ID: 1126352202

View in Genome Browser
Species Human (GRCh38)
Location 15:47755981-47756003
Sequence CACTCACGCCCTGGTTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126352197_1126352202 -3 Left 1126352197 15:47755961-47755983 CCTTCTCCCAAGTATCCTGTCAC 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1126352199_1126352202 -10 Left 1126352199 15:47755968-47755990 CCAAGTATCCTGTCACTCACGCC 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1126352195_1126352202 1 Left 1126352195 15:47755957-47755979 CCTCCCTTCTCCCAAGTATCCTG 0: 1
1: 0
2: 3
3: 27
4: 297
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1126352194_1126352202 8 Left 1126352194 15:47755950-47755972 CCATGTACCTCCCTTCTCCCAAG 0: 1
1: 0
2: 1
3: 34
4: 348
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1126352198_1126352202 -9 Left 1126352198 15:47755967-47755989 CCCAAGTATCCTGTCACTCACGC 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102
1126352196_1126352202 -2 Left 1126352196 15:47755960-47755982 CCCTTCTCCCAAGTATCCTGTCA 0: 1
1: 0
2: 2
3: 20
4: 272
Right 1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126352202 Original CRISPR CACTCACGCCCTGGTTGTTC TGG Intronic
902790547 1:18764940-18764962 GACTCAAGCCCTGGTTACTCTGG - Intergenic
903105642 1:21077315-21077337 CACTCAAGCCCAGGATGTTGAGG + Intronic
903479087 1:23639974-23639996 CACTCTTGCCCTGGGTTTTCAGG + Intronic
904079437 1:27862760-27862782 GACTCAGGCCCTAGTTATTCTGG + Intergenic
911796500 1:102083257-102083279 CCCTCTCGACCTGGTTGTTAAGG - Intergenic
912885710 1:113471362-113471384 CATTGACCCACTGGTTGTTCAGG - Intronic
919978369 1:202627474-202627496 CACTCAGGCCCTGGGTGTCACGG - Intronic
1066204210 10:33171826-33171848 CTTTCACACCCTGCTTGTTCTGG - Intergenic
1071249256 10:83800094-83800116 CATTAACCCACTGGTTGTTCAGG + Intergenic
1072115049 10:92362684-92362706 CACTGACCCACTGGTTATTCAGG + Intergenic
1073042142 10:100615072-100615094 CACTCACCCCCTTGTTCCTCAGG + Intergenic
1077417593 11:2432083-2432105 CACTCACGCCCTGGGTGGAAGGG + Intergenic
1079677660 11:23250910-23250932 CACTGACCCAGTGGTTGTTCGGG + Intergenic
1080448568 11:32359716-32359738 CTCTGAAGCCCTGGTAGTTCTGG - Intergenic
1080996508 11:37608515-37608537 CGCTCACGACCTGGTTGATAGGG + Intergenic
1081750141 11:45504653-45504675 CACACACGCCCTGTTTGTTCTGG - Intergenic
1083251840 11:61473275-61473297 CACTCAAGCCCTGGAGGTTGAGG - Intronic
1083256837 11:61501755-61501777 CACTCAAGATCTGGTTGTTAAGG - Intergenic
1085023963 11:73225878-73225900 CACTCAGGCCCTGGCTGATCTGG - Intronic
1089580226 11:119476975-119476997 CACTACCGCCCTGGCTGTCCAGG - Intergenic
1096602033 12:52736173-52736195 CACTCAAGCCCTGGGTGGCCTGG + Intergenic
1097053499 12:56237276-56237298 CCCTCACTCCCTGGGTGTTTGGG + Exonic
1104991129 12:132624453-132624475 CGCTCACGGCCTGCTTCTTCAGG + Exonic
1106680441 13:32001688-32001710 CTCCCATGGCCTGGTTGTTCTGG + Intergenic
1109747943 13:66650924-66650946 CACTCACCCCCTGGTCATTCAGG - Intronic
