ID: 1126395595

View in Genome Browser
Species Human (GRCh38)
Location 15:48213202-48213224
Sequence AAGGGAAAGCAGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 659}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126395595_1126395600 17 Left 1126395595 15:48213202-48213224 CCATCCTCAGTCTGCTTTCCCTT 0: 1
1: 0
2: 2
3: 68
4: 659
Right 1126395600 15:48213242-48213264 CATTCAACAGCTGTAGAGAATGG 0: 1
1: 0
2: 0
3: 19
4: 192
1126395595_1126395603 28 Left 1126395595 15:48213202-48213224 CCATCCTCAGTCTGCTTTCCCTT 0: 1
1: 0
2: 2
3: 68
4: 659
Right 1126395603 15:48213253-48213275 TGTAGAGAATGGTGGGACTCAGG 0: 1
1: 0
2: 1
3: 9
4: 196
1126395595_1126395601 20 Left 1126395595 15:48213202-48213224 CCATCCTCAGTCTGCTTTCCCTT 0: 1
1: 0
2: 2
3: 68
4: 659
Right 1126395601 15:48213245-48213267 TCAACAGCTGTAGAGAATGGTGG 0: 1
1: 0
2: 0
3: 5
4: 176
1126395595_1126395602 21 Left 1126395595 15:48213202-48213224 CCATCCTCAGTCTGCTTTCCCTT 0: 1
1: 0
2: 2
3: 68
4: 659
Right 1126395602 15:48213246-48213268 CAACAGCTGTAGAGAATGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126395595 Original CRISPR AAGGGAAAGCAGACTGAGGA TGG (reversed) Intronic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
900858497 1:5205723-5205745 AAGGGAAAGGAAAGAGAGGAAGG + Intergenic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902647092 1:17807201-17807223 AGGGGAATGAAGACTGCGGATGG - Intronic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904585108 1:31575927-31575949 AAGGGAAGGCAGACTCAACAAGG + Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
905303374 1:37000734-37000756 AAGGGAAAGGAGACTGAATTTGG - Intronic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905499957 1:38428359-38428381 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
905857037 1:41321024-41321046 ATGGGAAGGCGGACAGAGGAGGG - Intergenic
905968307 1:42117783-42117805 AGAGGAGAGCAGACTGGGGACGG + Intergenic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907872612 1:58456536-58456558 TAGGGAAGGCTGAGTGAGGACGG + Intronic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
909014896 1:70370691-70370713 AAGTGAAAGCAAACAGAGGCTGG - Intronic
909059390 1:70862770-70862792 ACAGGAAAGCTTACTGAGGATGG + Intronic
909509520 1:76436267-76436289 AAAGGACAGCTGATTGAGGATGG + Intronic
909974495 1:82029430-82029452 AAGGGAGAGCAGGCTGAGAGAGG + Intergenic
911496937 1:98643244-98643266 AAGGGAATGCAGAATGGGTATGG + Intergenic
914196449 1:145450459-145450481 ACGGGAAGGCAGACGGAGGCAGG + Intergenic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
916700042 1:167282698-167282720 AAGGGAAAGCAGTATTATGAGGG - Intronic
917205561 1:172567393-172567415 AAGAGAAGGAATACTGAGGAAGG - Intronic
917539565 1:175899690-175899712 AAGGTAAAGGAGACAGAGGGAGG + Intergenic
917679863 1:177354839-177354861 GAGGGAAAGAAGTCTGAGAATGG + Intergenic
917781882 1:178406008-178406030 TGGGGAAAGGACACTGAGGAGGG - Intronic
919935679 1:202249038-202249060 AATGGAGATCAGCCTGAGGAAGG - Intronic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920077703 1:203349260-203349282 AAGGGAAAGCAGCTTGAGGTAGG + Intronic
920250643 1:204620139-204620161 AAGAGAAGGCATATTGAGGAGGG - Exonic
920274788 1:204796087-204796109 AAGGCAAAGAAAACTGAAGAAGG + Intergenic
920458275 1:206117194-206117216 GAGGGAAAGAAGGCTGGGGAGGG + Exonic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
922933487 1:229407662-229407684 TGGGGAAAGCAGTCTGTGGAGGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
924562980 1:245172403-245172425 TAGTGAGAGAAGACTGAGGAAGG + Intronic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1063443836 10:6095561-6095583 CAGGGAAAGCAGACTGTCCAGGG - Intronic
1063630820 10:7732208-7732230 AAGGCAAAGCCTACGGAGGAAGG - Intronic
1063878464 10:10506520-10506542 AAGGGAAAACAGATTGGGGTAGG - Intergenic
1064669326 10:17693428-17693450 AAAGCAAAGAATACTGAGGAGGG - Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066405276 10:35112442-35112464 AAGGGAACCCAGACAGAGCATGG + Intergenic
1066408265 10:35141075-35141097 AAGGAAAAGGAGACTCAGGGAGG - Intronic
1066604511 10:37147727-37147749 AAGGGAATGAAGACTAAAGAAGG + Intronic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069550797 10:69362691-69362713 AAGGGAAGGCTGCCTCAGGAAGG - Intronic
1069606517 10:69742187-69742209 GAGGGAAAGGAGGCTGGGGAGGG + Intergenic
1069898198 10:71691895-71691917 ATGGGTACGAAGACTGAGGAAGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070286486 10:75087462-75087484 AAGGGAAAGGGTTCTGAGGAGGG + Intergenic
1071751521 10:88482898-88482920 AAGGGAAGGAAAACTGAGCAGGG - Intronic
1071805840 10:89119893-89119915 GAGTGAAAGGAGAGTGAGGAGGG - Intergenic
1072241321 10:93497761-93497783 GAGGGAAGGCATGCTGAGGAAGG + Intronic
1072278081 10:93842200-93842222 CAGGGTAAGCAGGCTTAGGATGG - Intergenic
1073926433 10:108521593-108521615 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1075093379 10:119455838-119455860 AAGGAAGAGCAGACAGAGGTGGG - Intronic
1075258086 10:120940815-120940837 AAGGGGAAGCCGACTGATGCAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075382472 10:122030602-122030624 AGGAGAATGAAGACTGAGGAGGG - Intronic
