ID: 1126381556

View in Genome Browser
Species Human (GRCh38)
Location 15:48052959-48052981
Sequence TGACTTAAGCAGCTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126381556_1126381563 26 Left 1126381556 15:48052959-48052981 CCCAGCTCAAGCTGCTTAAGTCA No data
Right 1126381563 15:48053008-48053030 CCTCTGCTTTTTTGTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126381556 Original CRISPR TGACTTAAGCAGCTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr