ID: 1126351055

View in Genome Browser
Species Human (GRCh38)
Location 15:47745198-47745220
Sequence CAGGCTTCCTGGTACTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126351050_1126351055 4 Left 1126351050 15:47745171-47745193 CCTCACAGTTGTACCTTTAGCCT 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 201
1126351052_1126351055 -9 Left 1126351052 15:47745184-47745206 CCTTTAGCCTTGAACAGGCTTCC 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 201
1126351047_1126351055 16 Left 1126351047 15:47745159-47745181 CCACACACCCTTCCTCACAGTTG 0: 1
1: 0
2: 4
3: 31
4: 316
Right 1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 201
1126351049_1126351055 8 Left 1126351049 15:47745167-47745189 CCTTCCTCACAGTTGTACCTTTA 0: 1
1: 0
2: 2
3: 17
4: 193
Right 1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 201
1126351048_1126351055 9 Left 1126351048 15:47745166-47745188 CCCTTCCTCACAGTTGTACCTTT 0: 1
1: 0
2: 0
3: 30
4: 278
Right 1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126351055 Original CRISPR CAGGCTTCCTGGTACTCACC TGG Intronic
900439831 1:2648965-2648987 CAGGCTGTCAGATACTCACCTGG - Intronic
900440198 1:2651071-2651093 CAGGCTTTCTGATGCTTACCTGG - Intronic
900441196 1:2656258-2656280 CAGGCTTTCAGATGCTCACCTGG - Intronic
900441768 1:2659189-2659211 CAGGCTGTCTGATGCTCACCTGG - Intronic
900442661 1:2663805-2663827 CAGGCTGTCTGATGCTCACCTGG - Intronic
900443554 1:2668421-2668443 CAGGCTGTCTGATGCTCACCTGG - Intronic
900444556 1:2673599-2673621 CAGGCTGTCTGATGCTCACCTGG - Intronic
900446164 1:2681988-2682010 CAGGCTGTCTGATGCTCACCTGG - Intronic
900448235 1:2692386-2692408 CAGGCTGCCAGATGCTCACCTGG - Intronic
900449332 1:2697809-2697831 CAGGCTGTCTGATCCTCACCCGG - Intronic
900449447 1:2698409-2698431 CAGGCTGTCGGATACTCACCTGG - Intronic
900449477 1:2698530-2698552 CAGGCTGCCCGATGCTCACCTGG - Intronic
900449844 1:2700375-2700397 CAGGCTGTCAGATACTCACCTGG - Intronic
900450006 1:2701222-2701244 CAGGCTGCCAGATGCTCACCTGG - Intronic
900450238 1:2702388-2702410 CAGGCTGTCAGATACTCACCTGG - Intronic
900452800 1:2758760-2758782 CAGGCTGTCTGATCCTCACCCGG - Intronic
900452915 1:2759360-2759382 CAGGCTGTCGGATACTCACCTGG - Intronic
900452946 1:2759481-2759503 CAGGCTGCCCGATGCTCACCTGG - Intronic
900453302 1:2761326-2761348 CAGGCTGTCAGATACTCACCTGG - Intronic
900453493 1:2762333-2762355 CAGGCTGCCAGATGCTCACCTGG - Intronic
900453722 1:2763499-2763521 CAGGCTGTCAGATACTCACCTGG - Intronic
900453921 1:2764504-2764526 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454206 1:2765918-2765940 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454435 1:2767084-2767106 CAGGCTGTCAGATACTCACCTGG - Intronic
900454651 1:2768248-2768270 CAGGCTGCCAGATCCTCACCTGG + Intronic
900454718 1:2768583-2768605 CAGGCTTTCAGCTGCTCACCTGG - Intronic
900454741 1:2768703-2768725 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454871 1:2769348-2769370 CAGGCTGTCAGGTGCTCACCTGG - Intronic
900455167 1:2770761-2770783 CAGGCTGTCAGATACTCACCTGG - Intronic
900455368 1:2771766-2771788 CAGGCTGCCAGATGCTCACCTGG - Intronic
900455685 1:2773340-2773362 CAGGCTGCCAGATGCTCACCTGG - Intronic
900455913 1:2774506-2774528 CAGGCTGTCAGATACTCACCTGG - Intronic
900456168 1:2775873-2775895 CAGGCTGCCAGATCCTCACCTGG + Intronic
900456234 1:2776208-2776230 CAGGCTTTCAGCTGCTCACCTGG - Intronic
900456256 1:2776328-2776350 CAGGCTGCCAGATGCTCACCTGG - Intronic
900456279 1:2776447-2776469 CAGGCTGCCAGATGCTCACCTGG - Intronic
900456409 1:2777092-2777114 CAGGCTGTCAGGTGCTCACCTGG - Intronic
900788654 1:4665645-4665667 CACGCTGCCTGGCTCTCACCTGG - Intronic
901277191 1:8001419-8001441 CAGGCTTGGTGGCACGCACCTGG + Intergenic
901641000 1:10693091-10693113 CAGGAGGCCTGGTGCTCACCTGG - Intronic
902117982 1:14137421-14137443 CAGGCTGGCTGGGACTCACAGGG + Intergenic
902717542 1:18282989-18283011 CAGGCTTCCTTGTTCACAGCAGG + Intronic
902734476 1:18391120-18391142 TAGGCTGCCTGGCACCCACCTGG - Intergenic
903658487 1:24963178-24963200 CAGCCTTCCTTGGCCTCACCAGG + Intronic
903740992 1:25558355-25558377 CAGGCTTCCTGCTGCCCATCAGG + Intronic
905016133 1:34780175-34780197 GAGGCTCCCTTGTACTCACTGGG - Intronic
905414695 1:37795734-37795756 CAGGCGTCCTGGTCCTGTCCTGG + Exonic
905626562 1:39493403-39493425 CAGGCTTCCTGGGCCTGTCCTGG - Intronic
905670333 1:39787053-39787075 CAGGCTTCCTGGGCCTGTCCTGG + Intronic
906082384 1:43101886-43101908 CAGGCCTTCTGGTAGTCTCCTGG + Intergenic
906524039 1:46484155-46484177 CAGGCCTCCTTGTACACACAAGG + Intergenic
907288206 1:53395722-53395744 GAGGCTTCCTGGAGCTCAGCTGG - Intergenic
909395864 1:75169921-75169943 CAGGCTTCATGGTGCTACCCTGG + Intergenic
910288252 1:85577285-85577307 CTGGCTTCCTGGGGCTCTCCTGG + Intronic
910872340 1:91846385-91846407 CAAACTTCCTGGCACTCACAAGG + Intronic
913334639 1:117697967-117697989 CAGGGTTCCTGGTACACAGTAGG - Intergenic
915487557 1:156232422-156232444 CAGGCTTCCCGCCACTCACCCGG - Exonic
915669093 1:157472449-157472471 CAGGCTTCCTGATGCAAACCAGG - Intergenic
916177604 1:162055577-162055599 CGGGCTTCTTGGTTCTCACAGGG + Intergenic
1067182516 10:43999682-43999704 CAGGCTTTCTGGTTGACACCTGG - Intergenic
1070311243 10:75275653-75275675 CAGGCAGCCTGGGCCTCACCTGG + Intergenic
1072020777 10:91397719-91397741 CAAGCTTCATGGTAATCACAAGG + Intergenic
1073870121 10:107853699-107853721 GAGGCTTCCTGGTGCTCAGATGG - Intergenic
1074969472 10:118523936-118523958 CAGGCTTGCTGTGACTCACGTGG + Intergenic
1076109525 10:127850196-127850218 CAGGCTTTCTGGTACTGAGTGGG - Intergenic
1077627043 11:3781426-3781448 CAGGGTTTCTGGTTTTCACCAGG + Intronic
1078669106 11:13349130-13349152 CAGGGTTCATGGTAGCCACCGGG - Intronic
1081493611 11:43584671-43584693 CTGACATCTTGGTACTCACCTGG - Intronic
1083176003 11:60950975-60950997 CAGGCCTCCTGCCACTCACCTGG + Exonic
1084438881 11:69159348-69159370 CAGCGTTTCTGGTCCTCACCTGG - Intergenic
1085304521 11:75477566-75477588 CAGGCTTGCTGGGGCTCACTGGG + Intronic
1085394962 11:76202552-76202574 CAGGCTTCCGTCTACTCCCCTGG + Intronic
1089051829 11:115552351-115552373 CAAGCTGCCTGGAATTCACCAGG + Intergenic
1091480190 12:820614-820636 CAGGCATGGTGGTACACACCTGG - Intronic
1094414384 12:30201830-30201852 CAGGCTCCCAGGTCCTCTCCAGG + Intergenic
1097533000 12:60829276-60829298 CTGGCTTCATAGTACTCACTGGG + Intergenic
1100487129 12:95041031-95041053 CAGGCTTGCTGGTACCAACTGGG + Intronic
1104893540 12:132151365-132151387 CAGGTGCCCTGGTACTCACGAGG - Exonic
1105716101 13:23066417-23066439 CAGGCATCATGTTACACACCAGG + Intergenic
1105882010 13:24613821-24613843 CTGTCTTCCTGCTACTCACAAGG - Intergenic
1107559274 13:41545610-41545632 CAGCCCTCCTGACACTCACCTGG - Intergenic
1113721507 13:112561245-112561267 CTGGCTTGCAGGGACTCACCGGG - Intronic
1113840357 13:113355830-113355852 CCGGCCTCCTTGTACTCAGCTGG - Intronic
1119552157 14:75522806-75522828 CAGGCTTCCTTGTCCTGCCCAGG + Intronic
1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG + Intronic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1127700580 15:61496331-61496353 TATGCCTCCTGGGACTCACCTGG - Intergenic
1127799072 15:62462332-62462354 CATGTTTCCTGGTCCTCTCCTGG - Intronic
1128551109 15:68598564-68598586 CAGGCATGCTGGTGCTCACCAGG - Intronic
1130830410 15:87592970-87592992 CTGGCTTCCTGGTACTGACAGGG + Intergenic
1132744345 16:1430514-1430536 CAGGCGTCCTGGTAACCACTGGG + Intergenic
1133036870 16:3038482-3038504 CTGACTTCCAGCTACTCACCTGG + Intergenic
1133435167 16:5772975-5772997 AAGGCTTCCTGGAACACACCAGG - Intergenic
1134105777 16:11485186-11485208 CAGGCTCCCTGGTGCCCACCTGG + Intronic
1134840794 16:17400029-17400051 CAGGCTAACTGGCCCTCACCAGG + Intronic
1142138269 16:88461279-88461301 CAAGCATCCTGGTCCTCACCAGG - Intronic
1143620379 17:8076939-8076961 CAGGCATCATGGCCCTCACCTGG - Intronic
1146620228 17:34391424-34391446 CAGGGAACCTGGTCCTCACCTGG - Intergenic
1147488171 17:40838913-40838935 AAGGCTTCCTGGCACACACTGGG - Intergenic
1149610680 17:57955831-57955853 CTGGGTTCCTGGCACTGACCTGG - Intergenic
1151034263 17:70779926-70779948 AAGGCTTGCTGGCACTCTCCAGG + Intergenic
1152730925 17:81969523-81969545 CAGGCTTCCTGCAGCCCACCGGG + Intergenic
1156317479 18:35983902-35983924 CAGTCTTCCTCTTATTCACCAGG + Intergenic
1158629125 18:59096722-59096744 CAGGCTTCCTGTTATTTACCTGG - Intergenic
1159376766 18:67603449-67603471 AAGCATTCCTGGTACTTACCTGG + Intergenic
1161030601 19:2056245-2056267 CAGGCTTCCTGCCTCCCACCAGG - Intergenic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1163972832 19:20816248-20816270 CAGGCATCTTGGTGCACACCTGG + Intronic
1166294227 19:41881139-41881161 CAGGCCTCCTTGGACTCCCCTGG + Exonic
1166633810 19:44431748-44431770 TAGGCCTCATGGTTCTCACCTGG + Intronic
1167607163 19:50487619-50487641 CAGGTTTCCAGGTCCTGACCAGG - Exonic
1168034664 19:53709848-53709870 CAGGCATCCTGGGACACACAGGG + Intergenic
925039449 2:719859-719881 CAGGCTTCCTGTTAATACCCCGG + Intergenic
927070543 2:19524387-19524409 CAGCCTTCCTGGCACTCAGGTGG + Intergenic
927575773 2:24200873-24200895 CAGGGTTCCTGGTTCACAACAGG - Intergenic
928364306 2:30689749-30689771 CCGGCTTCCAGCTCCTCACCTGG - Intergenic
928404705 2:31005741-31005763 AATGCTTCCTGGGACTCAGCAGG + Intronic
929576619 2:43056439-43056461 CAGGGTTTCTAGTCCTCACCTGG + Intergenic
932702900 2:74003058-74003080 CTGCCTTCCTGGTACCCGCCTGG + Intronic
935407938 2:102728644-102728666 CTGGCCTCCTTGTACTCACAGGG + Intronic
936349339 2:111701105-111701127 CAGGCTTACTGGTAGACACATGG - Intergenic
937294004 2:120798888-120798910 CAGGCTTCCTGGAGCTCACAAGG - Intronic
937979934 2:127608909-127608931 CAGGCTTCCCTGTCCCCACCCGG - Intronic
938092319 2:128441719-128441741 ACGGCTCCCTGGGACTCACCAGG - Intergenic
938097943 2:128475509-128475531 CAGGCCTCCTGGTACACAGTTGG + Intergenic
938408215 2:131044451-131044473 CGGGCTTCCTGGTGCACAGCAGG - Exonic
939261700 2:139818884-139818906 CAGGTTTCAGGGTACTCACTTGG - Intergenic
944370145 2:198973407-198973429 CAGGCTGCCTGGTACACAGCTGG + Intergenic
944448234 2:199813961-199813983 CATGGTTCCTGGCACTCACCAGG - Intronic
944928402 2:204490242-204490264 CAGAGTTCTTGTTACTCACCTGG + Intergenic
946044250 2:216807987-216808009 CAGGCCAACTGGCACTCACCTGG + Intergenic
946862924 2:224017112-224017134 CAGGTTTACAGGTACTCACTGGG - Intronic
947670901 2:231934749-231934771 CAGGACTGCTGGGACTCACCTGG + Intergenic
947714652 2:232333508-232333530 CTGGCTCCCTGGTCCTCAGCAGG + Intronic
948496409 2:238352553-238352575 CAGGCCTCCTGGTCCACACCTGG - Intronic
948601844 2:239111868-239111890 CAGGCTTCAGGGCACTCACAGGG - Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
948910338 2:240999356-240999378 CAGGGGTCCTGGTACTGCCCTGG + Intronic
948922950 2:241074332-241074354 CAGTCCTCCTGGTGCTCACAGGG - Intronic
1173446323 20:43122157-43122179 CTGGCATCCTGGGAATCACCTGG - Intronic
1173569759 20:44068579-44068601 CAGGGGTCCTGGTGCTCCCCTGG + Intronic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1180025777 21:45161298-45161320 CAGGCATCCCTGCACTCACCAGG + Intronic
1181610914 22:24011364-24011386 CAGCCTTCCAGGAACTCACCAGG - Intronic