1075446106 10:122514275-122514297 AAGGGAAAGCACCCTGAACATGG + Exonic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1076071172 10:127490976-127490998 TAGGGAAAGGGGACTGGGGAGGG - Intergenic
1076091988 10:127694316-127694338 AATGGCAAGTAGACTGAGGGCGG + Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1077092510 11:786108-786130 ACTGGAAGGCAGGCTGAGGATGG + Intergenic
1077096794 11:802388-802410 ACAGGAAAGCTGAGTGAGGAAGG + Exonic
1077841766 11:5982960-5982982 AATTGAGAGCAGACTGAGGGAGG - Intergenic
1079260768 11:18878106-18878128 AAGAGAAATCAGATTGTGGATGG + Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079724827 11:23867780-23867802 TAGGGCCAGCAGACTGAGGTGGG - Intergenic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080244658 11:30166056-30166078 TGGGGAAAGCAGCCTAAGGAAGG + Intergenic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081498251 11:43638062-43638084 GAGGGAAAGCAGACTGAGAGAGG + Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081714894 11:45242909-45242931 AAGTGAAAACAGACAGAGGGAGG + Exonic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081869770 11:46378026-46378048 CAGGGAAACGAGACAGAGGAAGG - Intronic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1083314044 11:61803176-61803198 CAGGTAAAGCTGGCTGAGGAAGG + Intronic
1083372669 11:62194193-62194215 AAGGGAGAGCAGGTTGAGGGCGG - Intergenic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1084519956 11:69657051-69657073 CAGGGAGAGCTGACTGCGGAAGG - Intronic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084793532 11:71489864-71489886 GAGGGAATTCAGACTGTGGAAGG + Intronic
1084873812 11:72115994-72116016 AATGGAAAGCAGGGTCAGGATGG + Intronic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085875265 11:80399604-80399626 GAGGTAAAGCTGACGGAGGAGGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086442796 11:86846098-86846120 GAGTGAAAGCACACTGTGGAAGG - Intronic
1086855112 11:91856470-91856492 ATGAGAAAGCAGACAAAGGAGGG + Intergenic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088836304 11:113580506-113580528 GAGGGACAGCAGTCTGAGGAAGG - Intergenic
1088878370 11:113954455-113954477 CAGGGTAAGCAGGCTTAGGACGG + Intergenic
1088900649 11:114114310-114114332 GAGGGAAACCTGACTGGGGAGGG + Intronic
1089278320 11:117354929-117354951 TAGGAAACGCAGCCTGAGGAGGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090107426 11:123868015-123868037 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090609811 11:128460793-128460815 AAGGCAAAGGAAACTAAGGAAGG - Exonic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091077058 11:132629066-132629088 CAGGGCAAGCAGGCTTAGGATGG - Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091663735 12:2403502-2403524 AAGGAAAAGCAGCCTTGGGATGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093789735 12:23234558-23234580 GAGGGAAAGCACACTGGGGATGG + Intergenic
1093919089 12:24839227-24839249 AAGGAAAGCCAGACTGAGAATGG + Intronic
1093943998 12:25086631-25086653 AAGGCAGAGGAGACTGAGAACGG + Intronic
1094479695 12:30871821-30871843 AAGGTAGAGCAGACTCAGAAAGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1096431671 12:51549469-51549491 AAGGGAAAGGAGAGAGAGAAAGG - Intergenic
1096602160 12:52737051-52737073 AGGGGAAAGGACACAGAGGATGG - Intergenic
1096602897 12:52742682-52742704 AGGGGAAAGGACACAGAGGATGG + Intergenic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096748923 12:53746562-53746584 AATGGAAGGGAGGCTGAGGAGGG + Intergenic
1096758995 12:53824342-53824364 AAGGCAATCCAGCCTGAGGAGGG - Intergenic
1097638106 12:62146239-62146261 AAGGCAAAGCAACCTTAGGAGGG - Intronic
1098327845 12:69321396-69321418 AAAGGAGAGCAAACTGGGGATGG + Intergenic
1098443780 12:70545707-70545729 AATGGAAAGAAGACTGTGAAAGG + Intronic
1098803701 12:74994483-74994505 AAGTGAAAGGAGACAGAAGAGGG + Intergenic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1099610209 12:84858036-84858058 AAGGGAAAGCACAGTGACTAAGG - Intergenic
1100189709 12:92177347-92177369 GAGGGAAGGGAGGCTGAGGAAGG + Intergenic
1100594328 12:96058879-96058901 AATGGAAAGCCGGCTGAGCACGG - Intergenic
1101985283 12:109441295-109441317 AAGGGACAGCAGGCTGAGTTTGG + Intronic
1102761906 12:115394902-115394924 CAGGGAAAGAAGAGTGAGCAAGG + Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104684920 12:130778549-130778571 GGAGGAAAGCAGACAGAGGAGGG - Intergenic
1105266434 13:18822044-18822066 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1105429079 13:20320811-20320833 AAGGGAAAGCAGCATGAGTGTGG - Intergenic
1105509334 13:21038118-21038140 AAAACAAATCAGACTGAGGAGGG + Intronic
1105679963 13:22715979-22716001 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1105962423 13:25354300-25354322 AACAGAAGGCAGACTGTGGAAGG + Intergenic
1106699566 13:32214678-32214700 AAGGGAAAGCGGACTGGTGGTGG - Intronic
1107703789 13:43078066-43078088 AATGGGAACCAGACTGTGGATGG - Intronic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108482876 13:50892476-50892498 AAGGGAAAGAAAATTAAGGAAGG + Intergenic
1108798488 13:54063987-54064009 AATGGAAACCAGATTGAGGTGGG - Intergenic
1108919373 13:55657396-55657418 AAGTGAAAGCAAAGAGAGGATGG + Intergenic
1109284260 13:60393727-60393749 AAGAGAAAGGAGGCTGAGGCAGG - Intergenic
1109358080 13:61258439-61258461 AAGGGAAAGCATAGACAGGAAGG - Intergenic
1109716564 13:66228806-66228828 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110120705 13:71877193-71877215 TATGGAAAGCAGACTGAGGTTGG - Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1112197835 13:97242918-97242940 AAATGAAAGCCGACTGAGCAGGG + Intronic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112995614 13:105571417-105571439 AAGGGAAAGTAAAATAAGGAGGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113895052 13:113759128-113759150 AAGGGAGAGTAGAGCGAGGAAGG + Intergenic
1114204699 14:20557989-20558011 AAGGGAAACCAGACTGATAGAGG - Intronic
1114219080 14:20681386-20681408 AAGGGAAAACCGGCAGAGGAAGG - Intergenic
1114485785 14:23060898-23060920 TAGAGAAACCAGACTCAGGAGGG - Intronic
1114564962 14:23623909-23623931 AACTGAAAGCAGAATAAGGAGGG + Intergenic
1114958411 14:27851247-27851269 AATGGAAAGCAGGCAAAGGAGGG + Intergenic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1116111306 14:40588084-40588106 AAGGAAAAGTAGATTTAGGATGG + Intergenic
1116543938 14:46138699-46138721 AAGCAAAAGCAGATTGAGGTTGG + Intergenic
1116735490 14:48685538-48685560 AAGAGAAATCAGCCTGGGGAAGG + Intergenic
1117200694 14:53386948-53386970 AAGTGAAAGAAGACTGAAGAAGG - Intergenic
1118482620 14:66182253-66182275 AAAGGAAGGCCGACTGAGAAGGG + Intergenic
1118850942 14:69582985-69583007 AAAGGAAATCAGACTCAGCAAGG - Intergenic
1118982791 14:70730092-70730114 AAGGCAAGGAAGACTGTGGAGGG + Exonic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119498470 14:75101813-75101835 AAGGAAAATCAGGCTGAGAATGG + Intronic
1119620906 14:76131277-76131299 TGGGGAATGCAGACTGTGGAAGG + Intergenic
1120054714 14:79909964-79909986 AAGGAAAAGGAGACAGAGAAGGG - Intergenic
1121034468 14:90688930-90688952 AGGGGAAGCCAGACAGAGGAGGG - Intronic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122864366 14:104596874-104596896 CAGGGACCGCAGACTCAGGATGG + Intronic
1202832092 14_GL000009v2_random:46037-46059 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1123971383 15:25511165-25511187 AAGGGATATCTGACTGAGTAAGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1126000986 15:44209757-44209779 AAAGGAAAGGGGACAGAGGAAGG - Intergenic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126590149 15:50331031-50331053 AAGGGAAAGCAAACCTAGGGAGG + Intronic
1126666462 15:51079692-51079714 AAGTCAAATCAGACTGAGCATGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127024963 15:54794416-54794438 AAAGGAGAGCAGATTCAGGAAGG - Intergenic
1127107862 15:55636440-55636462 AAGGGAGAGAAGATTGAGGAAGG - Intronic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128695302 15:69757455-69757477 AAGGGAGAGCAGAGTGAGTCAGG - Intergenic
1129102840 15:73282105-73282127 AAGGGAAAGGACCCTGAGGCAGG - Intronic
1129103899 15:73292005-73292027 AGAGGAAAGCTGTCTGAGGAGGG - Intronic
1129325464 15:74798202-74798224 AAGAGCATGAAGACTGAGGAGGG - Intronic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130231881 15:82103411-82103433 TAGAGAAAGCAGGCAGAGGATGG + Intergenic
1131351534 15:91705244-91705266 AACTCAAAGCAGACAGAGGAAGG + Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133233583 16:4377621-4377643 GAGGGAAGGCTGACTGTGGAGGG - Intronic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136347239 16:29684001-29684023 AATAGAAGGAAGACTGAGGATGG - Intronic
1137779633 16:51087104-51087126 AAGGGCAGGCAGACAGAGAAAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1140347226 16:74225954-74225976 AAGGGAAAGAAGAGAAAGGAGGG + Intergenic
1140728776 16:77837581-77837603 AAGGGAAAGAAGACAGAAAAGGG + Intronic
1140914760 16:79483390-79483412 AAAGGAAAGAAAACAGAGGAAGG + Intergenic
1141414405 16:83859013-83859035 AGGGGAAAGCAGAGTGAGTCAGG + Intergenic
1141526379 16:84614508-84614530 AAGGGACAGTAGCCTGAGGTGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143156445 17:4840305-4840327 GAGGGCAAGAAGCCTGAGGATGG + Intronic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1144560967 17:16320137-16320159 AAGGGAAGGGAGAGAGAGGAAGG + Intronic
1145720235 17:27064639-27064661 CATGGAAAGCAGGCTGAGAAAGG + Intergenic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146496572 17:33327964-33327986 AAGCCAAAGAAGACTGAGGATGG + Intronic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1147532891 17:41296697-41296719 AAGGGAAATAAGACTGAAGAGGG + Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1150410605 17:64937879-64937901 AAGGGAGAGAAGACCCAGGATGG + Intergenic
1150661124 17:67080481-67080503 CAGGAAGAGCAGACTGAGCATGG - Intronic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1151914134 17:77105009-77105031 AAAGGAAGGAAGACTCAGGAAGG + Intronic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1152496976 17:80680094-80680116 AAGAGCCAGCAGGCTGAGGAGGG - Intronic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1154037684 18:10821174-10821196 AAGGGAATCCAAACTGAGCATGG - Intronic
1154265669 18:12876640-12876662 AAGGGAAAGCAGCCTTGGGATGG - Intronic
1154421978 18:14239436-14239458 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1154477877 18:14782883-14782905 AAGGGAATGAAGACTAAGGAAGG + Intronic
1155349237 18:24890271-24890293 AAGGGAAGGAAGACAGAGGCAGG + Intergenic
