ID: 1126352226

View in Genome Browser
Species Human (GRCh38)
Location 15:47756244-47756266
Sequence AGGGGCATTCTTAGAGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126352226_1126352229 -7 Left 1126352226 15:47756244-47756266 CCTTATCCTCTAAGAATGCCCCT 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1126352229 15:47756260-47756282 TGCCCCTGTCATTGTTTGGATGG 0: 1
1: 0
2: 0
3: 3
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126352226 Original CRISPR AGGGGCATTCTTAGAGGATA AGG (reversed) Intronic
901479012 1:9511385-9511407 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
902390414 1:16101044-16101066 AGTGGCATTGTTAGACCATATGG - Intergenic
903932664 1:26872512-26872534 AGGGGGATTCTGAGAGGAGGGGG - Intergenic
903982450 1:27199175-27199197 AGGGGACTTCTGAGAGGAAAAGG + Intergenic
905591080 1:39164384-39164406 AGGGCCATCCCTAGAGGACAAGG - Intronic
906441935 1:45854818-45854840 AGGGGCAATCTTATGGGACAGGG - Intronic
906838675 1:49111572-49111594 AGAGACATACTTAGATGATATGG - Intronic
907464272 1:54624600-54624622 AGAGGCATTAGTAGAGGAAAGGG + Intronic
911181243 1:94862652-94862674 ACGGGCAGTGTTAGAGGGTAAGG - Intronic
911467154 1:98270211-98270233 AGTGGAAATTTTAGAGGATAGGG + Intergenic
913036786 1:114974852-114974874 AGTGGGATTCTTAGATCATATGG + Intronic
914464796 1:147917339-147917361 CGGGGCAGTCTGAGAGAATACGG - Intergenic
916743858 1:167669429-167669451 AGGCCCATTCTCAGAGGATCAGG - Intronic
919286155 1:195562932-195562954 AGTGGGATTGTTAGATGATATGG - Intergenic
919574061 1:199284679-199284701 AGAGGCAATGTTAGAGGATTGGG - Intergenic
921459312 1:215410235-215410257 TGGGGCAGTCTTATAGGATTTGG + Intergenic
1065100978 10:22333713-22333735 AGGGACATTTTTAAAGGCTAGGG - Intergenic
1065235923 10:23652127-23652149 AGGTGAATTCTTAGAAGATCAGG - Intergenic
1065421002 10:25543994-25544016 AGAGGCATTCTTAAAGGTAAAGG + Intronic
1065705527 10:28468757-28468779 AGAGGCAGTCTCAGAGGATGCGG - Intergenic
1070468259 10:76747667-76747689 AGGGGCATTAGTGGAGGCTAAGG + Intergenic
1072152848 10:92696895-92696917 AGGGGCCTTCTTAGAATCTAAGG - Intergenic
1072263765 10:93707369-93707391 TGGGGCATTCTTAAATGCTAGGG + Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1078346685 11:10555908-10555930 AGGGGCATTCTGAAAGGGCAGGG + Intergenic
1080101883 11:28468730-28468752 AGGGGCATTCATACAGGCCATGG + Intergenic
1080948442 11:37001360-37001382 ATGGTCATTCTTAGAAAATACGG - Intergenic
1081144703 11:39548310-39548332 ATAGCCATTCTTAGAGGAGAAGG - Intergenic
1083777628 11:64902048-64902070 AGGGTCATGCTCAGAGGAGAAGG - Exonic
1084169749 11:67395412-67395434 ATGGGTATCCTTAGAGGATAAGG + Intronic
1085015870 11:73173790-73173812 AGGAGTATCCCTAGAGGATAGGG - Intergenic
1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG + Intronic
1088084895 11:105965596-105965618 ATTGGCATTCTTAGAGGCAAAGG + Intronic
1090756012 11:129792620-129792642 AGTGGCATCCTTACAGGACAAGG + Intergenic
1091971928 12:4794535-4794557 ATGGGCATTCTTACAGGAAAAGG - Intronic
1096750162 12:53753498-53753520 AGGAGGGTTCCTAGAGGATAGGG + Intergenic
1096975174 12:55695658-55695680 AGGGGCATTCCTAGGGGGCAAGG + Intronic
1097922208 12:65088385-65088407 GGGGCCAGTCTCAGAGGATATGG - Intronic
1106543064 13:30707174-30707196 AGGGTCAGTCTTAGTTGATATGG + Intergenic
1109316169 13:60752604-60752626 TTTGGCATTCTTAGAGAATAAGG - Intergenic