1182125168 22:27810759-27810781 CAGCCTGCCTGGAGCTCACCAGG - Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183319037 22:37154035-37154057 CAGGCTTCCTGTGTCTGACCTGG - Intronic
1184726566 22:46350762-46350784 CACACTGCCTGGCACTCACCTGG - Intronic
1185072105 22:48662102-48662124 CTGGCTTCCAGGTATTCACAAGG - Intronic
949469448 3:4379438-4379460 AAGGATTCCTGGAAGTCACCAGG + Intronic
950024510 3:9810938-9810960 TTGGCTCCCTGGAACTCACCAGG - Intronic
950107662 3:10398525-10398547 CAGGCTTCACGGGACTCACTGGG + Intronic
956421154 3:69087160-69087182 CAGGCTTTGTGGCACGCACCTGG - Intronic
956743862 3:72296169-72296191 CAGACTTGCTGGTACTAAACAGG + Intergenic
962134803 3:132722376-132722398 CAGTCCTGCTGGTACTCACTAGG - Exonic
962750510 3:138431654-138431676 AAGGATTCCTGGCACCCACCAGG - Intergenic
962874280 3:139523916-139523938 CAGGCATCGTGGTGCTCAGCAGG - Intronic
965380638 3:167983406-167983428 CAGGCTTCCTGGACCTGCCCTGG + Intergenic
965437510 3:168670941-168670963 CGGTGATCCTGGTACTCACCTGG - Intergenic
965624016 3:170668986-170669008 CAAGCTTGCTGGTCCTCATCAGG - Intronic
966087790 3:176090900-176090922 CAGGCTTCCAAGCACCCACCTGG + Intergenic
967109118 3:186277761-186277783 TAGCCTTCCTCGTGCTCACCAGG + Intronic
968228383 3:196990079-196990101 CAGTATTCCTGGAACTCCCCCGG + Intronic
969241992 4:5905192-5905214 CCGGCTTCCTGTCACTCACATGG + Intronic
969308202 4:6337421-6337443 CAGGGTTCCCGCCACTCACCTGG - Intronic
969603456 4:8190161-8190183 CAGACTCCCTGCTACCCACCTGG - Intronic
974077973 4:57184918-57184940 CAGGCTTCCTTGTGTGCACCTGG - Intergenic
975613101 4:76220859-76220881 AATGCTTCCAGGTGCTCACCTGG + Intronic
976076567 4:81305769-81305791 CAGGCTTCCTTTTTCTCACAGGG - Intergenic
976398916 4:84585999-84586021 AAAGATTCCTGGGACTCACCAGG + Intronic
977735454 4:100409637-100409659 CAGGTTTCCTTTTACTCAGCTGG - Intronic
985746663 5:1652064-1652086 CAGGCTGCCTTGTTCTCAGCAGG - Intergenic
991398700 5:66231716-66231738 CAGGCTTCCTTGTCCTATCCAGG + Intergenic
991557770 5:67914762-67914784 CAGCCTTCCTGGGCCTCACTTGG - Intergenic
995022531 5:107382512-107382534 CAGGCATCGTGGTTCACACCTGG - Intronic
999816773 5:155184804-155184826 CAAGCATCCTGCTACTAACCTGG - Intergenic
1002699254 5:181110994-181111016 CAGGCTTCCTGGTTCCCCACAGG + Intergenic
1003051319 6:2783315-2783337 CAGGCTTTCTGGAAGTCAGCTGG + Intronic
1003850259 6:10215307-10215329 CAGCTTTCCTGCTTCTCACCAGG + Intergenic
1006928775 6:37674732-37674754 CTGGCATCCTGGGACCCACCAGG - Intronic
1009624916 6:66126802-66126824 CAGGCTGCCTGGAACCCAGCTGG - Intergenic
1011486595 6:87848671-87848693 CTGTCTTCCTGCCACTCACCTGG + Intergenic
1015416309 6:132952686-132952708 CAGCCTTCCAGGAAATCACCAGG - Intergenic
1018006113 6:159623757-159623779 ATGTCTTCCTGGTACTCAACTGG - Intergenic