1155439419 18:25845924-25845946 AAGGGAAATGAGACCAAGGAAGG - Intergenic
1155494410 18:26428714-26428736 TAGTTAAAGCAGACTGAGGCAGG - Intergenic
1155812607 18:30256759-30256781 AAGGGCAAGATGCCTGAGGATGG + Intergenic
1156040915 18:32821958-32821980 AAGGTAAACCAAATTGAGGAAGG - Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157215644 18:45781034-45781056 AAGGGAAAGGAGGTAGAGGATGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1159164650 18:64684916-64684938 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1160366314 18:78328944-78328966 AAGGGAACGCACACAGGGGAGGG + Intergenic
1160758598 19:771550-771572 GAGGGAGAGTAGACAGAGGAGGG - Intergenic
1160835110 19:1121226-1121248 CCAGGAAAGCAGTCTGAGGAAGG + Intronic
1161392337 19:4028093-4028115 AAAGGAGAGCTGAGTGAGGAGGG - Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1162501443 19:11056361-11056383 ATGGGAATGCAGTCTGAGAAGGG + Intronic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1164109729 19:22144783-22144805 AGGGGAATGCAGACTGTCGATGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165200914 19:34144166-34144188 ACTGGAAAGCAGCCTGAGGCAGG - Intergenic
1165826710 19:38709772-38709794 AAGGGCAAGGTGGCTGAGGAGGG + Intronic
1165943317 19:39426229-39426251 AAGGGAAATCAGACAGATGTGGG - Exonic
1165949868 19:39468238-39468260 GAGGGAATGCAGGCTCAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166654423 19:44599762-44599784 AAGGGAAAGAAGAATGGGCATGG + Intergenic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1167811305 19:51833667-51833689 AAAAGAAAGAAAACTGAGGAAGG + Intergenic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1202636083 1_KI270706v1_random:45911-45933 AGAGGCAAGCAGACTAAGGAGGG - Intergenic
1202640595 1_KI270706v1_random:81734-81756 AAGGGAAAACAGTCTGAGATAGG - Intergenic
925226596 2:2188883-2188905 TAGGGAAATCAGACTGTGGCAGG - Intronic
925258403 2:2509024-2509046 AATGGACAGCAGACAAAGGAAGG - Intergenic
925384081 2:3449887-3449909 AAGGAAAGGCCGAGTGAGGATGG + Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925732029 2:6926127-6926149 AAAGGAAAACATGCTGAGGATGG - Intronic
925847900 2:8050462-8050484 AAGCCCAAGCAGGCTGAGGAGGG - Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
925944262 2:8846243-8846265 AAGGGAAAGCAGAGTGACATGGG + Intergenic
925948964 2:8893280-8893302 AGGAGAAAGCTGACTGAGAAGGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927306313 2:21577183-21577205 AAGGAAAAGGAGACTGAGATGGG + Intergenic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
927856081 2:26528774-26528796 ATGGGAAAGAAGACTGGGCAAGG + Intronic
929957251 2:46467529-46467551 TGGAGAAATCAGACTGAGGAGGG - Intronic
929964218 2:46521516-46521538 TAGAGATTGCAGACTGAGGAAGG + Intronic
929993500 2:46810261-46810283 AAGGGAGATTTGACTGAGGAAGG + Intergenic
930106087 2:47640563-47640585 AAGGGAAATCAGCGTGAGGCAGG + Intergenic
930252073 2:49045537-49045559 AAGGGAAGGCAGACAGAGGTAGG + Intronic
930557563 2:52918397-52918419 AATGGAAAGCATGCTGAGGCTGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931591586 2:63889349-63889371 GAGGGAAAAAAGACTGAAGAGGG + Intronic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
931877533 2:66529967-66529989 AAGGGCAGGCAGACAGTGGAGGG + Intronic
931907102 2:66854313-66854335 AAGGGAACCCTGCCTGAGGAGGG - Intergenic
932168968 2:69536243-69536265 CACAGACAGCAGACTGAGGAAGG + Intronic
932566465 2:72914364-72914386 AAAGGTAAGCAGCCTGAAGATGG + Intergenic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933138113 2:78761195-78761217 AAGTGAAAGCAAAGAGAGGATGG - Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
934496158 2:94801697-94801719 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
934540803 2:95173025-95173047 AAGGGAAATAAGACTGGGGAAGG - Intronic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934844613 2:97654868-97654890 AAGGGAAAGCAGAATTTGCACGG - Intergenic
934945341 2:98537319-98537341 AGGGTAAAGCTGACTGAGGCTGG + Intronic
935187226 2:100745179-100745201 CAGGGACAGCAGACACAGGATGG - Intergenic
935678535 2:105616986-105617008 AAGGAAAAGCTGCCTGAGGTTGG - Intergenic
937424425 2:121786532-121786554 AAGGCAAGGCTGACTGTGGACGG - Intergenic
937439864 2:121906427-121906449 AAGGGAGAGCTGTCTGAAGAGGG - Intergenic
937952912 2:127402009-127402031 AAGGGAAGGCAGGCTGAGGTGGG - Intergenic
937957127 2:127427748-127427770 AAGGCAAAGCATATTGAGAAAGG + Intronic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
938640467 2:133272815-133272837 AAGGGAAAGAAGCCAGAGAAAGG - Intronic
939024680 2:136997942-136997964 AAGGTAAGGCAGAGTGAGCAAGG + Intronic
939845715 2:147244040-147244062 AAAGCAAAGCAGGCTGGGGAGGG + Intergenic
940433550 2:153623266-153623288 GAGGGAAAGCACGTTGAGGAAGG - Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
941159825 2:162023624-162023646 AAGGGCAGGCAGACTGGGGAAGG - Intronic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942259346 2:174142358-174142380 AAGGGAAACCAGATTTAGGGAGG + Intronic
942329228 2:174804483-174804505 AGTGGAAAACAGACTGTGGAAGG + Intronic
942475729 2:176318036-176318058 GATGGAAAGCAGACTTAGCAGGG - Intronic
942570907 2:177313364-177313386 AAGGGAAAGAAGAGGAAGGAAGG - Intronic
942607751 2:177710097-177710119 AAGGGACAGCAGATACAGGAGGG + Intronic
942659188 2:178246155-178246177 AAGAGAAAGAAGACAGAGAATGG - Intronic
943259415 2:185640021-185640043 GAGGGAAAGAAGACTGAGTGGGG - Intergenic
943332623 2:186577624-186577646 AAGGGAAAGGAGAATAGGGAAGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943757382 2:191570556-191570578 CACAGAAAGCAGACTGGGGATGG - Intergenic
944848298 2:203690916-203690938 AACAGAAAGGACACTGAGGAAGG - Intergenic
946826187 2:223680618-223680640 AAGAGAAAATAGACTGAGCATGG + Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947290223 2:228565515-228565537 AAGGCAAAGAAGATTGAGAAGGG + Intergenic
947459640 2:230292657-230292679 AAGTGTATACAGACTGAGGATGG + Exonic
947469943 2:230392098-230392120 AAGTGTATACAGACTGAGGATGG + Exonic
947691620 2:232142198-232142220 AAAGCAAATCAGGCTGAGGAGGG + Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948081755 2:235212227-235212249 ACAGGAAAGCAAACTGAAGAAGG - Intergenic
948453421 2:238092806-238092828 GAGGGAAAGCACGCTGGGGAGGG - Intronic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169160348 20:3372297-3372319 AGGGGAAAGAAGACTGAGGTGGG + Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169738719 20:8866711-8866733 CAGGGAGAGCAAACTGAGGCAGG - Intronic
1170412953 20:16110050-16110072 AAGAGAAAACACACTGAGGTGGG + Intergenic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170830677 20:19837822-19837844 AAAGGAAAGGAGACAGGGGAGGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1171464615 20:25318959-25318981 AAGGGAAAGCAGGCCTAGGTGGG - Intronic
1171882224 20:30626851-30626873 AGAGGCAAGCAGACTAAGGAGGG - Intergenic
1172986965 20:38999336-38999358 AAGGAAGAGCAGACAGAGAAGGG - Intronic
1173679139 20:44864160-44864182 AAGAGAAAGAACACTGAGGAAGG - Intergenic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1174359331 20:50018040-50018062 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175231719 20:57477686-57477708 AAGAGAAGGGAGGCTGAGGAGGG - Intergenic
1176851504 21:13920524-13920546 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1176902167 21:14455405-14455427 AAGGGAAAGGAGAGAGAGAAGGG + Intergenic
1177072970 21:16534153-16534175 AAGGAAAAGGAGACAGATGAAGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177940850 21:27409862-27409884 AGGATAAAGCAGACAGAGGAAGG - Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178465541 21:32844126-32844148 AGGCAAAAGCAGACTGGGGATGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179350845 21:40609644-40609666 AAAGGAAAGATGACTCAGGAAGG + Intronic
1180139928 21:45887003-45887025 AAGGGACAGCACAGTGAGGCTGG - Intronic
1180361348 22:11900148-11900170 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1180364635 22:11927325-11927347 AGAGGCAAGCAGACTAAGGAGGG + Intergenic
1181030321 22:20146301-20146323 GTGGGAAAGCACACTGGGGAGGG + Intronic
1181079116 22:20401965-20401987 AAGGGAAAGGGGACTGGGGTGGG + Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181840964 22:25660366-25660388 AAAGGCAGGCAGACTGGGGAAGG - Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1183669300 22:39262966-39262988 AACAGAAAGCAGACTAAGCAAGG - Intergenic
1184538239 22:45102037-45102059 AAAGGAGAGCAGACAGAGCAAGG + Intergenic
1184768812 22:46586419-46586441 AGGGGAGGGCAGACAGAGGAGGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
952561903 3:34604609-34604631 AAGGGAGAGGAGTCAGAGGAGGG - Intergenic
952637104 3:35545702-35545724 AAAGGCAAACAGACTGAAGATGG + Intergenic
952696034 3:36266015-36266037 AAGGGAAAGCTGGCTGAGCGTGG - Intergenic
953671972 3:44970363-44970385 AAGGGAATGAAGACTGAGCTTGG + Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
953942300 3:47110886-47110908 AGGGGAAAGGAGACTGGGGAAGG - Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
954975933 3:54694749-54694771 AAGGGAATGAAAACAGAGGAGGG - Intronic
955178725 3:56644981-56645003 AAAGGAGAGCAGGCTGAGCATGG + Intronic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956751921 3:72350428-72350450 AGGGGACAGGAGGCTGAGGAAGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
958834708 3:99131356-99131378 AAGGGAGAGAAGACTTAAGAAGG - Intergenic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960939289 3:122922967-122922989 AAGGAAAAGGAGACTGAAGGAGG + Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961491938 3:127262445-127262467 AAGGCCACCCAGACTGAGGAGGG - Intergenic
961493887 3:127276536-127276558 AGGGGAGTGCAGGCTGAGGATGG - Intergenic
961971593 3:130974032-130974054 AATGGAAAGAAGACTGAAGGAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962502028 3:136004740-136004762 AAGGGAAATGCAACTGAGGAAGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962927902 3:140012024-140012046 AAGGCAAAGCTGACTGTGGCTGG + Intronic
962961127 3:140312038-140312060 AAGGGAAAGCACTCTGAGTCTGG - Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
963462954 3:145640166-145640188 AAGAGAAAGCAAACCAAGGAGGG + Intergenic
963490639 3:145995728-145995750 AAGGGAAATCAGATTGCAGATGG - Intergenic
963905902 3:150773495-150773517 AAGGGAAAGGGTCCTGAGGAAGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
965000624 3:162948000-162948022 AAGGCAAAGCAGGCAGAAGAAGG - Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965676060 3:171198149-171198171 AAGAGAAGCCAGACTGAGGCAGG + Intronic
966253189 3:177889666-177889688 AATGGGAAGCAGTCAGAGGAGGG + Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
967224176 3:187275150-187275172 ACGGGAAAATAGCCTGAGGATGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968074505 3:195809150-195809172 AAGGCACAGCAGACAGAGGTGGG - Intronic
1202737960 3_GL000221v1_random:25672-25694 AAGGGAAAACAGTCTGAGATAGG + Intergenic
969194471 4:5549771-5549793 AAGGGAAGGAAGAGTGAGCAGGG - Intronic
969495869 4:7525862-7525884 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495887 4:7525937-7525959 AGGGGACAGGTGACTGAGGAGGG - Intronic
969495905 4:7526009-7526031 AGGGGACAGGTGACTGAGGAGGG - Intronic
969540317 4:7784519-7784541 AAGGGAGAGAGGACTGAGGAGGG + Intronic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971341391 4:25772638-25772660 AAGGGAAAGAAAAGAGAGGAAGG + Intronic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
973288836 4:48449395-48449417 GAGGGAAAGCACGCTGAGGGAGG - Intergenic
973365891 4:49209297-49209319 AGAGGCAAGCAGACTAAGGAGGG - Intergenic
973384106 4:49492248-49492270 AAGGGAAAACAGTCTGAGATAGG - Intergenic
973394708 4:49583154-49583176 AGAGGCAAGCAGACTAAGGAGGG + Intergenic
973530398 4:51831948-51831970 ATGGGAAAGCAGACTGTTGTTGG + Intergenic
973620450 4:52721292-52721314 CAGGGAAAACAGACTCAGGCTGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975151714 4:71029930-71029952 TAGAGAAAGCAGACTGAGGCAGG - Exonic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
976223493 4:82777277-82777299 AAGGGAGAGTAGGCCGAGGAGGG - Intronic
976626366 4:87187983-87188005 TAGTGAAAAAAGACTGAGGAAGG - Intronic
977243232 4:94599451-94599473 GAGGGATAGCAGACTGAGTGAGG + Intronic
977487216 4:97664880-97664902 AAGGGCAAGCAGAGTGGCGAGGG + Intronic
977520837 4:98081799-98081821 AAGATAAAGGAGACTGAGTAGGG + Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979011854 4:115380980-115381002 ATGGGAAAGCTGGCTGAGAAAGG - Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979667317 4:123326493-123326515 AAGGGAAAGCACAGTAAGGCTGG - Intergenic
981949790 4:150392377-150392399 AAGAGAGAGCAGAGTGAGTAGGG + Intronic
982136912 4:152280983-152281005 AAGGGACAGCAGGCAGAGGGTGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983238555 4:165207075-165207097 AATGGCTAGCATACTGAGGAGGG + Intronic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984826294 4:183927806-183927828 AAGAGAGAGCAGACTGACAATGG - Intronic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984911261 4:184676454-184676476 AAGGGAAAGGAGAGAGAGGGAGG - Intronic
1202763398 4_GL000008v2_random:131778-131800 AGAGGCAAGCAGACTAAGGAGGG - Intergenic
1202767961 4_GL000008v2_random:167573-167595 AAGGGAAAACAGTCTGAGATAGG - Intergenic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
985696983 5:1346234-1346256 AAGCGAGAACAGACTGAGGGGGG - Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
986605376 5:9517800-9517822 ACAGGAAAGCAGACTGGAGAGGG - Intronic
986774896 5:11005416-11005438 AATGGAAAATAGACTGAAGATGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987206415 5:15631558-15631580 ATGGGACAGGAGGCTGAGGAAGG + Intronic
988493586 5:31726105-31726127 AAGGAAAGGCAGGCTCAGGACGG - Intronic
988712463 5:33792284-33792306 AAGTGAAAGCAGGCTGGGCATGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990700340 5:58468026-58468048 AAGGGATGGCATTCTGAGGATGG + Intergenic
991260712 5:64664656-64664678 AAGGGAAATGAGCCTGAGAAAGG + Intergenic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
992170267 5:74094714-74094736 AAGCCAAAGTAGACTGAAGAGGG - Intergenic
992226714 5:74625852-74625874 AAGGGAGAGCAGACGTTGGAGGG - Intergenic
993152075 5:84174037-84174059 AAAGGAAAGGAGACAGATGAGGG + Intronic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
994190449 5:96863175-96863197 AATGGAGAGGAGCCTGAGGAGGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995740657 5:115352744-115352766 AATGAAAAGCAGGCTGAGCATGG - Intergenic
996511950 5:124326376-124326398 AAGGGAGAGGAGGCTGGGGAGGG + Intergenic
996570386 5:124927536-124927558 AAAGGACAGCAGAGTGAGGCTGG - Intergenic
996716434 5:126591658-126591680 AAGACAAAGCACACTGAGGATGG + Intronic
997888853 5:137657542-137657564 AAGGGAAGGAAGACACAGGAGGG - Intronic
998299769 5:141006593-141006615 AAGTGGAAGCAGACTGAATAAGG + Intronic
998980839 5:147700464-147700486 AATGGAAATCAGAGTGAGAAAGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1001300229 5:170528240-170528262 AAGGGGCTGCAGACTGGGGAAGG - Intronic
1001614261 5:173029864-173029886 GAAGGAAGGCAGACTGGGGAGGG - Intronic
1002065174 5:176648124-176648146 AAGGGAAAGGAGGCCGGGGAAGG - Intronic
1002288576 5:178182390-178182412 TAGGGAAGCCACACTGAGGAAGG + Intergenic
1002393862 5:178938327-178938349 AAGCGTAAGCAGACTGGTGATGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003414086 6:5892683-5892705 TAGGCAGAGCACACTGAGGATGG + Intergenic
1003664731 6:8100438-8100460 AAGGGAAAGCAAAAAGAGAAGGG + Intronic
1003689264 6:8336789-8336811 AAGGGAAAGGAGAGAAAGGAAGG - Intergenic
1004995992 6:21193668-21193690 AAGGGAAAAAAGTCTGAAGAGGG - Intronic