1114259696 14:21027232-21027254 CACTTACACCCTGGTTGGGCTGG - Intronic
1114326334 14:21592915-21592937 CACTGACCCACTGGTCGTTCAGG - Intergenic
1115578272 14:34732341-34732363 CTCTGACCCACTGGTTGTTCAGG + Intergenic
1118263876 14:64274852-64274874 CATTGACACACTGGTTGTTCAGG + Intronic
1118927595 14:70206930-70206952 TACACACTCCCTGGGTGTTCTGG + Intergenic
1120394375 14:83950105-83950127 CACTGACTCAATGGTTGTTCAGG + Intergenic
1123878028 15:24644304-24644326 CATTGACTCACTGGTTGTTCAGG - Intergenic
1124493993 15:30175413-30175435 CACTCAGGCCCTGGGTGTCAGGG - Intergenic
1124749576 15:32363233-32363255 CACTCAGGCCCTGGGTGTCAGGG + Intergenic
1126352202 15:47755981-47756003 CACTCACGCCCTGGTTGTTCTGG + Intronic
1129248404 15:74294100-74294122 CATTCCCTCTCTGGTTGTTCAGG + Intronic
1129256079 15:74334893-74334915 GGCTCAGGCCCTGGTTGTCCTGG + Intronic
1132976353 16:2712993-2713015 CACACACACCCTAGTTGATCTGG - Intronic
1138586796 16:57975912-57975934 CACTCACAGCCTGGCTTTTCTGG + Intergenic
1141086216 16:81097077-81097099 GACCCACACCCTGGTTTTTCAGG + Intergenic
1141460224 16:84174198-84174220 CAACCACGCACTGGTTGTTATGG + Intronic
1143323784 17:6085030-6085052 CAGTCAGGCTCTGGTTCTTCTGG - Intronic
1145011251 17:19369536-19369558 CACTCAGGCGCTGGGTGATCTGG - Intronic
1150464611 17:65381467-65381489 CACTCAAGCCCTGGTACTACAGG - Intergenic
1153075024 18:1152829-1152851 CACTGACCCCCTGGTCATTCAGG + Intergenic
1161561081 19:4972780-4972802 CACTCCTCACCTGGTTGTTCAGG + Intronic
1161826559 19:6570584-6570606 CATTGACCCACTGGTTGTTCAGG + Intergenic
1166581198 19:43901671-43901693 CGTTCACGCCCTGGGTCTTCTGG + Intergenic
1167334885 19:48878775-48878797 GGCCCACGCCCTGGTTTTTCAGG + Intergenic
925686113 2:6475696-6475718 CTCCCACGCCCTGGTGGTGCAGG - Intergenic
927171579 2:20375007-20375029 CACTCTCGCCCGGCTTGTCCTGG + Intergenic
932786838 2:74612753-74612775 CATTGACCCACTGGTTGTTCAGG + Intronic
934506935 2:94902222-94902244 CTCTCCCGCCCTGGATGTTATGG + Intergenic
935439346 2:103074045-103074067 CATTGACCCACTGGTTGTTCAGG - Intergenic
935527834 2:104193350-104193372 CACTCACTTCCTGCATGTTCAGG - Intergenic
938055492 2:128211318-128211340 CACTCAGGCCCAGGATGTTGAGG - Intergenic
939503905 2:143020378-143020400 CATTGACTCACTGGTTGTTCAGG + Intronic
940750833 2:157625654-157625676 CACTCTCACCCTGGTTATTAAGG + Intronic
943287568 2:186023075-186023097 CACTGACCAACTGGTTGTTCAGG + Intergenic
944495236 2:200300823-200300845 GACTCACTCCCTTGGTGTTCTGG - Intergenic
945284204 2:208065881-208065903 CAGCCAACCCCTGGTTGTTCTGG + Intergenic
1180027833 21:45178412-45178434 CCCTCATGCCCTAGTGGTTCTGG - Intronic
1180577152 22:16788185-16788207 CATTGACTCACTGGTTGTTCAGG - Intronic
1182422896 22:30257231-30257253 CACTCACTCCCTTGTGGGTCAGG - Intergenic
1184356707 22:43985659-43985681 CATTCACGCGCAGGTTGTTGTGG + Intronic
1184549173 22:45195358-45195380 AACTCTTCCCCTGGTTGTTCTGG - Intronic
950498336 3:13347860-13347882 CAATCAGGCCCTGGTTCCTCTGG - Intronic
