ID: 1126380631

View in Genome Browser
Species Human (GRCh38)
Location 15:48043165-48043187
Sequence TAGTGAATATAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126380631_1126380636 16 Left 1126380631 15:48043165-48043187 CCCTGCTCCTTCTATATTCACTA No data
Right 1126380636 15:48043204-48043226 CCACAATTTCTACCAAAAGAGGG No data
1126380631_1126380634 15 Left 1126380631 15:48043165-48043187 CCCTGCTCCTTCTATATTCACTA No data
Right 1126380634 15:48043203-48043225 ACCACAATTTCTACCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126380631 Original CRISPR TAGTGAATATAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr