGTAATAGATGTGGCACCTCTGG + Intronic
993168149 5:84383689-84383711 TGTAATCGATGCTGCTCCTCTGG + Intronic
995849738 5:116532563-116532585 TGCAGGAGATGGAGCCCCTCTGG + Intronic
997603432 5:135156018-135156040 TGGAACAAATCCAGCCCCACTGG + Intronic
999364502 5:151013247-151013269 GCGAAGAGAGGCAGCCCCTCTGG + Intergenic
999739851 5:154541908-154541930 TGGTGCATATGCAGCCCCTCAGG - Intergenic
1001105818 5:168853723-168853745 TGTAAGAGATGCTGCTCCTCTGG + Intronic
1006171837 6:32097588-32097610 TGTAATGTATGCAGCCTCTCAGG + Intronic
1011284103 6:85705698-85705720 AAGAAAAGCTGCAGCCCCTCAGG - Intergenic
1015030510 6:128588586-128588608 TGGTATTGATGAAGTCCCTCGGG - Intergenic
1016020830 6:139235099-139235121 TGGAATAGGTGTATTCCCTCCGG + Intergenic
1017159217 6:151349735-151349757 TGAAATGGATGCAGAACCTCAGG + Exonic
1018394407 6:163366578-163366600 TGGAATAGGTGGAACCCCCCAGG - Intergenic
1021537071 7:21717449-21717471 GGGAATAGTTTCAGCCCTTCAGG + Intronic
1021588624 7:22236994-22237016 AGGAAGAGATGCAGCACCTGGGG - Intronic
1022351563 7:29571006-29571028 TGGAATAAAAGCAGTCCTTCTGG + Intergenic
1025020927 7:55478688-55478710 TGGAATAGAACCAGGACCTCAGG + Intronic
1026081271 7:67223623-67223645 TGGAATAGAGGCAGCCAGTCAGG - Intronic
1026695808 7:72590380-72590402 CGGAATAGAGGCAGCCAGTCAGG + Intronic
1029116919 7:98242322-98242344 AGGAATCGAAGCAGCCCCTGAGG - Intronic
1031975983 7:128093840-128093862 TTGACTACATGCAGCCCCTTAGG + Intergenic
1034101732 7:148456775-148456797 GAGAAGAGCTGCAGCCCCTCAGG - Intergenic
1034876597 7:154730005-154730027 AGGCAGAGGTGCAGCCCCTCCGG - Intronic
1035337985 7:158142296-158142318 TTGAATAGTTCCAGCCGCTCCGG - Intronic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1044781981 8:95752666-95752688 TTGAACAGTTGCAGCCCCTGGGG - Intergenic
1045198294 8:99952326-99952348 TGGAGTAGATGGAGCACCTATGG - Intergenic
1048495751 8:134934591-134934613 AGGAATAGATACTGCACCTCAGG + Intergenic
1050238202 9:3605451-3605473 TAGCATAGATGCATTCCCTCTGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1060304394 9:122397894-122397916 TGGGATGGATGCTTCCCCTCTGG - Intergenic
1061261089 9:129481567-129481589 AGGACTAGATTGAGCCCCTCTGG + Intergenic
1186805920 X:13139984-13140006 GAGAAGAGATGCAGCCACTCAGG + Intergenic
1187396851 X:18926898-18926920 TAGAATAGATGCAGACCCAGAGG - Intronic
1191110272 X:56798913-56798935 TGGAAAAGGTGGAGGCCCTCAGG + Intergenic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1194831718 X:98631657-98631679 TGGAATTGATGACTCCCCTCTGG - Intergenic
1198773456 X:140155280-140155302 TGGAATAGACGATTCCCCTCTGG - Intergenic
1199359946 X:146906577-146906599 GAGGATAGCTGCAGCCCCTCAGG - Intergenic