1019117409 6:169776408-169776430 CAGGCATCATGATCCTCACCTGG - Intronic
1022537543 7:31107243-31107265 CAGGCCTCCTGGCACTCGCCTGG + Exonic
1023207862 7:37770396-37770418 CTTGCTTCCTTGTCCTCACCAGG + Intronic
1026117513 7:67508482-67508504 CAGGCCTCCTGGTCCTAACATGG - Intergenic
1029126911 7:98300934-98300956 CAGGGTTCCTGGGACGCATCAGG - Intronic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1029421309 7:100473054-100473076 CAGGCTGCCTGCTTCTCCCCGGG - Intronic
1030094733 7:105888111-105888133 CAAACTTCCTGAGACTCACCTGG - Intronic
1031560640 7:123233882-123233904 CAGGCTTCCTGGTCCACACCAGG - Intergenic
1034114752 7:148574980-148575002 CAGGCTTACTGCTACACAACGGG - Intergenic
1034265768 7:149779966-149779988 CAGGCCTCGTGGTACTCAGCAGG - Intergenic
1034338161 7:150336750-150336772 CAGGCCTCCTGGCACTGGCCTGG + Exonic
1036465990 8:8997733-8997755 CAGGCTTGGTGGTGCACACCTGG - Intergenic
1038893670 8:31756325-31756347 CCTGCTTCCTGCTAGTCACCTGG - Intronic
1040661368 8:49579904-49579926 CAGGTGTAGTGGTACTCACCTGG + Intergenic
1042053577 8:64737603-64737625 CAGGCATCTTGGTACTTACAAGG - Intronic
1046619096 8:116509044-116509066 CTTGCTTCCTGATACTCACTTGG - Intergenic
1048261246 8:132947007-132947029 CAGCCTTCCTCGAACTCTCCTGG + Intronic
1050261321 9:3843526-3843548 CAGGCTTCCTGGTAGCCAGATGG - Intronic
1052993124 9:34533816-34533838 CAGTCTTTCTGGTACTCAGAAGG + Intergenic
1053684253 9:40506696-40506718 CAGGAGTCATGGTACACACCTGG + Intergenic
1054279471 9:63118257-63118279 CAGGAGTCATGGTACACACCTGG - Intergenic
1054297347 9:63342160-63342182 CAGGAGTCATGGTACACACCTGG + Intergenic
1054395367 9:64646668-64646690 CAGGAGTCATGGTACACACCTGG + Intergenic
1054430014 9:65151868-65151890 CAGGAGTCATGGTACACACCTGG + Intergenic
1054500371 9:65869664-65869686 CAGGAGTCATGGTACACACCTGG - Intergenic
1055449215 9:76415910-76415932 CATGCTTCCTGGTAATCACAGGG + Intergenic
1055894528 9:81159933-81159955 CAGGATTTCTGTTACTCATCTGG - Intergenic
1057276986 9:93681212-93681234 CAGGCTGCCTGGCACTCAGTGGG - Intergenic
1057869361 9:98707263-98707285 CTGGCTTCCTGGGACTCTCCGGG - Intronic
1059333110 9:113548884-113548906 CAGGCTTCCTGAGAGTCGCCTGG + Intronic
1061822385 9:133235725-133235747 AGGGCTTCCTAGTGCTCACCTGG - Intergenic
1187137826 X:16565358-16565380 CAGGCATGGTGGTACACACCTGG + Intergenic
1188642358 X:32521977-32521999 CAGGCTTCCTGGTTCATACTTGG - Intronic
1193961100 X:87925385-87925407 CTGGCTTCCCCGTACCCACCAGG + Intergenic
1194882793 X:99274390-99274412 CAGGATTCCTGGACCTGACCTGG + Intergenic
1198254142 X:134910668-134910690 CATTCTTCCTGGAATTCACCCGG - Intronic
1198651988 X:138873198-138873220 CAGGTCTCCTGGTACTGATCTGG - Intronic
1201232715 Y:11880159-11880181 CAGTCTCCCTTGTACTCACAGGG - Intergenic