956476395 3:69625032-69625054 CATTGATGCACTGGTTGTTCAGG - Intergenic
956911978 3:73827600-73827622 TAATCAAGCCCTGGTTGTTTGGG + Intergenic
960995270 3:123336294-123336316 CACCCACTCCATAGTTGTTCTGG + Intronic
964880643 3:161419316-161419338 CATTCTGGCCCTGGTTGGTCGGG + Intergenic
970754020 4:19402150-19402172 CTCTCAAGCCCTTGCTGTTCAGG + Intergenic
972415506 4:38835862-38835884 CATTCACCCAGTGGTTGTTCAGG - Intronic
974712106 4:65611501-65611523 CAATTACACCCTTGTTGTTCTGG + Intronic
977307723 4:95345744-95345766 CATTGACCCACTGGTTGTTCAGG - Intronic
979218805 4:118197090-118197112 CATTTACCCACTGGTTGTTCAGG + Intronic
984540947 4:181036132-181036154 CACACACCCCCTGGTTTTTCAGG + Intergenic
991224189 5:64250205-64250227 CACTAACCCATTGGTTGTTCAGG - Intronic
996137207 5:119858039-119858061 CATTGACCCACTGGTTGTTCGGG + Intergenic
998043346 5:138967461-138967483 CCCTCACGGCCTGGGTCTTCTGG - Intronic
1004222762 6:13760443-13760465 GACTCACACCCAGGTCGTTCTGG - Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006376973 6:33677074-33677096 CACTCACGCCCTTGACGATCTGG - Exonic
1006734661 6:36264551-36264573 CACTCCCTCCCTGGTTCTCCTGG + Intronic
1007237753 6:40403286-40403308 CACTCAGGCCCTGGTGCTTAGGG - Intronic
1009967239 6:70590575-70590597 GACTCACACCCTGGTTTTTCAGG + Intergenic
1013110595 6:107061863-107061885 CACCCACGCCCTGGCTGCTGAGG + Intergenic
1017562109 6:155639232-155639254 CAGTGACCCCCTGGTTTTTCAGG - Intergenic
1022989689 7:35695166-35695188 CACTTCCGCCCTGCCTGTTCCGG - Intronic
1023623272 7:42093545-42093567 CACACATGCTGTGGTTGTTCTGG + Intronic
1027399704 7:77794953-77794975 CACTCTTGCCCTGGCTGGTCTGG - Intronic
1030987718 7:116262031-116262053 CACTGACGTCCTTGTGGTTCTGG + Intergenic
1031532128 7:122887437-122887459 CACTCAGTCGCTGGTGGTTCTGG + Intergenic
1035017024 7:155775579-155775601 CACTCACACCCTGGCTTTCCAGG - Exonic
1046318107 8:112534003-112534025 CACTGACCCATTGGTTGTTCAGG - Intronic
1047218475 8:122898933-122898955 CACTCCCGGCCTTGTTCTTCTGG + Intronic
1050084063 9:1945953-1945975 CTCTCAGGTCCTGGTTGCTCAGG - Intergenic
1053169140 9:35866246-35866268 CCCTCACCCCCGTGTTGTTCAGG + Intergenic
1054955550 9:70905825-70905847 CACTCGAGCCCAGGTTGTTGAGG - Intronic
1055683957 9:78750129-78750151 CTCTCACCAACTGGTTGTTCAGG + Intergenic
1056940297 9:90949770-90949792 TTCTCACGTCCTGTTTGTTCAGG - Intergenic
1057445724 9:95113086-95113108 CACACCCTCCCTGGTTGTCCTGG - Intronic
1060142143 9:121219552-121219574 GACCCACACCCTGGTTTTTCAGG - Intronic
1061850289 9:133410911-133410933 CACTCACGCCCTTGCTGTGTTGG - Intronic
1187623854 X:21089111-21089133 CATTAACCCACTGGTTGTTCAGG - Intergenic
1188420957 X:29990602-29990624 CATTGACTCACTGGTTGTTCAGG + Intergenic
1190657857 X:52627746-52627768 CACTCAAGCACTGGCTTTTCAGG - Intergenic
1195466133 X:105181564-105181586 CACTAACACAGTGGTTGTTCAGG + Intronic
1196436163 X:115676514-115676536 CACTCATGCCATGGTGGTTCTGG - Intergenic