ID: 1126367295

View in Genome Browser
Species Human (GRCh38)
Location 15:47908304-47908326
Sequence CTGCCTTTGCAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126367292_1126367295 -2 Left 1126367292 15:47908283-47908305 CCATGAGATTCAGGGTGGAAGCT No data
Right 1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG No data
1126367291_1126367295 -1 Left 1126367291 15:47908282-47908304 CCCATGAGATTCAGGGTGGAAGC No data
Right 1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126367295 Original CRISPR CTGCCTTTGCAGAGGGAAGC TGG Intergenic
No off target data available for this crispr