ID: 1126351170

View in Genome Browser
Species Human (GRCh38)
Location 15:47746241-47746263
Sequence GTGCCTCATCAGAGGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126351170 Original CRISPR GTGCCTCATCAGAGGTTCTC AGG (reversed) Intronic
901517713 1:9760512-9760534 GTATCTCATCAGAGGTACTGTGG - Intronic
903016511 1:20365531-20365553 GTGGCTCAGCAGAGGGTCCCAGG + Intergenic
905522776 1:38613299-38613321 CTGCCTCATCTCAGGTTATCGGG - Intergenic
912920202 1:113859031-113859053 AATCCTCATCAGAGGTTATCAGG + Exonic
913118955 1:115722015-115722037 GTGGCTCCTCAGAGGTCCTTTGG + Intronic
914340456 1:146755608-146755630 GTGGCAGATCAGAGCTTCTCCGG - Intergenic
914521779 1:148424115-148424137 GTGCTTCCTCAGATGTTCTTGGG - Intergenic
915929905 1:160053919-160053941 GGGCCACATCAGATATTCTCTGG + Intronic
917153010 1:171964844-171964866 GTGCCACAACGGAGGTTCCCAGG - Intronic
1063149712 10:3325095-3325117 GTGCCTCAGCAGCTGCTCTCTGG + Intergenic
1067055240 10:43046154-43046176 GTGCCTCGTCAGAGGGACTGGGG - Intergenic
1070801266 10:79245656-79245678 GTGCTTCCACAGAGGTTCTGCGG + Intronic
1071167375 10:82822482-82822504 TTGACTCCTCAGAGGATCTCTGG + Intronic
1071486034 10:86103385-86103407 GGGCCTCATCACAGGCTCACAGG - Intronic
1072618106 10:97063059-97063081 GTGCCTCCTCCGATGTCCTCTGG - Intronic
1073357283 10:102867121-102867143 GTGCCTCACCACAGGTTTTGTGG - Intronic
1074704435 10:116118569-116118591 GTGTCACAGCAGAGGGTCTCAGG - Intronic
1074810274 10:117097998-117098020 GTGCCTCTTCAGTTGTTCTGGGG - Intronic
1078201907 11:9191036-9191058 GTGCTTCATAAGTGGTTCTTGGG - Intronic
1080133671 11:28827493-28827515 CTGCCTCATTGCAGGTTCTCTGG + Intergenic
1080822503 11:35820918-35820940 GTGCCTCTTCAGAGTTTGGCTGG - Intergenic
1082812970 11:57489785-57489807 GTCTCTCATCAGAAGTCCTCAGG + Intronic
1083454057 11:62766281-62766303 GTGCCTGATCATAGGTGCTGGGG + Intronic
1085845648 11:80061571-80061593 GTGGCTCATCAGATGTTGTCTGG - Intergenic
1086152185 11:83624151-83624173 GTGGCTCAGAAGAGGTTTTCTGG + Intronic
1087592115 11:100203200-100203222 TTGCCTCTTCAGATGTTCTGTGG + Intronic
1089559553 11:119336960-119336982 GAGCCTCATCAGACGATCACAGG - Exonic
1091314875 11:134607372-134607394 GTGCCTCATCAGGAGTTCAGTGG - Intergenic
1092416526 12:8294229-8294251 ATGCTTCTTCAGAGGTTCTAGGG - Intergenic
1099427197 12:82537909-82537931 GGGCCTAATCTGAGGTGCTCAGG + Intergenic
1101656834 12:106729862-106729884 GTACCTCCTCAGTGGTTCACAGG + Intronic
1104997440 12:132667398-132667420 GTGCCTGCTCAGAGGATCCCAGG + Intronic
1105828629 13:24144552-24144574 GTGCCTGATCAAAGTTTGTCTGG - Intronic
1107825543 13:44325793-44325815 GTGCCTCTTCTGTGGTTCTCAGG + Intergenic
1108012559 13:46034552-46034574 GTGACAGATCAGAGGTTATCAGG + Intronic
1110274147 13:73624378-73624400 ATGCCTTATCAGAGATTCTGGGG - Intergenic
1111463407 13:88575963-88575985 CTGCCTTAGTAGAGGTTCTCTGG + Intergenic
1113162286 13:107395423-107395445 GTACCTCTTCAGAGCTTCCCAGG + Intronic
1121379592 14:93451545-93451567 GAGACACATCAGAGGGTCTCCGG - Intronic
1122823655 14:104359387-104359409 GTGCCTCCTCAGAGATTTTGGGG + Intergenic
1124808859 15:32913931-32913953 GTGCCCCTTTAGAGGCTCTCTGG - Intronic
1125862324 15:43010573-43010595 GCTCCTCCTCAGAGGTTCTCTGG - Intronic
1126351170 15:47746241-47746263 GTGCCTCATCAGAGGTTCTCAGG - Intronic
1126682272 15:51213897-51213919 GTGCCTCCTAGCAGGTTCTCAGG - Intronic
1129490752 15:75923114-75923136 GGGCCTCATCAAAGATTCCCAGG - Intronic
1133103109 16:3491088-3491110 GTGACTCATCAGTGGACCTCAGG + Intergenic
1139993832 16:70961798-70961820 GTGGCAGATCAGAGCTTCTCCGG + Intronic
1141315076 16:82954380-82954402 GTGCGTCACCAGAGGCTTTCTGG - Intronic
1142338665 16:89507041-89507063 GTGCCTCGGCAGAGGTGCTCGGG - Intronic
1143896613 17:10141475-10141497 GTGTCTCTTCAGGGGTGCTCAGG - Intronic
1146913528 17:36663590-36663612 GTGCCCCCCCAGAGCTTCTCTGG + Intergenic
1147386726 17:40086924-40086946 CAGGCTCATCTGAGGTTCTCTGG + Intronic
1147388070 17:40093316-40093338 GTTCCTCCTCAGAGGAGCTCGGG - Exonic
1148089375 17:45013667-45013689 GTGCCCCAGCAGGGGCTCTCTGG - Intergenic
1149105656 17:52961473-52961495 GTGGCTCCTCACAGGTTCTTGGG + Intergenic
1152286801 17:79417305-79417327 GTGCCTCAGCTGAAGCTCTCAGG + Intronic
1155357619 18:24968825-24968847 GGGGCCCATCAGAGGTGCTCAGG - Intergenic
1156359799 18:36374763-36374785 GTGCCTCATCACAGGTAGACCGG + Intronic
1158263971 18:55639667-55639689 GTGCCTCACTAAAGATTCTCTGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161590703 19:5127925-5127947 GTGCCTGCTCAGAGGGTCCCTGG - Intronic
1161627368 19:5335138-5335160 CTGCCTCATCCGAGGGTCCCAGG + Intronic
1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG + Intronic
930710053 2:54542575-54542597 ATTCCACATCAGTGGTTCTCAGG - Intronic
932816605 2:74866796-74866818 GTGCCCCCTCAAAGGATCTCAGG - Intronic
935962949 2:108445327-108445349 GTGGCTGGTCAGAGATTCTCTGG - Intergenic
938617002 2:133009766-133009788 GAGCATCAACAGAGGCTCTCTGG + Intronic
938698361 2:133854726-133854748 GTGGCACATCTGTGGTTCTCAGG - Intergenic
941857984 2:170249790-170249812 GTGCCTCATTAGTGGTTATATGG + Intronic
946203416 2:218085260-218085282 GTGATTAATCACAGGTTCTCAGG + Intronic
946245537 2:218385133-218385155 CTGCCTCCTCACAGCTTCTCTGG + Exonic
946745126 2:222837914-222837936 GTTCTTCATCACATGTTCTCGGG + Intergenic
1170007677 20:11686802-11686824 TTGCCTCCTCTGAGGCTCTCTGG - Intergenic
1171375982 20:24694346-24694368 GGGCCTCCTCCCAGGTTCTCTGG - Intergenic
1174943577 20:54959288-54959310 GTGCATCATCAGTGGCTCTTGGG + Intergenic
1175743903 20:61440206-61440228 CTGCCTCCTCAGTGGTTATCTGG - Intronic
1176184162 20:63769125-63769147 GTGCCTCCTCGGAGGTGCCCGGG + Intronic
1184914667 22:47561393-47561415 GTGCCACAGCAGAGGTGTTCTGG + Intergenic
1185136590 22:49076869-49076891 CTGCCTCTCCAGAGGTGCTCAGG - Intergenic
955638178 3:61053235-61053257 ATGCCTCTTGAGAAGTTCTCAGG + Intronic
957507773 3:81146458-81146480 GTGCCTCATTAGAAGTACACAGG - Intergenic
960347519 3:116552637-116552659 GTGCCTCATCAGGAATTCTGTGG - Intronic
961995224 3:131235110-131235132 GTGGCTGATCAGAGGTCCACAGG + Intronic
964182706 3:153907304-153907326 GTGCCTCTTCCATGGTTCTCGGG - Intergenic
965628579 3:170707169-170707191 GTGCATCCTGAGATGTTCTCAGG + Intronic
969834291 4:9827254-9827276 GTGCCTTATAGGAGGTACTCAGG + Intronic
970006819 4:11418958-11418980 CTGCCTCAGCAGAGCTTCTGAGG - Intronic
971174848 4:24272373-24272395 AAGCCTCCTCAGTGGTTCTCTGG - Intergenic
971390755 4:26183326-26183348 GTGCCGCATCACAGTTTCTGTGG - Intronic
978190044 4:105900189-105900211 CTTCCTCATCAGAGGTGCTCTGG + Intronic
980110925 4:128636100-128636122 GTGTCACATCAGCGATTCTCAGG - Intergenic
980576213 4:134686350-134686372 CTGCCTTATGAGAGGTTTTCAGG - Intergenic
983554327 4:169046415-169046437 GTGCCACCTCAGAGAGTCTCTGG - Intergenic
986453661 5:7892789-7892811 CTGCCACAACAGAGGTTCTGCGG + Exonic
995938681 5:117551174-117551196 ATGCCTCATGATAGGTTCCCAGG + Intergenic
1003637097 6:7842324-7842346 GTGCCTCAGCTGAGGTGCTTGGG + Intronic
1009275283 6:61670309-61670331 GTGCTTCATTAAAGGTTATCAGG + Intergenic
1009437068 6:63631037-63631059 GTGGCTGATCAGTGGTTCCCAGG + Intergenic
1011216413 6:85010659-85010681 GTTCCTCATCAGAATTGCTCAGG + Intergenic
1015808942 6:137142055-137142077 GTGGCTTACCAGGGGTTCTCAGG - Intergenic
1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG + Intronic
1019388496 7:772180-772202 ATGAATCATGAGAGGTTCTCAGG + Intronic
1019479114 7:1258092-1258114 GTGCCTAATCTGGGGTTCTCAGG + Intergenic
1020502317 7:8938875-8938897 GTCCCTCAACAGAGTTTCTCAGG - Intergenic
1032603086 7:133320587-133320609 GTGACTAATCACAGGTTCTAGGG + Intronic
1036689020 8:10929723-10929745 GTGCCCCCTCAGAGGGTCACAGG + Intronic
1037754719 8:21703384-21703406 GTGCCTCCTCGGATGTTCCCAGG + Intronic
1041143336 8:54845299-54845321 ATACCTGATCAGTGGTTCTCTGG + Intergenic
1042563337 8:70090113-70090135 ATTCCTCAGCAGAGGTCCTCGGG - Intergenic
1049022193 8:139965090-139965112 GTCCCTCAGCAGGGGGTCTCTGG + Intronic
1052523984 9:29588890-29588912 GGGCCTAATCAGAGGTGTTCAGG + Intergenic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1056044092 9:82698313-82698335 CTGCTTCATCAGATGTTCTTAGG - Intergenic
1060087855 9:120717353-120717375 TTGCTGTATCAGAGGTTCTCTGG + Intergenic
1061799551 9:133106445-133106467 GAGCCACATCAGAGATTTTCAGG - Intronic
1189079387 X:37954108-37954130 GTACCTCATCATAGGTTCAGAGG - Intronic
1189305926 X:39986560-39986582 GGGCCGCATCTGATGTTCTCAGG + Intergenic
1193258741 X:79380289-79380311 GAGTCTCAGCAGAGTTTCTCAGG + Intergenic
1196341029 X:114597690-114597712 ATGCACCATCAGATGTTCTCTGG + Intronic
1197509777 X:127356334-127356356 GGGCCAAGTCAGAGGTTCTCTGG - Intergenic
1199881458 X:151976679-151976701 CTCCCTCATCAGAGATTCCCAGG + Intergenic