ID: 1126365997

View in Genome Browser
Species Human (GRCh38)
Location 15:47895088-47895110
Sequence TGTGCTATCAATTAATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126365996_1126365997 -5 Left 1126365996 15:47895070-47895092 CCAGTGTGGATATATGGATGTGC No data
Right 1126365997 15:47895088-47895110 TGTGCTATCAATTAATAGCCTGG No data
1126365992_1126365997 9 Left 1126365992 15:47895056-47895078 CCAATAAGCCATGGCCAGTGTGG No data
Right 1126365997 15:47895088-47895110 TGTGCTATCAATTAATAGCCTGG No data
1126365994_1126365997 1 Left 1126365994 15:47895064-47895086 CCATGGCCAGTGTGGATATATGG No data
Right 1126365997 15:47895088-47895110 TGTGCTATCAATTAATAGCCTGG No data
1126365990_1126365997 29 Left 1126365990 15:47895036-47895058 CCTGATTAAATCAGGGATCTCCA No data
Right 1126365997 15:47895088-47895110 TGTGCTATCAATTAATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126365997 Original CRISPR TGTGCTATCAATTAATAGCC TGG Intergenic
No off target data available for this crispr