ID: 1126396072

View in Genome Browser
Species Human (GRCh38)
Location 15:48219252-48219274
Sequence GAAAACTTGTCGGCCGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 1, 1: 0, 2: 11, 3: 115, 4: 841}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126396072 Original CRISPR GAAAACTTGTCGGCCGGGTG TGG Intronic
900495091 1:2972585-2972607 GATACCTGCTCGGCCGGGTGGGG + Intergenic
901043471 1:6380307-6380329 AAACACCTTTCGGCCGGGTGTGG + Intronic
901418823 1:9136468-9136490 TAAAACTCCTTGGCCGGGTGCGG - Intergenic
901487469 1:9574921-9574943 GAACCCCTGTAGGCCGGGTGCGG + Intronic
901698963 1:11033036-11033058 AAAATATTGTCGGCCGGGCGCGG + Intronic
902102291 1:14001070-14001092 AAAATCATGTCGGCCGGGCGTGG - Intergenic
902118803 1:14144006-14144028 GAAAACTAGTTGGCCAGGTGCGG - Intergenic
902302208 1:15510218-15510240 GAAAAAATGTAGGCCGGGCGTGG - Intronic
902428199 1:16341678-16341700 TAAAAGTTCTGGGCCGGGTGCGG + Intronic
902452048 1:16502542-16502564 AAAAACTTGTAGGCCGGTTGTGG + Intergenic
902455559 1:16531335-16531357 AAAAACTTGTTGGCCGGGTGCGG - Intergenic
902481527 1:16714597-16714619 GAAAAATAGTTAGCCGGGTGTGG - Intergenic
902496619 1:16876560-16876582 AAAAACTTGTTGGCCGGGTGCGG + Intronic
903108819 1:21110076-21110098 TACAATTTGTTGGCCGGGTGTGG - Intronic
903630795 1:24768620-24768642 ATTAACATGTCGGCCGGGTGCGG + Intronic
903677776 1:25075364-25075386 CAAAACTATTAGGCCGGGTGCGG + Intergenic
903713654 1:25346076-25346098 GAAAACATATCGGCCGGGTGTGG - Intronic
904075231 1:27836706-27836728 AAAAACTTGCTGGCCGGGTGCGG - Intronic
904206381 1:28858083-28858105 GAAAAATCCTAGGCCGGGTGTGG - Intronic
904308252 1:29604914-29604936 TAAAACATTTAGGCCGGGTGCGG + Intergenic
904716285 1:32470208-32470230 GAAATCTTATTGGCCGGGCGTGG + Intronic
904755981 1:32768958-32768980 AAAATCTTGGCGGCCGGGTGCGG + Intronic
905015535 1:34775890-34775912 AAAAAATTGTTGGCTGGGTGCGG - Intronic
905569866 1:38994978-38995000 AAAAATTAGTAGGCCGGGTGTGG - Intronic
906067965 1:42995829-42995851 TAAACATTGTAGGCCGGGTGCGG - Intergenic
906092053 1:43188092-43188114 GAAAACATGCTGGCCAGGTGTGG - Intronic
906473369 1:46149819-46149841 GGTAACTTCTTGGCCGGGTGCGG - Intronic
907390557 1:54155360-54155382 GAAAGACTGTCGGCCGGGTGCGG + Intronic
908153482 1:61328707-61328729 AAAAAATTATAGGCCGGGTGCGG - Intronic
908197129 1:61756081-61756103 AAAAACTTGGTGGCCAGGTGCGG - Intronic
908208775 1:61878551-61878573 GAAAAGTTTTAGGCTGGGTGTGG + Intronic
908541653 1:65128135-65128157 GAATAACTGTTGGCCGGGTGTGG - Intergenic
908912808 1:69092379-69092401 GATAATTTCTAGGCCGGGTGTGG + Intergenic
910197546 1:84659503-84659525 GAAAAATTATTGGCCGGGCGCGG + Intronic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
910932358 1:92455071-92455093 TAAAAATTGCAGGCCGGGTGGGG - Intergenic
911077856 1:93896249-93896271 AAAAACCTTACGGCCGGGTGTGG - Intronic
911133875 1:94418654-94418676 AGAGACCTGTCGGCCGGGTGGGG - Intronic
911202082 1:95055700-95055722 TAAAACACCTCGGCCGGGTGTGG + Intronic
911531161 1:99044692-99044714 AAAACCTAGGCGGCCGGGTGTGG + Intergenic
912176266 1:107161368-107161390 CACAACTTATAGGCCGGGTGTGG + Intronic
912350056 1:109003972-109003994 GTAAACTAGCCGGCCGGGCGCGG + Intronic
912388840 1:109287577-109287599 TAAATTTTGTGGGCCGGGTGCGG - Intergenic
912918582 1:113842809-113842831 GAAAACTAAACGGCCGGGCGCGG + Intronic
913060867 1:115206175-115206197 TAAAAATTATTGGCCGGGTGCGG - Intergenic
913400183 1:118423203-118423225 GAAAATTTATCGGCCGGGCGCGG - Intergenic
914061802 1:144214244-144214266 AAAAAATTATCGGCTGGGTGCGG - Intergenic
914095894 1:144544149-144544171 TAATATTTGTTGGCCGGGTGCGG - Intergenic
914117348 1:144752110-144752132 AAAAAATTATCGGCTGGGTGCGG + Intergenic
914264678 1:146028211-146028233 AAAATTTTGTCGGCCGGGCGCGG + Intergenic
914302629 1:146389816-146389838 TAATATTTGTTGGCCGGGTGCGG + Intergenic
914922189 1:151854680-151854702 GAAGAGGTGTTGGCCGGGTGCGG - Intergenic
916014510 1:160737392-160737414 GAAAACTTGAAGGCTGGGTGTGG + Intergenic
916225629 1:162487255-162487277 GAAAATGTGGCGGCCGGGCGCGG - Intergenic
916336596 1:163677833-163677855 GAAACCTTCTCGGCCGGGCCCGG - Intergenic
916698262 1:167263227-167263249 AAAAACATGTCGGCCGAGTGTGG + Intronic
916803260 1:168233991-168234013 GAAGACTTATTGGCCGGGTGTGG + Intronic
917349207 1:174059226-174059248 AGAAATTTGTAGGCCGGGTGCGG + Intergenic
917658129 1:177148126-177148148 GAAAATTTTCAGGCCGGGTGTGG + Intronic
917766743 1:178228289-178228311 AAAAAATTGTGGGCCGGGTGCGG + Intronic
918168353 1:181972223-181972245 TAAAACTTGTTGGCTGAGTGTGG - Intergenic
918305363 1:183240955-183240977 AATCACTTGCCGGCCGGGTGTGG + Intronic
919329268 1:196148222-196148244 GAAATATTGCCGGCCGGGCGCGG - Intergenic
919480699 1:198085305-198085327 AAAAAATTGTCGGCCGGGCTCGG + Intergenic
919720484 1:200828865-200828887 AAAAACTTATGGGCCAGGTGCGG + Intronic
920109111 1:203574681-203574703 AAAGACTTGGGGGCCGGGTGTGG - Intergenic
920760975 1:208783446-208783468 GAAAACAAGGAGGCCGGGTGTGG - Intergenic
921140863 1:212305019-212305041 AAAAAATTGGGGGCCGGGTGTGG - Intronic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
921476455 1:215616468-215616490 AAAAACTTCCAGGCCGGGTGCGG + Intronic
922293961 1:224232648-224232670 AAAAAATTGTCTGCTGGGTGTGG - Intronic
922402332 1:225273140-225273162 TAAAAATTATTGGCCGGGTGTGG + Intronic
922648052 1:227310979-227311001 AAAAACTCCTTGGCCGGGTGCGG - Intronic
923229815 1:231974808-231974830 GAAATATTTTAGGCCGGGTGTGG + Intronic
923753918 1:236772959-236772981 AAAAACTTCCAGGCCGGGTGTGG - Intergenic
923780178 1:237015479-237015501 AAAAAGTTGTTGGCCGGGCGCGG + Intergenic
924031959 1:239894721-239894743 GAAGACTTCTCGGTCGGGCGCGG - Intronic
924371638 1:243357087-243357109 GGTAACTTTTGGGCCGGGTGTGG + Intronic
924754350 1:246928025-246928047 AAATACTGTTCGGCCGGGTGCGG + Intronic
1063055265 10:2497377-2497399 AAAAACTTACTGGCCGGGTGTGG - Intergenic
1063119704 10:3096786-3096808 GAAACCTGGGAGGCCGGGTGCGG + Intronic
1063212005 10:3889145-3889167 TAAAGCTAGTTGGCCGGGTGTGG - Intergenic
1063734765 10:8740333-8740355 GAAAACTAAGCGGCCGGGCGCGG - Intergenic
1063929245 10:11012701-11012723 GAAAACATGTCGTCGGGGTGGGG + Intronic
1063996073 10:11621182-11621204 GAAAAAATGTTGGCCGGGCGCGG + Intergenic
1063996814 10:11627368-11627390 TAAAAATTGTAGGCCGGGCGCGG - Intergenic
1064348133 10:14551433-14551455 GTAAGATTATCGGCCGGGTGAGG - Intronic
1064386277 10:14894655-14894677 AAAAACTTTGCGGCCGGGCGCGG - Intronic
1064401646 10:15026196-15026218 GACAAATTCTCGGCCGGGCGCGG - Intergenic
1064736295 10:18384987-18385009 GAACAGTTGCCGGCTGGGTGCGG + Intronic
1065097217 10:22293348-22293370 GAAAACTTGCAGGCCGGGCACGG - Intergenic
1065441517 10:25757046-25757068 GAAAGCTTTCCAGCCGGGTGCGG + Intergenic
1065671585 10:28124771-28124793 TAAAACTTGTGGGCCGGGCGTGG - Intronic
1065714938 10:28557403-28557425 GAATAGTTGTAGGCTGGGTGTGG + Intronic
1065982911 10:30919819-30919841 AAAAATTTGTCAGCCGGGCGCGG - Intronic
1066072072 10:31827499-31827521 AAAAACCTCTAGGCCGGGTGCGG + Intronic
1066321403 10:34307178-34307200 TAAAACTTTTGAGCCGGGTGCGG - Intronic
1066333366 10:34449205-34449227 GATAATTTATCTGCCGGGTGCGG - Intronic
1066348074 10:34608822-34608844 AAAAATTTGTAGGCTGGGTGCGG - Intronic
1066439299 10:35423182-35423204 TAAAAATTTTCGGCCAGGTGTGG + Intronic
1066533440 10:36365131-36365153 GAATAATTATTGGCCGGGTGCGG - Intergenic
1066579944 10:36869812-36869834 TTCAACTTGTCGGCCGGGCGCGG + Intergenic
1067001246 10:42615930-42615952 AAACAATTGTCGGCTGGGTGCGG + Intronic
1067241754 10:44501768-44501790 CAAAACATGTGGGCCGGGCGCGG - Intergenic
1067366103 10:45630439-45630461 GAAAAGGTATAGGCCGGGTGCGG + Intronic
1067410903 10:46063783-46063805 GAAACTTTCTCGGCCAGGTGCGG + Intergenic
1067887518 10:50103267-50103289 AGAAATATGTCGGCCGGGTGTGG + Intronic
1068081321 10:52321774-52321796 GAAACTTTTTCGGCCGGGCGCGG + Intergenic
1068284743 10:54920178-54920200 AAAAATTTCTCGGCCGGGAGCGG + Intronic
1068539122 10:58271328-58271350 AAAAAATAGTCGGCCGGGCGCGG - Intronic
1068655202 10:59567404-59567426 TAAAATTTGTTGGCCGGGTGCGG + Intergenic
1068979217 10:63043937-63043959 AAAAAACTGTCGGCCGGGCGCGG + Intergenic
1069009061 10:63350907-63350929 TAAAAATTTTGGGCCGGGTGCGG - Intronic
1069143037 10:64852202-64852224 AAACACTTGGAGGCCGGGTGTGG - Intergenic
1069216894 10:65832211-65832233 AGAAATTTGTTGGCCGGGTGCGG + Intergenic
1069369897 10:67736738-67736760 TAAAAAATGTGGGCCGGGTGTGG - Intergenic
1069439943 10:68418961-68418983 TAAAAATTGTGGGCCGGGCGCGG - Intronic
1070623498 10:78032173-78032195 GAAAAATAGTCGGCCGGGGACGG + Intergenic
1071708611 10:88026717-88026739 TAAAGCTTGTGGGCCGGGCGCGG + Intergenic
1071867640 10:89753906-89753928 AAAAACTTCTAGGCTGGGTGCGG - Intronic
1072045985 10:91655701-91655723 AAAAAATTGTTGGCCGGGCGTGG - Intergenic
1072080418 10:92024392-92024414 ATAAACTTCTGGGCCGGGTGTGG + Intronic
1072194807 10:93108145-93108167 GAATTATTGGCGGCCGGGTGCGG - Intergenic
1072318796 10:94228889-94228911 GAAAACGTGTAGGCCGGGCACGG + Intronic
1072339191 10:94430024-94430046 GAATACTTTTCGGCTGGGTGCGG - Intronic
1072461492 10:95622825-95622847 AAAAAATTCTGGGCCGGGTGCGG - Intronic
1073080643 10:100858218-100858240 GAAAGATTGTTGGCCGGGCGTGG - Intergenic
1073237851 10:102033706-102033728 GAAAACTAAGGGGCCGGGTGCGG - Intronic
1073334598 10:102696552-102696574 AAAAAACTGTTGGCCGGGTGCGG - Intronic
1073521130 10:104130705-104130727 GAACACTTGGAGGCCAGGTGTGG + Intronic
1073547839 10:104367147-104367169 ATAAACCTGTCGGCTGGGTGCGG - Intronic
1073720940 10:106170930-106170952 TAAAAAATGTCGGCTGGGTGTGG - Intergenic
1074165018 10:110867472-110867494 GAAAGTTTGCTGGCCGGGTGTGG - Intergenic
1074244329 10:111672529-111672551 GAAATTTTCTCGGCCGGGCGCGG - Intergenic
1074691617 10:116010745-116010767 AAAAAGTTGTCGGCCGGGCATGG + Intergenic
1075117707 10:119640761-119640783 GAAAAGGAGGCGGCCGGGTGTGG + Intergenic
1075152398 10:119945739-119945761 GAAAAAATCTCGGCCGGGCGCGG - Intergenic
1075365256 10:121882084-121882106 GAAAACCTGTAGGCCGGGCACGG - Intronic
1075515643 10:123105957-123105979 AAACTCTTGTCGGCCGGGCGCGG - Intergenic
1075617196 10:123899038-123899060 GGAAACTTTCAGGCCGGGTGCGG - Intronic
1075957309 10:126535225-126535247 AAAAATTTGTCAGCTGGGTGTGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076213299 10:128670199-128670221 GAAAACTTCTCGGCCAGGCGCGG - Intergenic
1076259341 10:129053343-129053365 AAAAAATTTTGGGCCGGGTGCGG - Intergenic
1077087417 11:761041-761063 GAAAACTTTTAGGCCGGGCACGG + Intronic
1077203072 11:1323087-1323109 AAAAACTAATCGGCCGGGTGCGG + Intergenic
1077293009 11:1808357-1808379 TAAAATTTATTGGCCGGGTGCGG + Intergenic
1077626877 11:3780229-3780251 GAAAACTTCCCTGCCAGGTGCGG + Intronic
1078679881 11:13465434-13465456 GAAAATTAATCGGCCGGGTTCGG + Intergenic
1079741681 11:24070062-24070084 AAAAACATGCTGGCCGGGTGCGG - Intergenic
1079745565 11:24124495-24124517 TAAAAGTTGTAGGCTGGGTGCGG - Intergenic
1080358874 11:31489185-31489207 TAAAACTTTTTGGCCGGGTGCGG - Intronic
1080379414 11:31752542-31752564 AAAAACTGGAAGGCCGGGTGCGG + Intronic
1081015786 11:37878302-37878324 TAAAATGTATCGGCCGGGTGCGG + Intergenic
1081897939 11:46603133-46603155 CAAAAATTAGCGGCCGGGTGCGG - Exonic
1082186679 11:49191020-49191042 AAAAACAGGTTGGCCGGGTGCGG + Intronic
1082186790 11:49191951-49191973 AAAAACAGGTTGGCCGGGTGCGG - Intronic
1082819496 11:57534971-57534993 AAAAATTTGTTGGCCGGGCGCGG - Intergenic
1083562981 11:63688510-63688532 AAAAACTTCTTGGCCGGGCGTGG - Intronic
1083947124 11:65930086-65930108 AAAAAATTTTAGGCCGGGTGTGG + Intergenic
1084016241 11:66384037-66384059 GACCTCTTGCCGGCCGGGTGCGG - Intergenic
1084100286 11:66943446-66943468 ATAAACTTCTCGGCCGGGTGCGG + Intronic
1084124401 11:67089525-67089547 ATCAAGTTGTCGGCCGGGTGCGG - Intergenic
1084160839 11:67349196-67349218 GAAGACTTGTGGGAAGGGTGGGG - Intronic
1084501009 11:69535334-69535356 GAAAATGTTTGGGCCGGGTGCGG + Intergenic
1084916884 11:72435099-72435121 CAAAAATTGTGGGCCGGGCGCGG - Intergenic
1084983993 11:72851448-72851470 TAAAGGTTGCCGGCCGGGTGAGG + Intronic
1085098980 11:73784286-73784308 GAAAACTTTTCGACCAAGTGTGG - Intergenic
1085142998 11:74166018-74166040 CACATCATGTCGGCCGGGTGCGG + Intronic
1085543463 11:77295276-77295298 GCAAAGTTGTGGGCTGGGTGTGG - Intronic
1085648687 11:78246787-78246809 TATCACTTCTCGGCCGGGTGCGG - Intronic
1085667707 11:78430165-78430187 AAAAACTTCTTGGCTGGGTGTGG + Intergenic
1086679664 11:89654349-89654371 AAAAACAGGTTGGCCGGGTGCGG - Intergenic
1086863500 11:91952295-91952317 GAAAACATCTCAGCCGGGCGTGG - Intergenic
1087010267 11:93507112-93507134 TAAAACTTCGGGGCCGGGTGCGG + Intronic
1087105470 11:94402834-94402856 GAAAGCTTGGGGGCCGGGCGCGG + Intergenic
1088055536 11:105571800-105571822 AAAAACGTTTCGGCCGGGTGTGG - Intergenic
1088248103 11:107838917-107838939 AGAAACTTATCGGCCAGGTGTGG - Intronic
1088611027 11:111577267-111577289 AAAAAGTTGTCGGCCAGGCGCGG + Intergenic
1089078164 11:115755625-115755647 GAAAACTTGCAGGCCTTGTGAGG + Intergenic
1089451015 11:118596917-118596939 AACAAATTCTCGGCCGGGTGCGG + Intronic
1089463617 11:118668153-118668175 GTAAATTTGTAGGCTGGGTGCGG - Intronic
1089592081 11:119548200-119548222 AAGAACTTATTGGCCGGGTGCGG + Intergenic
1089673071 11:120070279-120070301 TAAAAATTCTAGGCCGGGTGTGG + Intergenic
1090022862 11:123142914-123142936 GAAACCTCATCGGCCGGGCGCGG - Intronic
1090557374 11:127890993-127891015 GAAAAGTTGTAGGCTGGGCGCGG + Intergenic
1090720015 11:129463193-129463215 CAAAAATTCTCGGCCGGGCGCGG - Intergenic
1091431891 12:443069-443091 AAAAACTTGTGGGCTGGGTGTGG - Intergenic
1091504946 12:1057882-1057904 AAAAAATTTTAGGCCGGGTGCGG - Intronic
1091725317 12:2842449-2842471 GAAATGTTTTAGGCCGGGTGTGG + Intronic
1091865564 12:3833307-3833329 AAAAACTAGTAGGCCGGGCGTGG + Intronic
1092133637 12:6130561-6130583 ACATGCTTGTCGGCCGGGTGCGG - Intergenic
1092266706 12:6986822-6986844 TTACACCTGTCGGCCGGGTGCGG + Intronic
1092369529 12:7904979-7905001 AAAAACATATCGGCCGGGCGCGG - Intergenic
1092693177 12:11138746-11138768 GAAAACTTTTGGGCCAGGTGTGG + Intronic
1092790436 12:12066079-12066101 GAAAAACTCTCGGCCAGGTGCGG - Intronic
1093477384 12:19571062-19571084 GAAAATTGGTCGGCCGGGCACGG - Intronic
1093811922 12:23502158-23502180 GAAAACTCTTTGGCGGGGTGTGG - Intergenic
1094119022 12:26949420-26949442 GAAAAACTGTAGGCCAGGTGTGG - Intronic
1094364595 12:29666521-29666543 GAAAAGGGGTAGGCCGGGTGTGG - Intronic
1094541625 12:31367653-31367675 CAAAACTCCTTGGCCGGGTGCGG + Intergenic
1094614291 12:32022398-32022420 GAAAACTTCCCAGCTGGGTGCGG - Intergenic
1094637245 12:32238652-32238674 AAGAAATTGTCAGCCGGGTGTGG + Intronic
1095154306 12:38833766-38833788 TAAAAATTGGTGGCCGGGTGCGG - Intronic
1095304561 12:40624545-40624567 AAAAAAATGTCGGCCGGGCGCGG + Intergenic
1096076222 12:48806978-48807000 TAAAACTTCTAGGCCGGGCGCGG + Intergenic
1096154395 12:49333901-49333923 TAAAATTTGTCGGCCAGGCGCGG + Intronic
1096576657 12:52557040-52557062 TAAAAATTGTAGGCCGGGTGTGG + Intergenic
1096998832 12:55858730-55858752 AAAAAAATATCGGCCGGGTGTGG - Intergenic
1097056137 12:56250591-56250613 GAAAAATTGTGGGCTAGGTGTGG + Intronic
1097220323 12:57446224-57446246 AAAAATTTTTAGGCCGGGTGTGG - Intronic
1097511515 12:60547920-60547942 AAAAAATTGGGGGCCGGGTGTGG + Intergenic
1097646116 12:62236553-62236575 GAAAACATTTGGGCTGGGTGCGG - Intronic
1097980415 12:65732460-65732482 AAAAAATAGTTGGCCGGGTGCGG + Intergenic
1098420013 12:70285504-70285526 GATAACTTTGCGGCCAGGTGCGG - Intronic
1099038678 12:77622447-77622469 GACAGCTTGGGGGCCGGGTGCGG - Intergenic
1100184620 12:92126177-92126199 GTAAGGTTCTCGGCCGGGTGCGG + Intronic
1100200493 12:92293185-92293207 TAAAAATTGCCGGCCGGGCGCGG + Intergenic
1100211980 12:92407166-92407188 AGAATCTTGTAGGCCGGGTGTGG + Intergenic
1100487145 12:95041195-95041217 AAAAACTGGCAGGCCGGGTGTGG + Intronic
1100797420 12:98196982-98197004 TAAACCTTATCGGCCGGGTGTGG - Intergenic
1100851881 12:98720673-98720695 GAAAAGTTTCCAGCCGGGTGCGG + Intronic
1101366203 12:104072932-104072954 GAAACCAAATCGGCCGGGTGCGG - Intronic
1101454689 12:104818586-104818608 GAAAACAGGACAGCCGGGTGCGG + Intronic
1102165097 12:110799733-110799755 CAAGACTTATGGGCCGGGTGTGG - Intergenic
1102169852 12:110834132-110834154 GAAAAAGAGTCGGCCGGGTGCGG + Intergenic
1102192664 12:111000627-111000649 GTAAAGTTGTAGGCCAGGTGTGG - Intergenic
1102271650 12:111541621-111541643 CATAACTTGTCAGCTGGGTGCGG - Intronic
1102472342 12:113166408-113166430 AAAACTTTGTTGGCCGGGTGCGG + Intronic
1102848941 12:116220084-116220106 AAAAACTGGTAGGCTGGGTGCGG - Intronic
1102870801 12:116412514-116412536 CAAAACAGGCCGGCCGGGTGCGG - Intergenic
1103090546 12:118095191-118095213 CAAAAAATGCCGGCCGGGTGCGG - Intronic
1103114530 12:118315213-118315235 GAAAAATTTTCTGCTGGGTGTGG - Intronic
1103511138 12:121475296-121475318 CAAAACTTGGAGGCCAGGTGTGG + Intronic
1103514608 12:121499409-121499431 AAAAAATTATTGGCCGGGTGTGG - Intronic
1103576175 12:121878992-121879014 CATAACTTATAGGCCGGGTGAGG + Intergenic
1103688288 12:122750336-122750358 AAAAACTTGTAAGCCGGGCGCGG + Intergenic
1103688485 12:122751869-122751891 AAAAAATTGTAGGCCGGGCGCGG + Intergenic
1104869454 12:131984186-131984208 AAGAACCTGTAGGCCGGGTGCGG - Intronic
1105607096 13:21934976-21934998 GAAAACTTCTCGGCCAGGCAAGG - Intergenic
1105693649 13:22866521-22866543 GAAAATATGTTGGCCGGGCGCGG + Intergenic
1105877056 13:24565721-24565743 AAAAAATTTTCAGCCGGGTGAGG - Intergenic
1106195313 13:27488663-27488685 AAAAAATTAGCGGCCGGGTGCGG + Intergenic
1106311997 13:28562879-28562901 GAAACCTAGTAGGCCCGGTGGGG + Intergenic
1106590188 13:31091992-31092014 GAAATGTTTTCGGCCGGGCGCGG - Intergenic
1106600139 13:31180599-31180621 TAAAAATTTTTGGCCGGGTGCGG + Intergenic
1106601019 13:31187084-31187106 GAAAACATTGCGGCCGGGTGCGG + Intergenic
1106904479 13:34390801-34390823 GCAAATTTCTGGGCCGGGTGCGG - Intergenic
1107194407 13:37631404-37631426 AAAACCTTGTGGGCTGGGTGCGG + Intergenic
1107827787 13:44345099-44345121 GCAAACCTGTTGGCTGGGTGTGG - Intergenic
1108420102 13:50240065-50240087 AAAAAATAGTGGGCCGGGTGCGG - Intronic
1109504702 13:63285169-63285191 GAAAAATTATTGGCCGGGTGCGG - Intergenic
1109705480 13:66086037-66086059 GAAAAGTTATAGGCCGGGCGCGG + Intergenic
1109864067 13:68239396-68239418 AAAAAGCTGTAGGCCGGGTGCGG + Intergenic
1111230126 13:85334437-85334459 GGAAAAAAGTCGGCCGGGTGTGG - Intergenic
1111531550 13:89543181-89543203 GAAAATTTGTTGGCCGGGAGCGG + Intergenic
1111594863 13:90398727-90398749 GAAAACATAAGGGCCGGGTGTGG + Intergenic
1111831877 13:93340322-93340344 GAAAACTTTTGGGCCGGGCACGG - Intronic
1112710421 13:102120992-102121014 GATCACTTTTCGGCCGGGCGCGG - Intronic
1113458180 13:110463824-110463846 GTAAAAATGTGGGCCGGGTGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1113988154 13:114335889-114335911 ACAAACATGTGGGCCGGGTGTGG + Intergenic
1114005925 14:18313263-18313285 GAAAATTTGTAGGCCGGGCGCGG - Intergenic
1114162676 14:20186896-20186918 GAAAATTTCTAGGCTGGGTGTGG + Intergenic
1114372984 14:22110824-22110846 GAACAGTTGTCGGCCGGGCGCGG - Intergenic
1114496332 14:23135410-23135432 GAAAAGTTTTAGGCCAGGTGCGG + Intronic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1114734975 14:25034858-25034880 GAAAACTTCTTGGCCGGGTGTGG + Intronic
1114771403 14:25431301-25431323 GAGAACTTGTCGACCTGCTGTGG - Intergenic
1114931592 14:27475351-27475373 AAAAACTTGTCGGCTGGGCGCGG - Intergenic
1115064658 14:29243281-29243303 GAAAACTTGTTAGCAGGATGAGG - Intergenic
1115178497 14:30594397-30594419 TAAAAGATGTAGGCCGGGTGTGG + Intronic
1115258426 14:31427509-31427531 GATTATTTGTCGGCCGGGCGTGG + Intronic
1115343874 14:32321593-32321615 AAACACTGGTCGGCCAGGTGTGG + Intergenic
1115397314 14:32922997-32923019 GAATACTTGGCGGCCAGGTGCGG + Intergenic
1116449572 14:45049547-45049569 GAGAACTTTCTGGCCGGGTGCGG - Intronic
1116794584 14:49376052-49376074 GTAAAATAGTTGGCCGGGTGCGG + Intergenic
1117563509 14:56969580-56969602 GAAAAACTTTTGGCCGGGTGCGG - Intergenic
1117718303 14:58603272-58603294 GCAAACTTGTAGGCTGGGCGTGG - Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118580783 14:67295170-67295192 GAACTCTTGTTGGCTGGGTGCGG + Intronic
1118750288 14:68802579-68802601 GAAAAGGTGTTGGCCCGGTGTGG + Intergenic
1118991210 14:70798766-70798788 TAAAACTTTTGGGCCGGGCGCGG - Intronic
1119006309 14:70932900-70932922 AAAAACTTCTTGGCCGGGCGTGG - Intronic
1119240587 14:73056278-73056300 GAAACCATCTTGGCCGGGTGCGG - Intergenic
1119276026 14:73357110-73357132 TAAAAAGTGTTGGCCGGGTGTGG + Intronic
1119706543 14:76786450-76786472 GAAAACTTAGCGGCCGGGTGCGG - Intergenic
1120412752 14:84177886-84177908 GAAAAGTTATAGGCCGGGCGCGG + Intergenic
1121345704 14:93134221-93134243 AAAAAAAAGTCGGCCGGGTGCGG - Intergenic
1121716771 14:96081888-96081910 AAACATTTGTTGGCCGGGTGCGG - Intronic
1122167243 14:99837070-99837092 GAAGACTTGAGGGCAGGGTGTGG + Intronic
1122535550 14:102459487-102459509 AAAAACTTGTCGGCCAGGCATGG + Intronic
1122556222 14:102581842-102581864 AATAATTTGTTGGCCGGGTGTGG + Intergenic
1122562614 14:102627364-102627386 AAAAACTTTTTTGCCGGGTGTGG + Intronic
1122746963 14:103903326-103903348 GAAAAGTTTCTGGCCGGGTGCGG - Intergenic
1202915321 14_GL000194v1_random:165370-165392 GAAAATTAGTGGGCCGGGCGCGG + Intergenic
1123690552 15:22835182-22835204 AAATACTTGCAGGCCGGGTGCGG - Intergenic
1123900871 15:24875761-24875783 TAAAAATTTTAGGCCGGGTGCGG + Intronic
1124418416 15:29493421-29493443 AAAGAGTTGTCGGCCGGGCGCGG - Intronic
1124437298 15:29661487-29661509 TACATCTTCTCGGCCGGGTGTGG - Intergenic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124525169 15:30444369-30444391 TAAAATCTGTCGGCCGGCTGCGG + Intergenic
1124773487 15:32563344-32563366 TAAAATCTGTCGGCCGGCTGCGG - Intergenic
1125018595 15:34962476-34962498 GATTACTGGTTGGCCGGGTGTGG + Intronic
1125258919 15:37799721-37799743 TTAAACATATCGGCCGGGTGCGG - Intergenic
1125313418 15:38405024-38405046 GAAAATATATCGGCCAGGTGCGG - Intergenic
1125495293 15:40187414-40187436 AAAAAATTGTTGACCGGGTGCGG - Intronic
1125497348 15:40209127-40209149 AAGAAGTTGCCGGCCGGGTGCGG + Intronic
1125543674 15:40487432-40487454 AAAAAATTGTTGGCCGGGCGCGG + Intergenic
1125547366 15:40516121-40516143 AAAGACTTATTGGCCGGGTGGGG - Intergenic
1125626486 15:41113556-41113578 GAAAGTTTGTTGGCCGGGTGCGG - Intronic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1125929037 15:43586517-43586539 AAAAACTTTTTGGCCGGGTATGG - Intronic
1125942204 15:43686352-43686374 AAAAACTTTTTGGCCGGGTATGG - Intergenic
1126155301 15:45560286-45560308 GAAAACTTTTTGGCTGGGCGTGG - Intergenic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1127368228 15:58310979-58311001 TAAAAATTCTTGGCCGGGTGCGG + Intronic
1127463101 15:59217816-59217838 TAAAACTAGTAGGCTGGGTGCGG - Intronic
1127903164 15:63356100-63356122 TAAAAATTGTCGGCCGGGCACGG + Intronic
1128039461 15:64557972-64557994 GAAAATCTTTCGGCCGGGCGCGG - Intronic
1128042316 15:64586032-64586054 GGGATCTTGCCGGCCGGGTGCGG + Intronic
1128076443 15:64829240-64829262 GAAAAATTTTCAGCTGGGTGTGG + Intergenic
1128641208 15:69339173-69339195 GATAACTTGGTGGCGGGGTGGGG - Intronic
1128654620 15:69451487-69451509 AAAAACTGATCTGCCGGGTGCGG - Intergenic
1128662952 15:69515817-69515839 TAAAACTTGTTGGCTGGGTGTGG + Intergenic
1128755005 15:70176885-70176907 GAAGACTTATGGGCCGGGTGTGG + Intergenic
1129036618 15:72654045-72654067 CAAAGCTTTTGGGCCGGGTGTGG - Intergenic
1129213269 15:74083180-74083202 CAAAGCTTTTGGGCCGGGTGTGG + Intergenic
1129306310 15:74666086-74666108 TATAATCTGTCGGCCGGGTGTGG - Intronic
1129397131 15:75257906-75257928 CAAAGCTTTTGGGCCGGGTGTGG - Intergenic
1129400742 15:75282183-75282205 CAAAGCTTTTGGGCCGGGTGTGG - Intronic
1129593938 15:76944269-76944291 CAAAACATCTCGGCCGGGCGCGG - Intronic
1129611755 15:77065695-77065717 TAAAACTTATCAGCCAGGTGCGG - Intronic
1129637163 15:77332307-77332329 AAAAATTTTTTGGCCGGGTGCGG + Intronic
1129730399 15:77927493-77927515 CAAAGCTTTTGGGCCGGGTGTGG + Intergenic
1130044037 15:80430316-80430338 GAAAAGTGGCCAGCCGGGTGTGG - Intronic
1130174634 15:81555351-81555373 AAAAATGTGTCGGCTGGGTGCGG - Intergenic
1130260472 15:82350076-82350098 CAAAGCTTTTGGGCCGGGTGCGG + Intergenic
1130280760 15:82518928-82518950 CAAAGCTTTTGGGCCGGGTGCGG - Intergenic
1130474765 15:84254833-84254855 AAAAACAAGTTGGCCGGGTGCGG - Intergenic
1130482181 15:84368889-84368911 AAAAACAAGTTGGCCGGGTGCGG - Intergenic
1130568129 15:85015844-85015866 GATGACTTGTCGGCTGGGCGTGG + Intronic
1130594431 15:85239751-85239773 CAAAGCTTTTGGGCCGGGTGCGG - Intergenic
1131030858 15:89185042-89185064 GAAAACTTGCCTGCCAGGTAGGG + Intronic
1131169898 15:90170419-90170441 AAAACCCTGTCGGCCGGGCGCGG + Intronic
1131845115 15:96482855-96482877 GAAACCATATTGGCCGGGTGCGG - Intergenic
1132021445 15:98366011-98366033 GGATACTAGTCGGCCAGGTGCGG - Intergenic
1132791087 16:1688581-1688603 CAAATCTTGTAGGCCAGGTGCGG + Intronic
1132867573 16:2101272-2101294 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1133219723 16:4314993-4315015 GAAAACAGCTGGGCCGGGTGCGG + Exonic
1133265085 16:4578467-4578489 AAAAACTAATAGGCCGGGTGCGG + Intronic
1133715479 16:8443181-8443203 AAAAACTTTTAGGCCGGGTGCGG - Intergenic
1134055129 16:11165198-11165220 GAACACGTATCGGCCAGGTGTGG + Intronic
1134129574 16:11640062-11640084 GACACATTGTTGGCCGGGTGCGG - Intergenic
1134524207 16:14931841-14931863 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1134548698 16:15129093-15129115 TAAAAACTGTCGGCCGGGCGCGG - Intronic
1134649200 16:15895269-15895291 AAAAACTTGTAGGCCGGGCGCGG + Intergenic
1134676262 16:16092697-16092719 GAAAAGTTGGTGGCCGGGTGTGG + Intronic
1134711796 16:16330327-16330349 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1134719648 16:16373621-16373643 TAAAAACTGTCGGCCGGGCGCGG + Intergenic
1134947778 16:18338264-18338286 TAAAAACTGTCGGCCGGGCGTGG - Intergenic
1134955032 16:18378366-18378388 TAAAAACTGTCGGCCGGGTGCGG - Intergenic
1135041942 16:19124179-19124201 AAAGACTTGTCGGCAGGGCGTGG + Intronic
1135594209 16:23729036-23729058 AAAATATTTTCGGCCGGGTGCGG - Intergenic
1136056931 16:27697017-27697039 GAAAATGTGGAGGCCGGGTGTGG - Intronic
1136316812 16:29459277-29459299 GAAAGCTTGTCGGCCAGGCATGG + Intergenic
1136431387 16:30198619-30198641 GAAAGCTTGTCGGCCAGGCATGG + Intronic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1138464047 16:57174003-57174025 AAAAAATTCTCGGCCGGGTGCGG + Intronic
1138901629 16:61276981-61277003 AAAACCTTTTCGGCCGGGCGCGG - Intergenic
1139539627 16:67604629-67604651 AAAAAATTGTTGGCCGGGTATGG - Intronic
1139688322 16:68621818-68621840 GAACCCTTGTGGGCTGGGTGTGG + Intergenic
1139723660 16:68877896-68877918 AAAAATTTTTTGGCCGGGTGTGG - Intronic
1139749943 16:69103685-69103707 GAAAACTGCCTGGCCGGGTGTGG - Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140428505 16:74881582-74881604 AAATACTTCTTGGCCGGGTGTGG + Intronic
1140788533 16:78367267-78367289 TATAACTTTTCGGCTGGGTGCGG - Intronic
1141713673 16:85714864-85714886 GAGAACATTTCAGCCGGGTGCGG + Intronic
1142303578 16:89273409-89273431 GAAAATCTGTCGGCTGGGTGCGG + Intronic
1142322002 16:89389313-89389335 GCAAAGTTGTAGGTCGGGTGTGG - Intronic
1142564817 17:833179-833201 AATAACTTTTCGGCCGGGTGCGG - Intronic
1142665323 17:1459783-1459805 GAAGACATTTGGGCCGGGTGCGG - Intronic
1142721880 17:1781820-1781842 GAAAACTTTGAGGCCGGGTGTGG - Intronic
1142859898 17:2755312-2755334 GTAAACTACTCGGCCGGGCGCGG - Intergenic
1142975858 17:3643855-3643877 AAAAAATTTTTGGCCGGGTGCGG - Intronic
1143216157 17:5226797-5226819 AAAAATGTGTCGGCCGGGCGTGG - Intronic
1143592850 17:7895933-7895955 AAAAAATTCTCGGCTGGGTGTGG + Intronic
1143656673 17:8298414-8298436 GAAAAATTTTAGGCTGGGTGTGG - Intergenic
1144162113 17:12569807-12569829 AAAAATTATTCGGCCGGGTGTGG - Intergenic
1144427718 17:15159806-15159828 GAAAACCTGTTGGCCGGGCGCGG + Intergenic
1144845269 17:18214550-18214572 AAAAATTTGTAGGCCGGGCGTGG + Intergenic
1144933717 17:18880697-18880719 GATAACAAGTCAGCCGGGTGTGG - Intronic
1145028976 17:19490182-19490204 AAAAAAATGTCGGCCGGGCGTGG + Intergenic
1145762775 17:27435822-27435844 AAAAATTGGTGGGCCGGGTGGGG + Intergenic
1145874021 17:28302131-28302153 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1145951778 17:28824165-28824187 AAAAAATTCTCGGCCGGGCGTGG - Intronic
1146060581 17:29604033-29604055 TAAAACTTATAGGCAGGGTGCGG - Intronic
1146144651 17:30402814-30402836 TAATACTTGTTGGCTGGGTGTGG + Intronic
1146802718 17:35839670-35839692 AAAAGCATCTCGGCCGGGTGCGG - Intronic
1146899011 17:36569119-36569141 GGAAACTGGTGGGCAGGGTGCGG + Intronic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1147227131 17:38987958-38987980 TAAAAATGGTTGGCCGGGTGCGG - Intergenic
1147287351 17:39412823-39412845 GAAAAATTTGCGGCCGGGTGCGG - Intronic
1147608635 17:41788254-41788276 GAGAACTTCTCGGCCAGGCGTGG + Intergenic
1147714798 17:42498535-42498557 TAAAAATTGTCGACCGGGCGCGG + Intronic
1148201850 17:45754340-45754362 AAAAACTTTTAGGCTGGGTGTGG + Intergenic
1148712799 17:49693991-49694013 AAAAATTGGTGGGCCGGGTGTGG + Intergenic
1149708505 17:58717446-58717468 GAAAAGCTGCCGGCCGGGTGTGG + Intronic
1149749025 17:59127675-59127697 AAAAAATTGTGGGCTGGGTGTGG - Intronic
1149854331 17:60066978-60067000 GAGAACAAGTCGGCCGGGCGCGG + Intronic
1149957549 17:61069545-61069567 GAAAACTTTCAGGCCAGGTGTGG + Intronic
1150324235 17:64243215-64243237 AAAAAATTTTTGGCCGGGTGTGG - Intronic
1150383341 17:64738175-64738197 TAGAACATTTCGGCCGGGTGTGG - Intergenic
1150536361 17:66046330-66046352 AAAAACTTTTTGGCCGGGCGTGG - Intronic
1150746938 17:67824417-67824439 GAAAAATAGTTGGCCGGGCGTGG - Intergenic
1150795348 17:68232548-68232570 GAAAACCTTTGGGCTGGGTGTGG + Intergenic
1151232465 17:72694671-72694693 GGAACCTTGTGGGCAGGGTGGGG + Intronic
1151276090 17:73035428-73035450 AATAACTTTTTGGCCGGGTGCGG - Intronic
1151511070 17:74560543-74560565 AAAAAAATGTAGGCCGGGTGCGG - Intergenic
1151533549 17:74723862-74723884 GAAAATGTTACGGCCGGGTGCGG - Intronic
1151595089 17:75073565-75073587 AAAAAAGTGTCAGCCGGGTGAGG - Intergenic
1151645918 17:75431647-75431669 GAAACTTTCTCGGCCGGGCGCGG + Intergenic
1152104365 17:78320184-78320206 TAAAACATGTAGGCCGAGTGCGG + Intergenic
1152456099 17:80417043-80417065 GAGGACTTGTGGGCTGGGTGTGG - Intronic
1154251008 18:12745033-12745055 AAAAAATTGTCGGCTGGGTGCGG - Intergenic
1154531555 18:15350930-15350952 GAAAATTTGTAGGCCGGGCGCGG + Intergenic
1154993734 18:21620242-21620264 AAAAATTAGTTGGCCGGGTGCGG - Intronic
1155575511 18:27241795-27241817 GAAAAGTTCTAGGCTGGGTGCGG + Intergenic
1155953858 18:31940785-31940807 AAAAAATTTTCGGCCGGGCGCGG - Intronic
1156313743 18:35948711-35948733 TAAAACTTGCCGGCCGGGCGCGG - Intergenic
1156321182 18:36024444-36024466 GATAACTGTTGGGCCGGGTGTGG - Intronic
1156564880 18:38176472-38176494 GAAATATTGTGGGCCGGGCGTGG + Intergenic
1156567203 18:38205480-38205502 GAGTACTTGTAGGCTGGGTGTGG + Intergenic
1156587842 18:38452125-38452147 GAAAAGTTCTAGGCCGGGTGTGG + Intergenic
1157237580 18:45978959-45978981 AAAAAATTGAAGGCCGGGTGAGG - Intergenic
1157660238 18:49434915-49434937 AAAAACTTTTGGGCCAGGTGTGG + Intronic
1157690217 18:49675676-49675698 GAAAAAATGTGGGCCGGGTGCGG + Intergenic
1157696425 18:49727285-49727307 GAAAACTTCTCGGCTGGGCTTGG - Intergenic
1158334270 18:56398456-56398478 GAATGCATGTAGGCCGGGTGTGG - Intergenic
1158534638 18:58296629-58296651 GGACACTTGTGGGCCGGGCGCGG + Intronic
1158914852 18:62114069-62114091 AAAAAAATGTGGGCCGGGTGCGG + Intronic
1158919430 18:62173923-62173945 GATCATTTCTCGGCCGGGTGCGG + Intronic
1158954900 18:62528302-62528324 GAAAACCTTGCGGCCAGGTGCGG + Intronic
1160275016 18:77423926-77423948 AAATAAATGTCGGCCGGGTGCGG + Intergenic
1160830224 19:1101066-1101088 AAAAACTTTTTGGCTGGGTGCGG - Intergenic
1160882560 19:1328103-1328125 AAAAACTGCTCGGCTGGGTGAGG - Intergenic
1160959602 19:1713739-1713761 GAAAATTTTTAGGCCGGGCGTGG + Intergenic
1161024192 19:2027961-2027983 GAGGGCTTGTCGGCCGGGCGCGG - Intronic
1161123543 19:2543513-2543535 GAAAAATTGCAGGCCGGGAGCGG - Intronic
1161185002 19:2911674-2911696 GAAAACTTCTAGGTTGGGTGCGG - Intronic
1161372238 19:3919301-3919323 TAAAAATTATCGGCCGGGTGTGG + Intronic
1161722700 19:5912452-5912474 AAAAATTAGTCAGCCGGGTGCGG - Intronic
1161837769 19:6659627-6659649 CAAAATTTCTCGGCCGGGCGCGG - Intergenic
1161923983 19:7287450-7287472 GAATACTTCTGGGCCAGGTGTGG - Intronic
1162048864 19:8019922-8019944 GAAAATTTATTGGCCGGGCGCGG + Intronic
1162579209 19:11518134-11518156 AAAAAATTAGCGGCCGGGTGCGG + Intronic
1162581450 19:11533547-11533569 GAATGCTTGACGGCCGGGTGTGG - Intergenic
1162891869 19:13739299-13739321 GAAAATATGTCAGCTGGGTGTGG - Intronic
1162903571 19:13809768-13809790 CAAAACATGTAGGCTGGGTGTGG - Intronic
1163135626 19:15309044-15309066 AAAAACTTTAGGGCCGGGTGCGG + Intronic
1163140789 19:15347143-15347165 TAAAAATTTTGGGCCGGGTGCGG - Intergenic
1163216620 19:15883768-15883790 GAAAATGTGGCGGCCGGGTGCGG + Intronic
1163342835 19:16720841-16720863 GAAAAAGTCTCGGCCAGGTGCGG - Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163909689 19:20177864-20177886 GAAAACGTTTTGGCTGGGTGTGG - Intronic
1163930283 19:20383652-20383674 GAAAAATTTTTGGCCAGGTGCGG - Intergenic
1163994658 19:21032435-21032457 AAAAATTTGTTGGCTGGGTGTGG + Intronic
1163996623 19:21054962-21054984 GAAAAAATGACGGCCGGGCGCGG - Intronic
1164050615 19:21583279-21583301 GAAAATGTTTGGGCCGGGTGCGG - Intergenic
1165018613 19:32903868-32903890 GAAACCATGCTGGCCGGGTGTGG + Intronic
1165048018 19:33121607-33121629 GGAGACTTGGCGGCCGGGTGCGG - Intronic
1165296719 19:34933163-34933185 TAAAACCTTTCGGCTGGGTGTGG + Intronic
1165426582 19:35749181-35749203 GAGAACTTCTCGGCTGGGCGCGG - Intronic
1165498195 19:36166704-36166726 GAAAACTTGTTGGCCCGGCATGG - Intergenic
1165661491 19:37584670-37584692 GACAAATTCTCGGCCGGGCGCGG + Intronic
1165921758 19:39303308-39303330 GAAATCTTGTTGGCTGGGTGTGG - Intergenic
1166132564 19:40755006-40755028 GAAAATGTGTAGGCTGGGTGGGG - Intronic
1166189931 19:41169775-41169797 GAAAAATTTTCGGCCGGTCGCGG - Intergenic
1166288446 19:41846855-41846877 AAAAATTTTTAGGCCGGGTGCGG - Intronic
1166675985 19:44741395-44741417 AAAAACCTGTTGGCTGGGTGTGG - Intergenic
1166725376 19:45024129-45024151 GAAAACTTCAGGGCCAGGTGCGG - Intronic
1166845504 19:45725447-45725469 AAACACTTGTGGGCCAGGTGCGG + Intronic
1166871702 19:45874938-45874960 GAAAACATGTAGTCTGGGTGTGG + Intergenic
1167234899 19:48308464-48308486 AAACACTTCTCGGCTGGGTGTGG - Intronic
1167408719 19:49332264-49332286 GGACACTTGTCAGCCGGGTGCGG + Intergenic
1167497457 19:49827937-49827959 CAACAAATGTCGGCCGGGTGTGG + Intronic
1167892550 19:52552305-52552327 AAAAATTTTTGGGCCGGGTGCGG - Intronic
1168143125 19:54402924-54402946 AAAGACTTGTTGGCCGGGCGCGG - Intergenic
1168505482 19:56930377-56930399 AAAAAATTGTGGGCTGGGTGTGG - Intergenic
1168592663 19:57650356-57650378 GTATAATTTTCGGCCGGGTGTGG + Intergenic
1168628456 19:57937546-57937568 TAAAACTTCTGGGCCGGGCGAGG - Intergenic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
1202715566 1_KI270714v1_random:40508-40530 GAAAAATAGTTAGCCGGGTGTGG - Intergenic
925076037 2:1016529-1016551 ATAAAGTTGTCGGCCGGGCGTGG - Intronic
925393685 2:3517473-3517495 GAAAGCATATAGGCCGGGTGCGG + Intronic
925798093 2:7568397-7568419 GAAAAGTTGTCGGCAGTGGGGGG - Intergenic
925929468 2:8695352-8695374 GAAACCATGTTAGCCGGGTGTGG - Intergenic
927555466 2:24028099-24028121 AAAAACCTATCGGCTGGGTGTGG + Intronic
928140320 2:28723213-28723235 GAAACCCTGTTGGCTGGGTGAGG + Intergenic
928262298 2:29778863-29778885 GAAAACCTTAAGGCCGGGTGCGG + Intronic
928496766 2:31840635-31840657 AAGAACTAGTCAGCCGGGTGCGG - Intergenic
928946088 2:36773452-36773474 TAAAATTTATTGGCCGGGTGTGG + Intronic
928957602 2:36887136-36887158 AAGAACTTCTCGGCCAGGTGGGG + Intronic
928968324 2:36999720-36999742 TAAAACCTCCCGGCCGGGTGCGG + Intronic
929739137 2:44584762-44584784 AAAAAATAGTAGGCCGGGTGCGG + Intronic
930565567 2:53015140-53015162 GAAAGTTTGGGGGCCGGGTGCGG - Intergenic
930756746 2:54982244-54982266 TCATACTTGTGGGCCGGGTGTGG - Intronic
930811485 2:55546416-55546438 AGAAACTTGCAGGCCGGGTGTGG + Intergenic
931060605 2:58524640-58524662 AAGAATTTGTTGGCCGGGTGTGG - Intergenic
931133186 2:59363326-59363348 GAATGCTTGTGGGCCAGGTGTGG + Intergenic
932170262 2:69548891-69548913 AACAGCTTGTTGGCCGGGTGTGG - Intronic
932798819 2:74721224-74721246 GAAAAGATATAGGCCGGGTGCGG - Intergenic
933063862 2:77770517-77770539 CACAACTTTTCGGCTGGGTGCGG + Intergenic
933145748 2:78850243-78850265 GAAAACTATTTGGCCGGGCGCGG - Intergenic
933155918 2:78974345-78974367 TAAAACATGTCGGCCGGGCGCGG - Intergenic
933309272 2:80639810-80639832 AAATATTTGTCGGCCGGGCGCGG + Intronic
933824664 2:86148316-86148338 GAAAATTAGTTGGCCGGGCGTGG + Intronic
933906358 2:86897678-86897700 AAAACCTTCTGGGCCGGGTGTGG + Intergenic
934021244 2:87955303-87955325 AAGAACTTTTCGGCCGGGCGCGG - Intergenic
934172130 2:89549578-89549600 AAAAAATTATCGGCTGGGTGCGG - Intergenic
934547811 2:95233381-95233403 AAAAACATCTCGGCCGGGCGCGG + Intronic
934750430 2:96790294-96790316 AAAAAATTCTAGGCCGGGTGCGG - Intronic
934888884 2:98048306-98048328 GAAAAGTTCAAGGCCGGGTGTGG - Intergenic
935040971 2:99426891-99426913 AAAAAATTGCTGGCCGGGTGCGG + Intronic
935137067 2:100316028-100316050 GAAAATTTTCTGGCCGGGTGCGG + Intronic
935776189 2:106474079-106474101 AAAACCTTCTGGGCCGGGTGCGG - Intergenic
935999505 2:108812957-108812979 GAAAATTTCTCGGCTGGGTACGG + Intronic
936011718 2:108929315-108929337 GAAAACTTCTCCGCCGGGCAGGG + Exonic
936518677 2:113198534-113198556 GAAAATTTGGAGGCCCGGTGCGG - Intronic
936785560 2:116090009-116090031 GAAAACCTGTAGGCCGGGCGCGG - Intergenic
937979177 2:127603841-127603863 GAAAATCTGTTGGCCAGGTGTGG + Intronic
938367401 2:130745567-130745589 GAAAATTTCCCGGCCGGGCGCGG + Intergenic
938831689 2:135056124-135056146 GGAAATATGTCGGCCGGGCGTGG - Intronic
938940473 2:136165127-136165149 GAAAAGTTGAGGGCCGGGTGCGG + Intergenic
939375851 2:141365961-141365983 TAGAACTTGTTGGCCGGGTGCGG - Intronic
939963171 2:148584271-148584293 AAAAACATTTAGGCCGGGTGTGG + Intergenic
940257120 2:151743004-151743026 CAAAAATTGCAGGCCGGGTGTGG - Intergenic
941096305 2:161242600-161242622 TTAAAGTTGTCGGCCAGGTGAGG + Intergenic
941134682 2:161699308-161699330 TAATAAATGTCGGCCGGGTGCGG - Intronic
941151250 2:161918444-161918466 TAAAACTTCTAGGCCAGGTGTGG - Intronic
941506999 2:166358358-166358380 AAGAAGTTTTCGGCCGGGTGTGG - Intronic
942561749 2:177227077-177227099 GAAAACTTCAGGGCCGGGTGTGG - Intergenic
942795124 2:179808320-179808342 TAAAAATTATAGGCCGGGTGCGG - Intronic
944025914 2:195166879-195166901 AAAAACTTTTCGGCCGGGCGCGG - Intergenic
944080727 2:195785199-195785221 AAAAATGGGTCGGCCGGGTGCGG - Intronic
944809853 2:203317338-203317360 GAGTAATTTTCGGCCGGGTGTGG + Intergenic
945247156 2:207729085-207729107 GAAAAGGTCTAGGCCGGGTGCGG - Intronic
946277296 2:218641227-218641249 AAAAAATTATCGGCCAGGTGAGG - Intronic
946522409 2:220481206-220481228 AAAAATTTTTCGGCCGGGCGCGG + Intergenic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
947168932 2:227291271-227291293 AAACACTTGTCGGCCGGGCGCGG + Intronic
948165226 2:235856200-235856222 AAAATATTCTCGGCCGGGTGCGG - Intronic
948204053 2:236152322-236152344 CAAGACTTGTAGGCCGGGCGCGG - Intergenic
948497372 2:238360591-238360613 TAAAATTTTTCAGCCGGGTGTGG + Intronic
948872445 2:240810102-240810124 GAAATCTTTCCGGCTGGGTGCGG - Intronic
948957615 2:241306048-241306070 TAAAACTTTTTGGCCGGGCGCGG - Intronic
1169243289 20:4003257-4003279 GAAAAATTCTGGGCCGGGCGTGG - Intronic
1169437693 20:5607666-5607688 GTAAACATGGCGGCCAGGTGTGG + Intronic
1169700790 20:8444227-8444249 GAAAACTTGGAGACAGGGTGGGG - Intronic
1170257932 20:14366653-14366675 CAAAAATTGTTGGCCGGGTGTGG - Intronic
1170319945 20:15084356-15084378 AAAAACTAGTTGGCCGGGTGTGG - Intronic
1170627254 20:18039329-18039351 AAAAAGTTTTTGGCCGGGTGTGG + Intronic
1170699751 20:18693364-18693386 GAAAAATTGAGGGCCAGGTGCGG + Intronic
1171991061 20:31696763-31696785 ATAAGCTAGTCGGCCGGGTGTGG + Intronic
1172565407 20:35926527-35926549 GAAAGTCTGTCGGCCGGGCGCGG - Intronic
1173534999 20:43802792-43802814 GAAAGCTTGTTGGCCAGGCGCGG - Intergenic
1173641097 20:44602540-44602562 GAAGACTTGGAGGCCAGGTGCGG + Intronic
1173792296 20:45835378-45835400 AAAACCTTGTGGGCTGGGTGGGG - Intronic
1173968301 20:47130553-47130575 TAAACCTTCTCGGCCGGGCGCGG - Intronic
1174239218 20:49119447-49119469 GAAAAATTCACGGCCAGGTGTGG - Intronic
1174252383 20:49229318-49229340 GAAAACATGTCGGCTGGGTGCGG - Intronic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174658110 20:52188605-52188627 GAAATAATGTCGGCCGGGTGCGG - Intronic
1174887103 20:54347922-54347944 GAACAGTTGTTGGCCGGGCGTGG - Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1175978385 20:62725096-62725118 GAGCACTTGTCTGCCGGGAGAGG - Intronic
1176136822 20:63526707-63526729 GGAAATTTGTTGGCTGGGTGCGG + Intergenic
1176634671 21:9180016-9180038 GAAAATTAGTGGGCCGGGCGCGG + Intergenic
1177072609 21:16529432-16529454 GTGAACTTGTCGGCCGGGAGCGG + Intergenic
1177848493 21:26319210-26319232 GGGAACTTATGGGCCGGGTGCGG + Intergenic
1178096110 21:29217455-29217477 GAGGACGTGTGGGCCGGGTGCGG + Intronic
1178572488 21:33752593-33752615 CAGAACTTTTGGGCCGGGTGTGG + Intronic
1178609388 21:34067595-34067617 GAACACTTGTGGGCCTGTTGGGG + Intergenic
1178800364 21:35788959-35788981 GAATGCTTGTGGGCCGGGCGCGG - Intronic
1178858028 21:36266462-36266484 ATAAACTGGTCAGCCGGGTGTGG - Intronic
1179137422 21:38692539-38692561 TAAAACTCTTCGGCCGGGCGTGG + Intergenic
1179216793 21:39374412-39374434 GAAAGATTGTTGGCCAGGTGCGG + Intergenic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179806303 21:43839780-43839802 GAAAACGTGTGGGCCAGGCGCGG - Intergenic
1179892289 21:44342126-44342148 GACACCTTGAAGGCCGGGTGGGG + Intergenic
1180430435 22:15244070-15244092 GAAAATTTGTAGGCCGGGCGCGG - Intergenic
1180512989 22:16111983-16112005 GAAAATTTGTAGGTCGGGCGTGG - Intergenic
1180906710 22:19418332-19418354 TAAAAATTGTTGGCGGGGTGCGG + Intronic
1181087131 22:20446049-20446071 AAAAACTTTTAGGCCGGATGTGG - Intronic
1181814597 22:25428947-25428969 TAGAAATTGCCGGCCGGGTGTGG + Intergenic
1182139487 22:27941007-27941029 AAAAATTTGTAGGCCGGATGTGG - Intergenic
1182190672 22:28456862-28456884 AAAAATTTATGGGCCGGGTGCGG - Intronic
1182820612 22:33212725-33212747 GAATATTTGTGGGCCGGGTGCGG + Intronic
1183607863 22:38877076-38877098 AGAAAGTTGTTGGCCGGGTGCGG - Intergenic
1183875947 22:40781533-40781555 GAATCCTTTTAGGCCGGGTGCGG - Intronic
1183966102 22:41443914-41443936 AAAAACCTTCCGGCCGGGTGCGG - Intronic
1184704175 22:46198947-46198969 GAACAGTTTTCGGCCGGGCGCGG - Intronic
1184957122 22:47896343-47896365 TAAAACTTGGAGGCCGGGCGTGG + Intergenic
949256222 3:2049821-2049843 TTAAACTTGACGGCCGGGCGCGG + Intergenic
949695918 3:6695388-6695410 GAAAACTGATGGGCCGGGCGCGG - Intergenic
950222339 3:11205948-11205970 GAAAACCTGTGGGCCAGGCGCGG - Intronic
950240525 3:11365927-11365949 TAGAACTTGTGGGCCGGGCGCGG + Intronic
950855683 3:16102544-16102566 TAAAACTTGTCTGCCTGTTGTGG - Intergenic
950977411 3:17262769-17262791 AATACATTGTCGGCCGGGTGTGG - Intronic
951099206 3:18667317-18667339 AAAAAATTCTTGGCCGGGTGCGG + Intergenic
951402263 3:22247891-22247913 TAAAAATTGTAGGCCGGGCGTGG - Intronic
951853821 3:27172046-27172068 TAAAGGTTCTCGGCCGGGTGTGG + Intronic
951911152 3:27752123-27752145 GAAGGCTTGGAGGCCGGGTGCGG + Intergenic
952747380 3:36794061-36794083 GAAGACATGTGGGCCGGGTGCGG - Intergenic
953872924 3:46643080-46643102 TAAAACATTTAGGCCGGGTGTGG - Intergenic
954169177 3:48786505-48786527 GATAACTTGGGGGCCGGGCGCGG + Intronic
954564091 3:51583715-51583737 TACCACTTGTCGGCCGGGCGTGG - Intronic
954565075 3:51592860-51592882 GAAAAGCTTTAGGCCGGGTGTGG - Intronic
955772249 3:62396939-62396961 TTAAAATTGTAGGCCGGGTGCGG + Intergenic
956059707 3:65337029-65337051 TAAAATTTTTGGGCCGGGTGAGG - Intergenic
956159263 3:66331898-66331920 AAAAACTTTTTGGCTGGGTGTGG - Intronic
956204341 3:66740173-66740195 GAGAAGTTGTTGGCCAGGTGCGG - Intergenic
956791263 3:72681675-72681697 AAGAACTTGACAGCCGGGTGCGG - Intergenic
956853003 3:73248653-73248675 AAAAGCCTGTTGGCCGGGTGCGG + Intergenic
957993712 3:87661196-87661218 TAAAAGTTTTCGGCCAGGTGTGG + Intergenic
958713955 3:97754991-97755013 GAAAACTTTGTGGCCGGGCGCGG - Intergenic
959610992 3:108294886-108294908 TAAAAGTTGGCGGCCGGGCGCGG + Intergenic
959639670 3:108618770-108618792 GAAAGCTTATGGGCCGGGCGCGG + Intronic
959660671 3:108864489-108864511 TAAAAATTCTCGGCCGGGCGCGG + Intergenic
959665018 3:108910938-108910960 TGAAATGTGTCGGCCGGGTGCGG - Intronic
960387940 3:117043921-117043943 AAAAACTTCTCGGCCAGGTATGG + Intronic
960524239 3:118691517-118691539 TAAAAATTGCCAGCCGGGTGTGG + Intergenic
961153077 3:124656318-124656340 TAAAAGTTCTCGGCCGGGTGCGG + Intronic
961235330 3:125361539-125361561 GAAAAGTGCTAGGCCGGGTGTGG + Intronic
962075900 3:132081343-132081365 TAAGATTTGTCGGCCGGGCGCGG - Intronic
963243125 3:143030753-143030775 GAACATTTGTGGGCCAGGTGTGG + Intronic
963497460 3:146083869-146083891 AAAAAATTCCCGGCCGGGTGTGG - Intronic
963795573 3:149627780-149627802 AAAAACTTATTGGCCGGGCGCGG + Intronic
964348742 3:155781785-155781807 AAAAAATAGTGGGCCGGGTGCGG + Intronic
964422628 3:156520288-156520310 GAAAAATTATAGGCCAGGTGTGG + Intronic
964843990 3:161026403-161026425 TAAAAGTTGACGGCCGGGCGTGG + Intronic
965030589 3:163361413-163361435 GAGAACATCTGGGCCGGGTGCGG + Intergenic
965231966 3:166065694-166065716 GAAAAAATGTCGGCCGGGCACGG - Intergenic
965530535 3:169766015-169766037 TAAAAATTCGCGGCCGGGTGCGG - Intergenic
965575069 3:170209591-170209613 GGAACCTTGCAGGCCGGGTGCGG - Intergenic
965905629 3:173701947-173701969 GAAGAGTTTTCGGCCGGGCGCGG + Intronic
965983150 3:174717975-174717997 AAAAACTTGTCGGGCGTGTTGGG + Intronic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966358189 3:179104545-179104567 AAATAATTGCCGGCCGGGTGCGG + Intergenic
966588532 3:181653733-181653755 TAAAGCTTGTTGGCCGGGTGTGG + Intergenic
966768376 3:183482291-183482313 AAAAACCTGTAGGCCGGGCGCGG - Intergenic
966814103 3:183875122-183875144 GAAAAATAGTAGGCTGGGTGTGG + Intronic
967032472 3:185620731-185620753 GAAAGCTCCTCGGCCAGGTGCGG - Intronic
967204696 3:187108867-187108889 TAAAATTTGTTGGCCGGGCGCGG + Intergenic
967588686 3:191246313-191246335 AAGAACTAGTAGGCCGGGTGTGG + Intronic
967725668 3:192860151-192860173 GAAAACTACTCGGCCATGTGGGG - Intronic
968117611 3:196101486-196101508 TAAAAATTTTCGGCCGGGCGCGG - Intergenic
968312888 3:197698701-197698723 GAAAAATTCTGGGCCAGGTGTGG + Intronic
968397695 4:258791-258813 TAAAATGTGTAGGCCGGGTGTGG - Intergenic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
969069105 4:4518061-4518083 GAACACATATAGGCCGGGTGTGG - Intronic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
970115142 4:12686511-12686533 GAAAAGTTCTTGGCCAGGTGTGG + Intergenic
970621144 4:17820309-17820331 GGAAAATTTTCGGCTGGGTGCGG + Intronic
971289600 4:25324951-25324973 GAAATATTTTCGGCCGGGCGCGG + Intronic
971652689 4:29299679-29299701 GAAAACTTCTCGGCCAGGCATGG + Intergenic
971775941 4:30964529-30964551 TAAAACTACTGGGCCGGGTGCGG - Intronic
971810059 4:31413564-31413586 GCAAACCTGAGGGCCGGGTGTGG + Intergenic
972202857 4:36736314-36736336 TAAAACTTTTGGGCCAGGTGTGG - Intergenic
972547464 4:40094033-40094055 CAAAATTTGTAGGCCAGGTGTGG - Intronic
972734538 4:41827909-41827931 GAAAAGTTATCGGCCGGGCATGG + Intergenic
972983122 4:44729139-44729161 AAAAACTTTTTGGCCGGGAGTGG - Intergenic
973048432 4:45565974-45565996 GAAAATGTGGCGGCCGGGCGCGG - Intergenic
973889516 4:55355166-55355188 GAAAATGTATAGGCCGGGTGCGG + Intronic
974386815 4:61211311-61211333 GAAAACTGGTAGGCTGGGTAGGG - Intronic
974503307 4:62733289-62733311 AAAAACAAGTTGGCCGGGTGTGG - Intergenic
974577637 4:63748217-63748239 TGGAACTTTTCGGCCGGGTGTGG - Intergenic
975094727 4:70444759-70444781 GAACACTTTTGGGCCAGGTGCGG + Intronic
975113166 4:70649499-70649521 GTAAAGCTGGCGGCCGGGTGCGG - Intronic
975536557 4:75457416-75457438 GAAAACTTTATGGCTGGGTGTGG - Intergenic
975714392 4:77191459-77191481 AAAAACCTTTCGGCCGGGTGCGG - Intronic
975727739 4:77308462-77308484 GAAAAGCTGTAGGCCGGGCGTGG + Intronic
976236612 4:82903510-82903532 AGAAACTTGTCGGCCAGGCGTGG - Intronic
976351891 4:84069384-84069406 GAAAACTTGATGGCCAGGAGAGG - Intergenic
976708838 4:88047264-88047286 AAAAACTTGTCGGCCAGGTGTGG + Intronic
977276403 4:94982700-94982722 AAAAATTTGTCAGCCGGGTGCGG + Intronic
977422560 4:96821367-96821389 AAAAACTTGTGGGCCAGGCGCGG + Intergenic
978010369 4:103674838-103674860 TAAAACATGTAGGCCGGGCGCGG - Intronic
978106216 4:104904698-104904720 AAAATGTTGTCGGCCGGGCGCGG - Intergenic
978843663 4:113246084-113246106 AAAAACATTCCGGCCGGGTGTGG - Intronic
979452442 4:120888080-120888102 GATAAAATGTCGGCCGGGCGCGG - Intronic
980145290 4:128975327-128975349 AAAAAGTTGTTGGCCGGGTGTGG - Intronic
980513860 4:133827265-133827287 GAAAACATATAGGCCGGGAGCGG - Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
981196122 4:141922812-141922834 CAAAAATTGTAGGCCAGGTGCGG + Intergenic
981773493 4:148337083-148337105 GAAAACTTCGTGGCTGGGTGTGG - Intronic
982212523 4:153050706-153050728 GAAAACTTATCAGGAGGGTGAGG - Intergenic
982530815 4:156541057-156541079 CATAAATTGTCGGCCGGGTGCGG + Intergenic
983130019 4:164007046-164007068 GAAAACTTTTTGGCAGGGCGTGG + Intronic
983153280 4:164312609-164312631 GAAAATAATTCGGCCGGGTGCGG - Intronic
983324084 4:166230283-166230305 GAAAACATATAGGCCTGGTGCGG - Intergenic
983644797 4:169978759-169978781 GAAAAGTAACCGGCCGGGTGCGG - Intergenic
983784101 4:171710286-171710308 GAAAAACTTTTGGCCGGGTGCGG - Intergenic
984113196 4:175645428-175645450 AGAAAATTGTAGGCCGGGTGGGG + Intronic
984272171 4:177560015-177560037 AAAAATTTCCCGGCCGGGTGCGG - Intergenic
984785742 4:183565876-183565898 AAACCCTTGTCGGCCGGGCGCGG - Intergenic
985000229 4:185475302-185475324 GAAAATTTCTCGGCCGGGCACGG + Intergenic
985144055 4:186874853-186874875 GATAATTTGTTGGCCGGGCGCGG - Intergenic
985254344 4:188055019-188055041 TTAAACTTCTAGGCCGGGTGCGG + Intergenic
985334984 4:188882951-188882973 TAAAAATTAGCGGCCGGGTGCGG + Intergenic
985535449 5:462813-462835 AAGACCTTGTAGGCCGGGTGTGG + Intronic
986400554 5:7375106-7375128 GATAAACTGTGGGCCGGGTGCGG - Intergenic
986554362 5:8996310-8996332 GAAAACAAGTGGGCCAGGTGTGG - Intergenic
986693948 5:10335503-10335525 GAAGAGTTATAGGCCGGGTGTGG - Intergenic
987177920 5:15335464-15335486 AAAAACTTCTTGGCCAGGTGTGG - Intergenic
987305332 5:16632189-16632211 GAACACATGTTGGCTGGGTGTGG + Intergenic
988109611 5:26801181-26801203 GAAAATTTTTTGGCCGGGAGCGG + Intergenic
988168632 5:27626797-27626819 AAAAACTTCTCGGCCGGGCGGGG + Intergenic
988298909 5:29396527-29396549 AAAAACTATTCGGCCGGGCGCGG + Intergenic
990147431 5:52778465-52778487 AGAAAATTGTGGGCCGGGTGTGG + Intergenic
990259257 5:54004202-54004224 TAAATATTCTCGGCCGGGTGTGG + Intronic
991274246 5:64825020-64825042 GAACACTTACTGGCCGGGTGCGG - Intronic
991690810 5:69223367-69223389 AAAAACTTCTCGGCCGGGCATGG - Intronic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992305029 5:75428386-75428408 AAAAAATAGTTGGCCGGGTGCGG + Intronic
992688691 5:79222426-79222448 GAAAACTTTCTGGCCAGGTGTGG + Intronic
993187421 5:84637358-84637380 TAAAACTTTTTGGCCAGGTGTGG + Intergenic
994068605 5:95572486-95572508 GAAAACATTTGGGCCGGGCGCGG + Intronic
994135577 5:96282837-96282859 AAAAATTTGTTGGCCGGGCGCGG + Intergenic
994220444 5:97188855-97188877 GAAAATATGTTGGCCGGGTACGG - Intergenic
994600760 5:101901619-101901641 TAAAAATTGTCGGCTAGGTGTGG + Intergenic
995374264 5:111456209-111456231 AAAAATTTCTCGGCCGGGCGCGG + Intronic
995680973 5:114718839-114718861 AAGAAATTGTCGGCCGGGCGTGG - Intergenic
995813342 5:116134909-116134931 AAAAAATTGTAGGCCGGGCGCGG - Intronic
995884107 5:116873978-116874000 AAACAGTTGTCGGCCGGGCGCGG - Intergenic
996030147 5:118695614-118695636 GAAAACTTCTGGGCCGGGCACGG - Intergenic
996435054 5:123424846-123424868 GAAGACTTTTTGGCCAGGTGTGG + Intergenic
996541827 5:124638238-124638260 AAAAAACTGTTGGCCGGGTGTGG - Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997258596 5:132448122-132448144 GGGAAGCTGTCGGCCGGGTGCGG - Intronic
997385125 5:133466250-133466272 GAACACTTACCGGCCAGGTGCGG + Intronic
997451838 5:133989950-133989972 TAAAAATTGTGGGCCGGGCGTGG - Intronic
997478414 5:134163497-134163519 AAAAACTTCTCGGCTGGGTGTGG + Intronic
998023425 5:138791326-138791348 TAAAAAATGTCGGCCGGGTGCGG + Intronic
998118677 5:139559134-139559156 AAAAATCTGTCGGCCGGGCGCGG + Intronic
998285938 5:140861017-140861039 AAATACCTTTCGGCCGGGTGCGG - Intronic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
998931491 5:147186257-147186279 AAAAAATTGTCGGCTGGGCGGGG - Intergenic
998947489 5:147355382-147355404 AAAACCTTCTCGGCCGGGCGCGG + Intronic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
1000947481 5:167439082-167439104 AAAAACTTGGCGGCCCGGTGCGG - Intronic
1001241469 5:170074769-170074791 GAACACTTGGCTGCAGGGTGAGG + Intronic
1001732760 5:173972612-173972634 AACAAATTGTGGGCCGGGTGCGG - Intergenic
1002046685 5:176545430-176545452 AAAAACTTCTCGGCCGAGTGCGG - Intronic
1002067160 5:176657628-176657650 GAAAACATGTCGGCTGGGTGGGG - Exonic
1002122923 5:177019639-177019661 AAAAAATTGTAGGCTGGGTGTGG + Intronic
1002280688 5:178128438-178128460 GAAAACAGGTCGGCTGGGTGCGG + Intergenic
1002286349 5:178165112-178165134 AAAAACATGGGGGCCGGGTGTGG + Intergenic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003134710 6:3425572-3425594 GATAATTATTCGGCCGGGTGCGG - Intronic
1003144519 6:3498703-3498725 GACAGCTTATTGGCCGGGTGTGG + Intergenic
1003545567 6:7055599-7055621 TTAAACTTCTTGGCCGGGTGCGG - Intergenic
1003756477 6:9126508-9126530 AAAAATTTCTCGGCCGGGTGCGG - Intergenic
1003854173 6:10255164-10255186 TTAATATTGTCGGCCGGGTGCGG - Intergenic
1004386521 6:15177808-15177830 ATAAACTTGTTGGCCGGGTGCGG + Intergenic
1004410637 6:15378175-15378197 TAAAAATTGAGGGCCGGGTGGGG - Intronic
1004632932 6:17438727-17438749 AAAAACTTCTGGGCCGGGTGCGG - Intronic
1004696661 6:18040508-18040530 AAAAACTTGTTAGCCAGGTGCGG + Intergenic
1005246861 6:23895915-23895937 GAAAATCTGTTGGCCGGGTATGG - Intergenic
1005659615 6:27983034-27983056 GAAAACCAGTAGGCCGGGCGCGG - Intergenic
1005915997 6:30351859-30351881 AAAACGTTGTCAGCCGGGTGCGG - Intergenic
1005949513 6:30621109-30621131 GAAAACATATTGGCTGGGTGCGG + Intronic
1006037092 6:31222391-31222413 AAACACTTCTCAGCCGGGTGCGG - Intergenic
1006111166 6:31746385-31746407 AAAAACTGGACGGCCGGGCGCGG - Intronic
1006123210 6:31820364-31820386 TATTACTTGTCGGCCGGGCGTGG + Intergenic
1006166158 6:32066781-32066803 GAAAACATTCAGGCCGGGTGTGG + Intronic
1006197110 6:32251315-32251337 GAAAAGGTGCAGGCCGGGTGTGG + Intergenic
1006859968 6:37165093-37165115 TGAAAATTATCGGCCGGGTGCGG + Intergenic
1007463112 6:42032376-42032398 AAAACCTTGTCAGCTGGGTGTGG - Intronic
1007472652 6:42100784-42100806 AAAAAATTGGGGGCCGGGTGCGG + Intergenic
1007903559 6:45435646-45435668 GAAAGATTGTCGGCTGGGCGCGG - Intronic
1008114450 6:47531780-47531802 GAATCCTTTTCGGCCGGGCGTGG + Intronic
1008300796 6:49836627-49836649 TAAAATTTGTAGGCCGGGCGCGG - Intronic
1010186447 6:73149505-73149527 GAAAACTGATAGGCTGGGTGTGG + Intronic
1010231956 6:73542654-73542676 GAATACTTAATGGCCGGGTGTGG - Intergenic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010653947 6:78489611-78489633 GTAAACATGTCAGCAGGGTGGGG - Intergenic
1010695393 6:78967842-78967864 TAAAATTTATCGGCCGGGCGCGG + Intronic
1011126256 6:84011193-84011215 GAAACCTTCTTGGCCAGGTGCGG + Intergenic
1011466437 6:87662132-87662154 AAAAACTTTTGGGCCGGGTGCGG + Intronic
1011639171 6:89403149-89403171 TAAAAACTGTCGGCCGGGCGCGG + Intronic
1013511448 6:110848002-110848024 GGAAATTTGCTGGCCGGGTGCGG - Intronic
1013778133 6:113701508-113701530 GAAAAATGGTAGGCCGGGCGCGG - Intergenic
1014214698 6:118741927-118741949 TAAAATGTATCGGCCGGGTGCGG - Intergenic
1014551515 6:122794305-122794327 GAAACTTTCTTGGCCGGGTGTGG + Intronic
1014636535 6:123854061-123854083 GAAAATTTATCGGGCGGGTGTGG - Intronic
1014910640 6:127088783-127088805 GAATAGTTTGCGGCCGGGTGCGG + Intergenic
1015180570 6:130357412-130357434 TAAAAGATGCCGGCCGGGTGTGG - Intronic
1015410870 6:132892525-132892547 AAAATCTTGTTGGCCAGGTGCGG + Intergenic
1015424573 6:133050681-133050703 GAAAAATTGGCGGCCGGGCGCGG - Intergenic
1015798277 6:137034648-137034670 GAGAACATGTGGGCCAGGTGCGG + Intronic
1015958850 6:138626601-138626623 AAAAAATTGTAGGCCGGGCGCGG + Intronic
1016941583 6:149486759-149486781 TAGGAGTTGTCGGCCGGGTGCGG - Intergenic
1017096954 6:150813013-150813035 GAACACTTGCTGGCCGGGCGCGG + Intronic
1017866010 6:158443927-158443949 AAAAATTTTTTGGCCGGGTGCGG + Intronic
1018278836 6:162162717-162162739 GAAAAATTTCTGGCCGGGTGCGG + Intronic
1018322946 6:162633142-162633164 AAAAAAATGTAGGCCGGGTGCGG + Intronic
1018387363 6:163317061-163317083 GTCAATTTGTCGGCCGGGCGCGG - Intergenic
1018871427 6:167786121-167786143 TAAAAATTGCCGGCCGGGCGTGG - Intronic
1019059479 6:169245500-169245522 GAAAACTTCTAGGCCGGGCGTGG + Intronic
1019697693 7:2455763-2455785 AAAATCTTCTCGGCCGGGCGCGG - Intergenic
1019773773 7:2899980-2900002 GAAAACGCGTGGGCCGGGCGCGG - Intergenic
1019867654 7:3727779-3727801 TAAAATTTCTCGGCCGGGCGCGG - Intronic
1019885747 7:3903434-3903456 AAAAAACTGTCGGCCGGGCGCGG - Intronic
1019911201 7:4101435-4101457 GCAAATTTTTCCGCCGGGTGCGG - Intronic
1020239051 7:6378253-6378275 GAAAATATGTCTGCCAGGTGCGG + Intronic
1020805902 7:12790148-12790170 TAAAATTTTTGGGCCGGGTGTGG - Intergenic
1021288782 7:18817322-18817344 TAATACTTCTCGGCCGGGCGCGG - Intronic
1021448357 7:20757818-20757840 TTTAAATTGTCGGCCGGGTGTGG - Intronic
1021465923 7:20943578-20943600 GAGAAGTTGAAGGCCGGGTGTGG + Intergenic
1021571409 7:22068964-22068986 GGATCTTTGTCGGCCGGGTGCGG + Intergenic
1021865291 7:24950430-24950452 CAAAACATGTAGGCCGGGCGCGG + Intronic
1022080532 7:27015556-27015578 GAAAACTAATAGGCTGGGTGTGG - Intergenic
1022150529 7:27599390-27599412 TAAAAATTGATGGCCGGGTGCGG + Intronic
1022394936 7:29979072-29979094 CAAAAATTTTCCGCCGGGTGTGG + Intronic
1023931055 7:44706912-44706934 TAAAACATCCCGGCCGGGTGCGG - Intronic
1024274925 7:47669781-47669803 AAAAACTTGTTGGCCGGGCTCGG + Intergenic
1024299935 7:47879335-47879357 TAAAAATTGTTGGCTGGGTGCGG + Intronic
1024305683 7:47927552-47927574 GAAAATTTGTCGGCTGGATGTGG - Intronic
1024783486 7:52879456-52879478 GAAAACTTCTTGGCCGGTTGTGG + Intergenic
1025618321 7:63143778-63143800 TAAAACTTCTGGGCTGGGTGTGG + Intergenic
1026362095 7:69611638-69611660 TAAAAATTGTAGGCCGGGCGCGG + Intronic
1027197252 7:76039224-76039246 AAAAATTAGTTGGCCGGGTGCGG - Intronic
1028996147 7:97102291-97102313 GGGCAGTTGTCGGCCGGGTGTGG - Intergenic
1029013417 7:97287676-97287698 GAAAACATCTAGGCTGGGTGAGG + Intergenic
1029293935 7:99524362-99524384 CAAAAATTATCAGCCGGGTGTGG - Intronic
1030838114 7:114313453-114313475 AAAATATTGTCGGCCGGGCGCGG + Intronic
1031407584 7:121405201-121405223 GAATACTTGTCAGCTGGGCGCGG + Intergenic
1031531139 7:122878360-122878382 GCAATGTTGTCGGCCGGGCGCGG + Intronic
1031556929 7:123188823-123188845 GAAAATCTTTCGGCCGGGTGCGG + Intronic
1031921671 7:127606598-127606620 TAATAGTTGTTGGCCGGGTGCGG - Intergenic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032292651 7:130602761-130602783 GGAAAGTGGTTGGCCGGGTGTGG - Intronic
1032821301 7:135526747-135526769 GAAAACTTGCTGGCCAGGTGTGG + Intergenic
1033241728 7:139685451-139685473 GAAAACCTGTTGGCCGGGTGTGG - Intronic
1033828476 7:145221739-145221761 AAAAACATGTCGGCCGGGCACGG - Intergenic
1034194592 7:149236400-149236422 AAAACGTTGTTGGCCGGGTGTGG - Intergenic
1035155286 7:156907169-156907191 AAAAAGATGTTGGCCGGGTGCGG - Intergenic
1035195641 7:157218153-157218175 GAAACCATGTCGGCTGGGCGCGG + Intronic
1035871690 8:3142085-3142107 GATAATTTGGCGGCCGGGCGCGG - Intronic
1036451967 8:8876665-8876687 AAAAACTTATAGGCCAGGTGTGG - Intronic
1037007220 8:13797424-13797446 GAATAGTTATGGGCCGGGTGCGG + Intergenic
1037123512 8:15317626-15317648 AAAAAGTTCTGGGCCGGGTGCGG - Intergenic
1037627448 8:20620393-20620415 TAAAAAGTGTTGGCCGGGTGTGG + Intergenic
1037781430 8:21871893-21871915 GATAACTTCTCGGCCAGGCGCGG + Intergenic
1038228999 8:25683442-25683464 AAAAAATATTCGGCCGGGTGTGG - Intergenic
1039594298 8:38777438-38777460 CACAACTTTTCGGCCGGGAGAGG + Intronic
1040068903 8:43173280-43173302 GAAAACTCATAGGCCAGGTGTGG - Intronic
1040486795 8:47880761-47880783 GAAATGTTCTAGGCCGGGTGTGG + Intronic
1040494568 8:47955170-47955192 GAAAACATATGGGCCGGGCGCGG + Intronic
1040517426 8:48146139-48146161 AGAAACATGCCGGCCGGGTGCGG - Intergenic
1040645790 8:49395202-49395224 GAAAACTTTTGTGCAGGGTGTGG - Intergenic
1040813991 8:51487081-51487103 ATAAACTTTTCGGCCGGGTGCGG - Intronic
1041134350 8:54740751-54740773 AAAAGCTTATGGGCCGGGTGCGG + Intergenic
1041766140 8:61420307-61420329 AAAACATTGTTGGCCGGGTGCGG + Intronic
1042031154 8:64477433-64477455 GCAAAGTTGCCGGCCGGGCGTGG + Intergenic
1042136185 8:65635254-65635276 GAAAACAAATAGGCCGGGTGCGG + Intergenic
1042304956 8:67321748-67321770 CAGAAGTTCTCGGCCGGGTGTGG - Intronic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1043184203 8:77125243-77125265 GGAAACCTGTAGGCCTGGTGCGG + Intergenic
1043961381 8:86422661-86422683 AAAAACTGGTGGGCCGGGCGTGG - Intronic
1044568374 8:93690405-93690427 GAAAACTCCTAGGCCGGGTGCGG + Intergenic
1044856491 8:96481424-96481446 TATAACTTGGTGGCCGGGTGCGG + Intergenic
1045090468 8:98737998-98738020 GAAAATCATTCGGCCGGGTGCGG - Intronic
1045269842 8:100652266-100652288 AAAAACCTGTGGGCCGGGCGCGG - Intronic
1045274427 8:100689723-100689745 AAATACTAGTGGGCCGGGTGTGG - Intronic
1045601423 8:103722077-103722099 GAACACTTATTGGCCAGGTGTGG + Intronic
1045841606 8:106588247-106588269 AAAAAATTGTTGGCCGGATGCGG - Intronic
1046170678 8:110501295-110501317 GAAAATTTCTCGGCCGGGCGCGG + Intergenic
1047207577 8:122815795-122815817 TAAAAATTGCCGGCCGGGCGTGG + Intronic
1048627543 8:136202257-136202279 AAAAAATTGTCAGCCGGGCGTGG + Intergenic
1049130784 8:140838714-140838736 AAAAACTTCTAGGCCGGGCGCGG + Intronic
1050462083 9:5885661-5885683 GATAACATATGGGCCGGGTGCGG - Intronic
1050535480 9:6627003-6627025 GCAAACTAGTGGGCCGGGCGTGG + Intronic
1050612906 9:7371804-7371826 GAAAAATAGTAGGCCGGGCGCGG + Intergenic
1051234886 9:14989544-14989566 GATAAAGTGACGGCCGGGTGTGG + Intergenic
1051642548 9:19237307-19237329 TAAAAGCTGTCGGCCGGGCGTGG - Intronic
1052273186 9:26649097-26649119 GAAAACTTGTCTGCAGTCTGAGG - Intergenic
1052934008 9:34078187-34078209 AAAAAATTGGGGGCCGGGTGTGG - Intergenic
1052943106 9:34145999-34146021 TAAAACCTGTTGGCCAGGTGCGG + Intergenic
1053210317 9:36222126-36222148 AAAAACATTTCGGCCGGGCGCGG + Intronic
1053253230 9:36592465-36592487 GAAAATTTGAGGGCCGGGCGCGG - Intronic
1053262913 9:36686148-36686170 GAAAAGATTTAGGCCGGGTGTGG - Intergenic
1053709261 9:40788709-40788731 GAAAATTTGTAGGCTGGATGCGG + Intergenic
1055057968 9:72040968-72040990 ACAAACTTATTGGCCGGGTGTGG + Intergenic
1055089950 9:72353383-72353405 AAAAACTGATTGGCCGGGTGCGG + Exonic
1055306157 9:74930994-74931016 TTAAAATTGTGGGCCGGGTGTGG + Intergenic
1055480233 9:76702346-76702368 GAAAAGATATCGGCCAGGTGCGG - Intronic
1055590313 9:77805692-77805714 GCAAACTTTTTGGCCGGGTGCGG - Intronic
1055982930 9:82023780-82023802 TAAAACTTGTCAGCCAGGAGTGG + Intergenic
1056176432 9:84041186-84041208 GAAAAAATGTTGGCCAGGTGTGG - Intergenic
1057056449 9:91965121-91965143 AAAACCTTGTCGGCCGGGCATGG - Intergenic
1057415523 9:94858870-94858892 GAAACCCTGTCTGCTGGGTGTGG + Intronic
1057427070 9:94960720-94960742 GAATGCTTGTGGGCCGGGTGCGG + Intronic
1057471214 9:95358343-95358365 GAAAATTCCTGGGCCGGGTGCGG - Intergenic
1057789494 9:98114610-98114632 TAAAAATTGTCGGCTGGGTGCGG - Intronic
1057901014 9:98948306-98948328 ACACACTTGTCGGCCGGGCGCGG + Intronic
1058008073 9:99940769-99940791 GTAAAATTCTAGGCCGGGTGCGG - Intronic
1058042553 9:100319512-100319534 TAAGACTTGTAGGCTGGGTGTGG + Intronic
1058436062 9:104964738-104964760 AAAAATTTCTCGGCCGGGCGCGG + Intergenic
1059111923 9:111565813-111565835 GAAAAGTTTTAGGCTGGGTGCGG - Intronic
1059117759 9:111614791-111614813 TAAAAATTATTGGCCGGGTGCGG - Intergenic
1059158248 9:112009294-112009316 GAGCATTTGTGGGCCGGGTGCGG + Intergenic
1059857306 9:118414130-118414152 AATAACTTGTCGGCCAGGCGCGG - Intergenic
1060823683 9:126675434-126675456 TAAAAAATGTTGGCCGGGTGCGG + Intronic
1061230819 9:129314882-129314904 GGGAGATTGTCGGCCGGGTGTGG - Intergenic
1061564391 9:131428208-131428230 CAAAACTTGTAGGCCGGGCACGG - Intronic
1061599250 9:131655875-131655897 GAAAATTTTTTGGCCGGGCGCGG - Intronic
1061980558 9:134100922-134100944 TAAAACTTTTCGGCCAGGCGCGG + Intergenic
1062335181 9:136061827-136061849 GAAAAGTTGGTGGCCGGGCGCGG + Intronic
1185559405 X:1048008-1048030 TAAACCTTTTAGGCCGGGTGTGG + Intergenic
1185661306 X:1731034-1731056 AAAAAAGGGTCGGCCGGGTGCGG + Intergenic
1186135747 X:6518640-6518662 GAAAAACTCTGGGCCGGGTGTGG - Intergenic
1187704495 X:21995975-21995997 AAAAAGTAGGCGGCCGGGTGTGG - Intergenic
1187769799 X:22682594-22682616 GAAAATGTGGCGGCCGGGCGCGG + Intergenic
1187911844 X:24118544-24118566 GAAATATTATGGGCCGGGTGTGG - Intergenic
1188475306 X:30585936-30585958 GAAAAATGGTTGGCTGGGTGCGG + Intergenic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1188829827 X:34882389-34882411 GAAAAAGTGTTGGCCGAGTGCGG - Intergenic
1189797852 X:44662848-44662870 CAAAACTTGTTGGCCGGGTGCGG - Intergenic
1189819913 X:44860251-44860273 GAAAACTTTTAGGCTGGGTGCGG + Intergenic
1190045390 X:47107787-47107809 GCAAACTGGTCTTCCGGGTGTGG - Intergenic
1190419478 X:50214847-50214869 CAAAATTTGTGGGCCAGGTGTGG - Intronic
1190454319 X:50611627-50611649 AAAAACTTGTAGGCTGGGCGTGG + Intronic
1190715550 X:53100188-53100210 GAAAATCTGTTGGCCAGGTGCGG + Intergenic
1190715598 X:53100507-53100529 GAAAATCTGTTGGCCGGGTGCGG + Intergenic
1190818318 X:53948731-53948753 TAAAAATTGTCGGCCGGGCACGG + Intronic
1192347042 X:70318972-70318994 GAAATCCTTTAGGCCGGGTGTGG + Intronic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192488459 X:71551915-71551937 TTAAACTTTTAGGCCGGGTGCGG + Intronic
1193138431 X:77999285-77999307 GAAAATTTATGGGCCGTGTGTGG - Intronic
1194000787 X:88426384-88426406 GAAACCTTTTGGGCCGGGCGCGG + Intergenic
1194586592 X:95742263-95742285 AAAAGATTGTCGGCTGGGTGCGG - Intergenic
1194588933 X:95772639-95772661 AAGAAATTGTCAGCCGGGTGCGG + Intergenic
1195224404 X:102777476-102777498 GAAAATGTGGCGGCCGGGCGCGG - Intergenic
1195379623 X:104257896-104257918 GAAAAATTGTTCGCCGGGTATGG - Intergenic
1195398924 X:104441247-104441269 GAAAACATGTCAGCTGGGTGTGG + Intergenic
1195854861 X:109320141-109320163 GAAAAATTGTGGGCCAGGCGTGG + Intergenic
1196405000 X:115352007-115352029 AAAAAGTTGTTGGCCGGGTGCGG + Intergenic
1196430878 X:115623937-115623959 GCACACTTGTCGGCCGGGCACGG + Intronic
1196665795 X:118314781-118314803 TATAATTTGTCGGCCAGGTGCGG - Intergenic
1196921762 X:120592738-120592760 TAAAATTTATGGGCCGGGTGTGG + Intergenic
1197210000 X:123820515-123820537 GTGGATTTGTCGGCCGGGTGAGG - Intergenic
1197238441 X:124095215-124095237 GGAAAATTATCAGCCGGGTGCGG - Intronic
1197742209 X:129904060-129904082 GAAAACAAATCGGCTGGGTGCGG + Intergenic
1197744153 X:129919788-129919810 GAAACTTGTTCGGCCGGGTGTGG + Intronic
1197803605 X:130377645-130377667 TAAAAATTATTGGCCGGGTGTGG - Intergenic
1197937701 X:131756957-131756979 GAAAACTGTACGGCCAGGTGCGG + Intergenic
1198321641 X:135523092-135523114 AACAACTTATTGGCCGGGTGCGG + Intronic
1199123280 X:144083818-144083840 AAGAACTTTTCGGCCGGGCGCGG + Intergenic
1200808409 Y:7456879-7456901 TAAAAGAAGTCGGCCGGGTGCGG + Intergenic
1200944709 Y:8822466-8822488 CAAAAATTGTCGGCTGGGCGCGG - Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic
1202366193 Y:24167469-24167491 CAAAGCTTTTGGGCCGGGTGTGG - Intergenic
1202504588 Y:25502654-25502676 CAAAGCTTTTGGGCCGGGTGTGG + Intergenic