ID: 1126382568

View in Genome Browser
Species Human (GRCh38)
Location 15:48064501-48064523
Sequence TTTACTCCGTGTCCAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126382568_1126382570 -4 Left 1126382568 15:48064501-48064523 CCACCTCTTGGACACGGAGTAAA No data
Right 1126382570 15:48064520-48064542 TAAATAAAGTCCTCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126382568 Original CRISPR TTTACTCCGTGTCCAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr