ID: 1126374679

View in Genome Browser
Species Human (GRCh38)
Location 15:47985291-47985313
Sequence TATCCACAGCTGCTGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126374679_1126374683 5 Left 1126374679 15:47985291-47985313 CCTGGCTGCAGCAGCTGTGGATA No data
Right 1126374683 15:47985319-47985341 TGTCCACCTGCATTCTCAAGGGG No data
1126374679_1126374681 3 Left 1126374679 15:47985291-47985313 CCTGGCTGCAGCAGCTGTGGATA No data
Right 1126374681 15:47985317-47985339 CCTGTCCACCTGCATTCTCAAGG No data
1126374679_1126374682 4 Left 1126374679 15:47985291-47985313 CCTGGCTGCAGCAGCTGTGGATA No data
Right 1126374682 15:47985318-47985340 CTGTCCACCTGCATTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126374679 Original CRISPR TATCCACAGCTGCTGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr