ID: 1126384761

View in Genome Browser
Species Human (GRCh38)
Location 15:48082853-48082875
Sequence CTCAAACAAAGGTGTCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126384761_1126384764 5 Left 1126384761 15:48082853-48082875 CCTTGGAGACACCTTTGTTTGAG No data
Right 1126384764 15:48082881-48082903 GAAAAAAGAAGAGCTGGTAAAGG No data
1126384761_1126384763 -1 Left 1126384761 15:48082853-48082875 CCTTGGAGACACCTTTGTTTGAG No data
Right 1126384763 15:48082875-48082897 GAAGAAGAAAAAAGAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126384761 Original CRISPR CTCAAACAAAGGTGTCTCCA AGG (reversed) Intergenic
No off target data available for this crispr