1006276317 6:33007740-33007762 GAGGGAGAGGAGACTGGGGAGGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007363941 6:41376771-41376793 TCAGGAAAGCAGCCTGAGGAGGG + Intergenic
1007464776 6:42044092-42044114 AAGGGAAAGGACAGTCAGGAAGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007734349 6:43971372-43971394 AAGGAAAAGGAGACTCAAGAGGG + Intergenic
1008756021 6:54796526-54796548 ACTGGATAACAGACTGAGGATGG + Intergenic
1009452386 6:63817256-63817278 AAGGGAGAGCAAACAGGGGATGG + Intronic
1009647405 6:66424325-66424347 AACTCAAAGAAGACTGAGGAAGG - Intergenic
1010141081 6:72615507-72615529 AAGAGAAGGCAGTCTGAAGAAGG - Intergenic
1011129577 6:84039769-84039791 AAGGCAGAGCAGGCTGAGGGAGG + Intronic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1012306237 6:97661546-97661568 AAGGAAAAGAAGACTGAGAGAGG - Intergenic
1012569837 6:100710483-100710505 AAATGAAAGGTGACTGAGGAGGG - Intronic
1013210681 6:107983976-107983998 AAGGGGGAGCAGACCGAGAAAGG + Intergenic
1013414506 6:109912809-109912831 AAGAGAAAGTGGACAGAGGAGGG - Intergenic
1014255752 6:119158879-119158901 TAGGGCAACCAGACAGAGGAAGG - Intergenic
1015241074 6:131024214-131024236 AAGAGAAAGCAGGCAGAGGGAGG + Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016267057 6:142244996-142245018 AAGGGAAAACACACTGAAAAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017738318 6:157382326-157382348 AAACGAAAGCAGCCCGAGGAGGG - Intronic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018419140 6:163626917-163626939 AAGAGAAATCTGACTCAGGAGGG + Intergenic
1018615536 6:165683125-165683147 GAAGGAAAGAAGACTGAAGAGGG + Intronic
1018799760 6:167212769-167212791 AAAGGAAAGTAGACTGAAAACGG + Intergenic
1018813209 6:167312723-167312745 AAAGGAAAGTAGACTGAAAATGG - Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019646925 7:2135780-2135802 AAGGGAAAGTACACTCATGAAGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1020506332 7:8993380-8993402 ATGGGAAAGGAGACTGACTAGGG - Intergenic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1021172849 7:17417136-17417158 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022437964 7:30408308-30408330 AAGGAAAAGCAGACGGATGGTGG - Intronic
1022843832 7:34190608-34190630 AAGGTCAGGCAGCCTGAGGATGG - Intergenic
1023812992 7:43926712-43926734 AAGCGAACGCAGCCTGAGAAAGG + Intronic
1023966143 7:44963961-44963983 AGGGGAGAGAAGACTGAGGCAGG + Intronic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026310988 7:69184158-69184180 AAGGAAAAGGAGACTGATGTGGG + Intergenic
1026330670 7:69349830-69349852 AAGGGAAAGAAGACTTCGGCCGG + Intergenic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027355443 7:77349775-77349797 AAGTGAAAGAAGAGAGAGGAAGG - Intronic
1028193362 7:87876788-87876810 AAGGGACTGCAGGCGGAGGAGGG - Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028455372 7:91032564-91032586 AAGAGAAAGCAGTGTGAAGAGGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028670676 7:93397219-93397241 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1029790389 7:102837288-102837310 CAGGGAAACCAGGCTGAGCAAGG + Intronic
1030266932 7:107630614-107630636 AAGAGATAGGAGACTGAGGAAGG + Intergenic
1030992913 7:116322837-116322859 AGGGCAAGGCAGACTCAGGAAGG + Intronic
1031018111 7:116597415-116597437 CAGGGAAGGGAGACTGAGGTTGG - Intergenic
1031349556 7:120713034-120713056 AAGGGAAAGGAGGCTTAGCAAGG - Intronic
1031490714 7:122384253-122384275 AAGGGAATGCATTGTGAGGAAGG + Intronic
1032561933 7:132901282-132901304 AAGGGAAAGAAGTCTTAGAAGGG + Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034066134 7:148138588-148138610 AGAGGAGAGCAGATTGAGGAGGG - Intronic
1034221432 7:149449439-149449461 AGGGAAAAGCAGACAGAGAAAGG + Intronic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034345905 7:150384970-150384992 AGGGGAACTCAGACCGAGGAGGG - Intronic
1034570458 7:151951588-151951610 GAGGCAAAGAAGTCTGAGGATGG + Intergenic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034941350 7:155232331-155232353 AAGGGAGAGGAGTCGGAGGAAGG + Intergenic
1034998775 7:155594977-155594999 AAGGGAAATCACACAGAGGCAGG + Intergenic
1035118675 7:156546766-156546788 AATGGAAAGCTGGCTGAGCATGG + Intergenic
1035278568 7:157763284-157763306 AAGGGAGAGAAAAATGAGGAGGG - Intronic
1035682121 8:1495764-1495786 AAGCGAAAGCATACGGGGGAAGG - Intergenic
1037204781 8:16303506-16303528 AAAGGAAAGCAGAGAGGGGAAGG - Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037555001 8:20013655-20013677 AAGGGAAAGAAGCCTGAGCAAGG + Intergenic
1037905076 8:22711478-22711500 AAGGGAAACCAAACTGAAGGGGG + Intergenic
1038162349 8:25051999-25052021 AAAGGAAAGGAGACGGATGATGG + Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038611376 8:29062674-29062696 AAGGGAAGGCAGGCTGACGAAGG + Intronic
1038696872 8:29813996-29814018 AAGGCAAAGCAGGCTGAGCATGG + Intergenic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1040526151 8:48226829-48226851 AGAGGAGTGCAGACTGAGGATGG - Intergenic
1040681917 8:49820772-49820794 AAGGGAAGGGAGACGGAGGGAGG + Intergenic
1040906229 8:52472319-52472341 CATGGAGAGCAGGCTGAGGAAGG - Intergenic
1041235698 8:55799862-55799884 AAAGGAAACCAGCCTGAGCATGG - Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1044047084 8:87449534-87449556 AAGTCAAAGGAGACTGAGCACGG + Intronic
1044448097 8:92301996-92302018 AAGGCAAAGAAGACTGCAGAGGG - Intergenic
1044451686 8:92342883-92342905 AAGTGAAAACAGACTGAGCCTGG - Intergenic
1044541979 8:93418626-93418648 CAGAGAAAGCAGACTGGGAAGGG - Intergenic
1044952118 8:97445039-97445061 AAGGGAAAGCAAAAAGAGAAAGG - Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045598171 8:103681416-103681438 AAGGGAAATCAAATTGGGGAAGG + Intronic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046914841 8:119668872-119668894 GAGGGAAAGCGGATTGAGAAAGG - Intronic
1047031199 8:120883122-120883144 AAGGGAAAGCAGACTAAAGATGG + Intergenic
1047039207 8:120974204-120974226 AAGGGAAAGGAGACAGAAAAAGG + Intergenic
1047404411 8:124573247-124573269 GAGGGACAGCAGAGTGAAGATGG - Intronic
1048562694 8:135558986-135559008 AAGAGAAGGCAGTGTGAGGACGG - Intronic
1048855638 8:138684701-138684723 ATGGGAAAGCAAACTGAGAGAGG - Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1051029549 9:12658122-12658144 AAGGGCAAGCAGAGTGGTGAGGG + Intergenic
1051223744 9:14877342-14877364 AAGGTAAGGAAGACTGAGGGAGG - Intronic
1052875924 9:33563518-33563540 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053076256 9:35137316-35137338 AAGGGAAAGGAGAGAGAGAAAGG + Intergenic
1053500085 9:38580843-38580865 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1053660981 9:40278682-40278704 AAGGGAAAGCAGTCTGAGATAGG + Intronic
1053680903 9:40484526-40484548 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1053911358 9:42908019-42908041 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054282810 9:63140409-63140431 AATGGAAGCCAGATTGAGGAGGG + Intergenic
1054293985 9:63320041-63320063 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054373102 9:64424896-64424918 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054392010 9:64624530-64624552 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054503719 9:65891798-65891820 AATGGAAGCCAGATTGAGGAGGG + Intronic
1054523629 9:66097602-66097624 AAGGGAAAGCAGTCTGAGATAGG - Intergenic
1054680733 9:67914675-67914697 AAGGGAAAGCAGTCTGAGATAGG + Intergenic
1054894542 9:70294068-70294090 AAAGCAAAGCAGAATGAGTAAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055664813 9:78542815-78542837 AAGGGAAAGTGGACAGAGGCAGG - Intergenic
1055856531 9:80694651-80694673 AAAGGAAAGCAGACAGACAATGG + Intergenic
1055893242 9:81145588-81145610 AAGAGAAAGAAGACCGGGGAAGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1058493975 9:105534251-105534273 AATGGCATGCAGACTGAGCAAGG - Intronic
1059154746 9:111979758-111979780 GAGGGACAGCAGTCTGAGAATGG - Intergenic
1059318865 9:113450667-113450689 GAGGGAAAGAATATTGAGGAGGG + Intronic
1060748288 9:126152015-126152037 AAGGGAATGCTGCCTAAGGAAGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061267699 9:129516860-129516882 AAAGGAAAGAAGACAGAGGCTGG + Intergenic
1061656465 9:132095034-132095056 AAAGGAAAGCAGGCAGAAGAAGG - Intergenic
1203692373 Un_GL000214v1:56499-56521 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1203706688 Un_KI270742v1:56116-56138 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1203544156 Un_KI270743v1:116651-116673 AGAGGCAAGCAGACTAAGGAGGG - Intergenic
1203556557 Un_KI270744v1:3391-3413 AAGGGAAAACAGTCTGAGATAGG - Intergenic
1203643922 Un_KI270751v1:47692-47714 AAGGGAAAACAGTCTGAGATAGG + Intergenic
1185679108 X:1873716-1873738 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1185679112 X:1873752-1873774 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1185679116 X:1873788-1873810 GAGAGAAAGGAGACTGAGAAAGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186789346 X:12981894-12981916 AAGAGAAGGCAAACAGAGGAAGG - Intergenic
1186807081 X:13151006-13151028 AAGAGAAAGCAGATTGTTGATGG - Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187733613 X:22281855-22281877 AAGGGAAAGCAGAGTAAGTAAGG - Intergenic
1188139762 X:26535173-26535195 AAGTGAAAGCACACAGAAGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188385772 X:29555833-29555855 AAGGAAAAGAACACTGGGGAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189248362 X:39580870-39580892 AAGGGAAAGGAGTCTGGGGGAGG - Intergenic
1190765580 X:53473196-53473218 GAGGTAGAGCAGACTGAGGTGGG + Intergenic
1190981343 X:55458952-55458974 GAGGGAGAGCACACAGAGGAGGG + Intergenic
1190987355 X:55514228-55514250 GAGGGAGAGCACACAGAGGAGGG - Intergenic
1192059167 X:67805641-67805663 AAGAGAAAGCAGACTGGCAAGGG + Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192189825 X:68983943-68983965 AAGGGAAAGAAGACAAGGGATGG - Intergenic
1193052893 X:77120038-77120060 GGGGGAAAGAAGACTGAGGCTGG - Intergenic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1194375082 X:93122454-93122476 AAGGGAGAGTAGAGTGAGTAGGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195989332 X:110667093-110667115 AAAGGAAAGCAGTCTCAGGCTGG - Intergenic
1196883275 X:120219940-120219962 AAGGGCAAGTAGACAGAGGCTGG - Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199445887 X:147920468-147920490 AAAGGAAAACATACTGAAGAAGG - Intronic
1199700739 X:150373745-150373767 AAGGTACAGCGGGCTGAGGATGG - Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic