ID: 1126357917

View in Genome Browser
Species Human (GRCh38)
Location 15:47815689-47815711
Sequence GCTCCTATCCTCCTGCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126357914_1126357917 21 Left 1126357914 15:47815645-47815667 CCAGTAAGAGATAGGAGGCAGAA No data
Right 1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG No data
1126357916_1126357917 -7 Left 1126357916 15:47815673-47815695 CCAACAGGAAAACTCTGCTCCTA No data
Right 1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG No data
1126357912_1126357917 26 Left 1126357912 15:47815640-47815662 CCTGGCCAGTAAGAGATAGGAGG No data
Right 1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126357917 Original CRISPR GCTCCTATCCTCCTGCTGAC AGG Intergenic
No off target data available for this crispr