ID: 1126387921

View in Genome Browser
Species Human (GRCh38)
Location 15:48112878-48112900
Sequence CTGGCTGGGGCCGGTGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126387921_1126387930 12 Left 1126387921 15:48112878-48112900 CCCATAACACCGGCCCCAGCCAG No data
Right 1126387930 15:48112913-48112935 CAAACTCAGTGTGTTATTACAGG No data
1126387921_1126387931 13 Left 1126387921 15:48112878-48112900 CCCATAACACCGGCCCCAGCCAG No data
Right 1126387931 15:48112914-48112936 AAACTCAGTGTGTTATTACAGGG No data
1126387921_1126387932 21 Left 1126387921 15:48112878-48112900 CCCATAACACCGGCCCCAGCCAG No data
Right 1126387932 15:48112922-48112944 TGTGTTATTACAGGGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126387921 Original CRISPR CTGGCTGGGGCCGGTGTTAT GGG (reversed) Intergenic
No off target data available for this crispr