ID: 1126365440

View in Genome Browser
Species Human (GRCh38)
Location 15:47889507-47889529
Sequence CTGTGGAGATAGAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126365434_1126365440 8 Left 1126365434 15:47889476-47889498 CCCCCAGAGCTAAAAATTAAAAC No data
Right 1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG No data
1126365435_1126365440 7 Left 1126365435 15:47889477-47889499 CCCCAGAGCTAAAAATTAAAACA No data
Right 1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG No data
1126365437_1126365440 5 Left 1126365437 15:47889479-47889501 CCAGAGCTAAAAATTAAAACAAC No data
Right 1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG No data
1126365436_1126365440 6 Left 1126365436 15:47889478-47889500 CCCAGAGCTAAAAATTAAAACAA No data
Right 1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG No data
1126365433_1126365440 9 Left 1126365433 15:47889475-47889497 CCCCCCAGAGCTAAAAATTAAAA No data
Right 1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126365440 Original CRISPR CTGTGGAGATAGAGAGTAGA AGG Intergenic
No off target data available for this crispr