1110028860 13:70579550-70579572 AGGGTCTTTCTTAGAGCAAAAGG - Intergenic
1111849161 13:93550213-93550235 ACAGACATTCTTGGAGGATAGGG - Intronic
1112402947 13:99091526-99091548 GGAGACATTCTTAGAGGAAATGG + Intergenic
1113535524 13:111063280-111063302 AGGGGCAGTTTTACAGGATTTGG - Intergenic
1116124336 14:40762797-40762819 AGGAGCATGCTAAGAGGAAAAGG - Intergenic
1117816683 14:59606204-59606226 AGGTGCAGTCTTAGAGCAGAGGG - Intronic
1118459498 14:65975749-65975771 AAGGGCATGATTTGAGGATACGG + Intronic
1121900658 14:97690666-97690688 AGGCTCATTCTTCAAGGATAAGG + Intergenic
1123775003 15:23570510-23570532 AGGGACATTTTTAGAATATATGG + Intronic
1124089306 15:26582825-26582847 AGGGACATTGTTAGATGTTATGG + Intronic
1125418038 15:39473959-39473981 AGTGGCCTTCTAAGAGGAAAGGG + Intergenic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1129605922 15:77024982-77025004 AGCTGCATTCTTAGAGAAGAGGG - Intronic
1130442932 15:83973590-83973612 TAGGGCATTCTTAGAAAATAGGG - Intronic
1133447766 16:5876904-5876926 TGGGGCTTTCATGGAGGATATGG + Intergenic
1133451462 16:5907278-5907300 AGGGGCATGCACAGAGGATGAGG - Intergenic
1134237674 16:12480421-12480443 AGGGGAATTCTAAGAGGAAGAGG - Intronic
1134337109 16:13310518-13310540 AGGGGCATTCTAAGTCAATAAGG + Intergenic
1135230215 16:20699307-20699329 TGGGGCATTGTTAGAGAATGAGG + Intronic
1137639233 16:50013824-50013846 AGGAGGCTTCTTAGAGGACATGG - Intergenic
1138354345 16:56365638-56365660 AGGGTCAGGCTTAGAGGAGAGGG - Intronic
1138532606 16:57643033-57643055 AGGGAGATTCTAAGAGGAGAGGG - Intronic
1139587556 16:67913903-67913925 AGGGACAGTCTTAGAGAAGAGGG + Intronic
1140247494 16:73264359-73264381 AGGGGAATGAGTAGAGGATATGG - Intergenic
1140312396 16:73862277-73862299 AGGGGACTTATTAAAGGATATGG - Intergenic
1142781916 17:2187911-2187933 AAGGGCAGCCTTAAAGGATATGG + Intronic
1143130753 17:4675506-4675528 AGGGTCTATTTTAGAGGATAGGG - Intronic
1147808255 17:43147850-43147872 AGGGGCCTTCTTGGAGGCTTTGG - Intergenic
1148169839 17:45509764-45509786 AGGGGCCTTCTTGGAGGCTCTGG - Intergenic
1148279370 17:46336044-46336066 AGGGGCCTTCTTGGAGGCTCTGG + Intronic
1148301587 17:46553899-46553921 AGGGGCCTTCTTGGAGGCTCTGG + Intronic
1148365520 17:47052901-47052923 AGGGGCCTTCTTGGAGGCTCTGG + Intergenic
1148678492 17:49459070-49459092 AGGGGCCTTCCTAGAGGAGAAGG + Intronic
1149045189 17:52236712-52236734 AGAGGCATATTTAGATGATAGGG - Intergenic
1149326363 17:55534401-55534423 AGGGCTGTTCTTAGAGGAGAAGG + Intergenic
1150400920 17:64855362-64855384 AGGGGCCTTCTTGGAGGCTCTGG - Intronic
1150537762 17:66061399-66061421 AGGGGGATTGTTAGATCATATGG - Intronic
1153146731 18:2041573-2041595 AGGAGCATTATTAGAGGAGGTGG - Intergenic
1153499189 18:5730892-5730914 AGGGTCAGTCTTAGAGGGTCAGG - Intergenic
1157939027 18:51906265-51906287 AGGGTCATTCTTACATGATTGGG - Intergenic
1162829711 19:13276655-13276677 GGGGGCATTCTTGGAGGCTCAGG + Intronic
1165182123 19:33980502-33980524 AGAGGCATTCTCAGTGAATAAGG + Intergenic
1167847730 19:52178261-52178283 TGGGGCAGTCTTATAGGATTTGG - Intergenic
925966153 2:9068294-9068316 AGGGGGATTCTAAGGGGAGAGGG - Intergenic
926785667 2:16516113-16516135 ATGGGCTTTCTTAGGGGGTAGGG - Intergenic
927053166 2:19349406-19349428 AGGGGCATTCTGAGAGGGCCAGG + Intergenic
930152910 2:48076756-48076778 AGGCCCATTCCTAGATGATATGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935505493 2:103896393-103896415 AGTGACATTCTTACAGCATATGG + Intergenic
936513117 2:113164522-113164544 AGGGGCATTGTTAGAGAATGGGG + Intronic
937315458 2:120929333-120929355 GGGGTAATACTTAGAGGATATGG + Intronic
938096803 2:128469517-128469539 AAGGGCTTTCTTGGAGGAAAAGG - Intergenic
940069226 2:149666148-149666170 AGGGGAATTCTGAGAGGCTAAGG - Intergenic
942518099 2:176774369-176774391 GGGGGAATGCTTAGAGGATGTGG + Intergenic
942521440 2:176808601-176808623 AGGCTCATTCTTAGAGGAATAGG - Intergenic
944248636 2:197558848-197558870 AGTGGGATTATTAGAGCATATGG + Intergenic
945879814 2:215313457-215313479 AGTGGCATTCTGGGAGGAGAGGG + Intronic
946140903 2:217689921-217689943 AGGAGGATTCGAAGAGGATATGG + Intronic
947628484 2:231636364-231636386 AGGGGCTTTTTTAAAGAATAGGG - Intergenic
1170206602 20:13805454-13805476 AGGCTCATTTTTAGAGAATATGG - Intronic
1170936256 20:20812430-20812452 AGGGGACTTCCTAGAGGAAAAGG - Intergenic
1171542661 20:25976375-25976397 AGGGGCCTGCTTAGAGGGTGTGG + Intergenic
1175272511 20:57744612-57744634 AGGGGCATTCTTACAAGTTGGGG + Intergenic
1184648811 22:45910312-45910334 AGGGGCATCCTTGGAGGTTTTGG + Intergenic
1184823701 22:46932669-46932691 TGTGGCATTCTCTGAGGATAGGG + Intronic
949379071 3:3424365-3424387 AGGGGAATTCTTCCAGGAGAAGG + Intergenic
955788180 3:62561629-62561651 AAGGGCAATCTTAGAGGTTATGG - Intronic
959663904 3:108900602-108900624 AGGGTCATTCTAAGAGCATGGGG + Intergenic
959866243 3:111273659-111273681 AGGGTCAATATAAGAGGATATGG - Intronic
961096041 3:124157856-124157878 AGGGGCATTCGCAGGGGAAAGGG - Intronic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
962387185 3:134941112-134941134 TTGGGCATTCTTAGAGGAGCGGG + Intronic
963045818 3:141101955-141101977 AGGAGCATTCCTGGAGGAAAGGG - Intronic
965411325 3:168335244-168335266 AGGGGTTTTGTTGGAGGATATGG + Intergenic
967065462 3:185911325-185911347 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967074738 3:185991807-185991829 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
970738703 4:19206217-19206239 AGGTGCATTCTTAGTGCATAAGG - Intergenic
972699219 4:41477718-41477740 AGGACCATTGATAGAGGATAGGG + Intronic
972935319 4:44127728-44127750 AGGGGCATTTTTAGAAGGAAAGG - Intergenic
976984197 4:91272286-91272308 ATGGCCATTCTTGCAGGATAAGG + Intronic
977489681 4:97696836-97696858 ATGGGCATTCTTGCAGGAGAAGG - Intronic
978733610 4:112060484-112060506 AGGGGCTTTCTTGAAGGATCAGG + Intergenic
981513972 4:145587429-145587451 ATGGGAATTCTTAGAAGAAAAGG + Intergenic
983736849 4:171072351-171072373 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
989039411 5:37211659-37211681 GGGGGCATTCTGTCAGGATAAGG - Intronic
989134551 5:38140667-38140689 GGAGGCATTCTCAGAGGATGGGG - Intergenic
989327397 5:40215049-40215071 AGAGGCATTATTAGAATATATGG + Intergenic
989764397 5:45063212-45063234 AGTAGAATTCCTAGAGGATAGGG + Intergenic
996707917 5:126515508-126515530 AGAGGCATGATTAGAGGATTGGG + Intergenic
1000402512 5:160845910-160845932 TGGGGCATTCATATAAGATAGGG - Intronic
1001859110 5:175037686-175037708 ATGGGCTTTCTCAGAGGATCAGG + Intergenic
1003752732 6:9079292-9079314 AAGGGCATTCATGGAGGACAGGG - Intergenic
1005306395 6:24518102-24518124 AGGGGAATTCCTAGAGGAAAAGG - Intronic
1008058867 6:46975484-46975506 AGGGGAATACTTCAAGGATAGGG + Intergenic
1008066986 6:47060669-47060691 AAGGGCATTCTGAGAAGAAATGG - Intergenic
1008293572 6:49749925-49749947 AGGGGCATTATCAGATAATATGG + Intergenic
