ID: 1126363523

View in Genome Browser
Species Human (GRCh38)
Location 15:47870663-47870685
Sequence CAGTGATGATAGGAGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126363523_1126363526 -9 Left 1126363523 15:47870663-47870685 CCCTAATACTCCTATCATCACTG No data
Right 1126363526 15:47870677-47870699 TCATCACTGAAGATCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126363523 Original CRISPR CAGTGATGATAGGAGTATTA GGG (reversed) Intergenic
No off target data available for this crispr