ID: 1126360272

View in Genome Browser
Species Human (GRCh38)
Location 15:47838392-47838414
Sequence CTATGTATTTACATTTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126360269_1126360272 8 Left 1126360269 15:47838361-47838383 CCTGCTTCATCTGTACTGAGTTC No data
Right 1126360272 15:47838392-47838414 CTATGTATTTACATTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126360272 Original CRISPR CTATGTATTTACATTTATCT GGG Intergenic
No off target data available for this crispr