1008328475 6:50216434-50216456 AGTGGTATTGTAAGAGGATAGGG + Intergenic
1008559540 6:52710268-52710290 AGTGGCATTGTTACAGGAAAGGG - Intergenic
1008682645 6:53890240-53890262 AATAGCATTCTTAGAGGAGAAGG + Intronic
1008849595 6:56009051-56009073 AAGGTCATTACTAGAGGATAAGG - Intergenic
1008927919 6:56906675-56906697 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1010673187 6:78711104-78711126 AGGGGAATTTTTACAGCATAAGG + Intergenic
1014258982 6:119194684-119194706 AGGGGCAGTCAGAAAGGATATGG + Intronic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1016871618 6:148823359-148823381 AAAGGCATTCTTAGAGCAAAGGG - Intronic
1017233766 6:152098846-152098868 AGGGGCATCCGTGGAGGAGACGG + Exonic
1017565094 6:155675279-155675301 AAGTACATTCTTAGAGGATAGGG + Intergenic
1020330805 7:7015160-7015182 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
1020836282 7:13155902-13155924 AGAGGCAGACTTAGAGGACATGG + Intergenic
1022380306 7:29853258-29853280 AGGGGAACTCCTAGAGGAGAAGG - Intronic
1024103406 7:46056845-46056867 AGGGGCAGTCTTATGGGATTGGG + Intergenic
1030370031 7:108688707-108688729 AGTGGCATTGTTGGATGATATGG + Intergenic
1030541305 7:110833513-110833535 AGGGGCATTCTTAGACCATCTGG + Intronic
1032287735 7:130554930-130554952 AGAGGCATACTGAGATGATAAGG + Intronic
1037111559 8:15169091-15169113 GGGGCCATTGTTAGAGGCTATGG - Intronic
1038323224 8:26548470-26548492 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1039986692 8:42453752-42453774 AGGGGCTTGCCTAGAGGAGAAGG - Intronic
1041176764 8:55204917-55204939 AGGGGCACTGTTAGATGACATGG + Intronic
1041311913 8:56525845-56525867 AGGGCAATTCTTTGAGGACAGGG - Intergenic
1042246842 8:66716601-66716623 AGGGGAATTGTTAGAGGATGAGG + Intronic
1050115499 9:2259246-2259268 AGGGGCACTCTTAGAACATTTGG - Intergenic
1053083234 9:35194924-35194946 AGGGGAATTCTGAGAGCAAAAGG + Intronic
1053194868 9:36109414-36109436 AGAAACATTCTTAGAGGATAGGG + Intronic
1053536458 9:38931359-38931381 AGTGGCATTGTTAGATGATACGG + Intergenic
1053601662 9:39617126-39617148 AGGGGCAATCTTAGAGAAGTTGG - Intergenic
1053859310 9:42370893-42370915 AGGGGCAATCTTAGAGAAGTTGG - Intergenic
1054251873 9:62725320-62725342 AGGGGCAATCTTAGAGAAGTTGG + Intergenic
1054565986 9:66759821-66759843 AGGGGCAATCTTAGAGAAGTTGG + Intergenic
1054629676 9:67432589-67432611 AGTGGCATTGTTAGATGATACGG - Intergenic
1059557636 9:115297340-115297362 ATGTGCTTTCTCAGAGGATAGGG - Intronic
1060035440 9:120251676-120251698 AGGGGAATTCCTAGAAGAAAGGG - Intergenic
1061103325 9:128509559-128509581 AGGGGTCTTCTGAGAGGAAATGG - Intronic
1061335961 9:129936308-129936330 GAGTGCATTCTTAGAGGAAAGGG - Intronic
1186869941 X:13761117-13761139 AGGGGCATTCTGTCAGGACAAGG - Exonic
1190810671 X:53880491-53880513 AGGGGAATTATTAGCGGAAAAGG + Intergenic
1191668938 X:63731209-63731231 GGGGGCCTTCTGAGAGGATACGG - Intronic
1194011457 X:88567381-88567403 TGGGGCATTCTCAGAGGAGTAGG + Intergenic
1196394924 X:115249327-115249349 AAGGGCTTTTTTAGTGGATATGG - Intergenic
1197613304 X:128663166-128663188 AGATGCATTCTGAGAGGATTTGG - Intergenic
1199712922 X:150484423-150484445 AGGGCAATTCATAGAGCATAAGG - Intronic
1199977453 X:152902767-152902789 AGGGGCAGTGTTAGAGGTAAGGG + Intergenic
1200007149 X:153094677-153094699 AGGGGCAGTCTTATAGGACTTGG + Intergenic
1200008094 X:153101159-153101181 AGGGGCAGTCTTAAAGGACTTGG + Intergenic