ID: 1126377964

View in Genome Browser
Species Human (GRCh38)
Location 15:48015129-48015151
Sequence TTCCAACTCCAGTAGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126377960_1126377964 12 Left 1126377960 15:48015094-48015116 CCTGTTGACCAAACCAAAGAAAT No data
Right 1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG No data
1126377961_1126377964 4 Left 1126377961 15:48015102-48015124 CCAAACCAAAGAAATTAAAAATG No data
Right 1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG No data
1126377962_1126377964 -1 Left 1126377962 15:48015107-48015129 CCAAAGAAATTAAAAATGTACCT No data
Right 1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126377964 Original CRISPR TTCCAACTCCAGTAGCTATA AGG Intergenic
No off target data available for this crispr