ID: 1126382570

View in Genome Browser
Species Human (GRCh38)
Location 15:48064520-48064542
Sequence TAAATAAAGTCCTCTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126382568_1126382570 -4 Left 1126382568 15:48064501-48064523 CCACCTCTTGGACACGGAGTAAA No data
Right 1126382570 15:48064520-48064542 TAAATAAAGTCCTCTTCTCAAGG No data
1126382569_1126382570 -7 Left 1126382569 15:48064504-48064526 CCTCTTGGACACGGAGTAAATAA No data
Right 1126382570 15:48064520-48064542 TAAATAAAGTCCTCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126382570 Original CRISPR TAAATAAAGTCCTCTTCTCA AGG Intergenic
No off target data available for this crispr