ID: 1126396981

View in Genome Browser
Species Human (GRCh38)
Location 15:48228806-48228828
Sequence TACCTAGACTTTCCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126396981 Original CRISPR TACCTAGACTTTCCTACTCC TGG Intronic
905894228 1:41534733-41534755 AGCCTTGACTTTCCCACTCCAGG + Intronic
913715418 1:121529510-121529532 TACCCAGACTTCCCTACCTCTGG + Intergenic
915667753 1:157460294-157460316 TACCTTTACTGTCCTACTTCAGG - Intergenic
922020019 1:221694504-221694526 TACCTCCACTGTCCTACTTCAGG + Intergenic
1064113928 10:12561522-12561544 TACCTACACTTTCGTATTCTGGG + Intronic
1066247646 10:33598905-33598927 TACCTTTACTTTCTTACACCAGG + Intergenic
1068162434 10:53282570-53282592 TACCCAGACTTTCTTAGTCTTGG + Intergenic
1070886398 10:79904125-79904147 TACCTCGCCTTCCCTGCTCCCGG - Intergenic
1071937603 10:90548677-90548699 TACCTTTACTTTCCTACCTCAGG + Intergenic
1071947166 10:90658363-90658385 TACCTTCACTTTCCTACTTCAGG - Intergenic
1072209351 10:93232325-93232347 TACCTTTACTTTCCTACCTCAGG - Intergenic
1076504781 10:130964420-130964442 CCCCTGCACTTTCCTACTCCTGG - Intergenic
1077199971 11:1301859-1301881 TCCCTAGATGTTCCTACTACGGG - Intronic
1078405889 11:11069634-11069656 TACCAACACATTCCTTCTCCTGG + Intergenic
1080704630 11:34678692-34678714 TGCCTTGATTTTCCCACTCCTGG - Intergenic
1080891930 11:36416686-36416708 TACCTAGACTTTTCTCTTCCTGG + Intronic
1082007727 11:47429184-47429206 CCCCAAGACATTCCTACTCCTGG - Intergenic
1082999532 11:59278883-59278905 TACCTTTACTGTCCTACTCAAGG + Intergenic
1087050620 11:93882885-93882907 AATCAAGACTTACCTACTCCAGG - Intergenic
1091485683 12:885461-885483 TAACTAGACACTCCTGCTCCAGG - Exonic
1094102441 12:26778589-26778611 TACCTTCACTGTCCTACTACAGG + Intronic
1096193551 12:49634760-49634782 TACCTTTCCTTTCCTTCTCCTGG - Intronic
1099591756 12:84601240-84601262 CAACTAGACTTTCCTACACTAGG + Intergenic
1099689636 12:85936795-85936817 TACATAAACTTTGCTTCTCCTGG - Intergenic
1111806555 13:93045352-93045374 TACCTGGTCTGTCATACTCCAGG - Intergenic
1112143219 13:96669605-96669627 TTCTTCAACTTTCCTACTCCTGG + Intronic
1112301573 13:98235525-98235547 TACCTAGAGTATCCCACACCCGG - Intronic
1116740543 14:48748946-48748968 TACCTATTCTTGGCTACTCCAGG + Intergenic
1116851974 14:49917815-49917837 TACCTGGAATTTCCTACTCTTGG - Intergenic
1118907515 14:70033418-70033440 TACTTAGATTTTCTGACTCCAGG + Intergenic
1123961940 15:25412124-25412146 TACCTATGCTTTCCTCATCCCGG - Intronic
1124480661 15:30076359-30076381 TTCCTGTATTTTCCTACTCCAGG + Intergenic
1125045019 15:35235230-35235252 GAACTGGACTTTCCTACCCCTGG - Intronic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1126413001 15:48391176-48391198 AACCCATACTTTCATACTCCCGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1135876107 16:26201507-26201529 TACCTTGACTTTCTGAATCCTGG + Intergenic
1139589471 16:67925627-67925649 GACCCTGACTTTCCTCCTCCTGG + Intronic
1140633852 16:76887780-76887802 TACTTAAACTTTGTTACTCCAGG + Intergenic
1142121698 16:88389739-88389761 TGCCTTGACTTCCCTACTCAGGG - Intergenic
1149231913 17:54544630-54544652 TACTTAGTCTTTCCTCCTGCTGG + Intergenic
1155523725 18:26695543-26695565 TACCTGGACTTTCCTCCACATGG + Intergenic
1156656317 18:39292116-39292138 TACCTAGACTTTCCTGATCTTGG - Intergenic
1158000590 18:52613780-52613802 TACCCAGAATTTCCTCCACCTGG - Intronic
1158624671 18:59060898-59060920 CACCTAGACTTTTCACCTCCAGG + Intergenic
926288295 2:11508227-11508249 TCCCTAGATCTTCCTTCTCCAGG + Intergenic
937416917 2:121722566-121722588 TACCTAGACTTTCTGAGTTCAGG - Intergenic
937478588 2:122236787-122236809 TCCCTACACTTTCCTAGTCCAGG - Intergenic
939547374 2:143569937-143569959 GACCTAGGCTTTCTAACTCCTGG - Intronic
939704345 2:145433565-145433587 CAACTTAACTTTCCTACTCCAGG - Intergenic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
943006810 2:182395219-182395241 TACCTTTACTTTCCTACCTCAGG + Intronic
944096768 2:195976427-195976449 TTCCTAAGGTTTCCTACTCCAGG + Intronic
947107579 2:226683647-226683669 TACTTAGTCTTTTCTACTCCAGG - Intergenic
948951989 2:241259074-241259096 TACCCAGGCTTTCCTACTGATGG - Intronic
1168847009 20:952140-952162 AGCCTAGACATTCCTTCTCCAGG - Intergenic
1173182757 20:40816980-40817002 TTCCAAGCCTTTCCTGCTCCAGG - Intergenic
1173466438 20:43285761-43285783 TACCTAGAATTTCTTTCTCCTGG - Intergenic
1174167448 20:48595145-48595167 CCCCTAGACTTTCCCACTGCTGG + Intergenic
1174583900 20:51592745-51592767 TGCCCAGCCTTTCCTACCCCGGG + Intergenic
1174588997 20:51630327-51630349 TGCCTAAATTTTGCTACTCCAGG + Intronic
1177069676 21:16488394-16488416 TACAGAGACTTTCTGACTCCTGG - Intergenic
1179427723 21:41295229-41295251 TACCTCAATTTTCCTACACCTGG - Intergenic
1183028873 22:35086991-35087013 GACCTAGGCTTCCCAACTCCCGG - Exonic
949243451 3:1897305-1897327 TACCAAGACTTTCCTATTAAAGG - Intergenic
949340337 3:3022833-3022855 TCCCTAAACTTTCCTACTTGTGG - Intronic
949417748 3:3831885-3831907 TACCTTTACTGTCCTACCCCAGG - Intronic
953052773 3:39361104-39361126 TACCCATACTTTCCTACCTCTGG - Intergenic
956039758 3:65133451-65133473 TACCTAGTCTTCCTTCCTCCTGG - Intergenic
958012582 3:87899361-87899383 TTCCCACACTTTCCTATTCCTGG + Intergenic
959746106 3:109777951-109777973 TACCTTTACTCTCCTACCCCAGG - Intergenic
961466138 3:127082780-127082802 TACCTTGACCTCCCTCCTCCTGG - Intergenic
963129918 3:141848539-141848561 TACCTAGACTATATTACTCAGGG - Intergenic
965299148 3:166988536-166988558 TACCTTTACTGTCCTACTGCAGG - Intergenic
966583957 3:181600679-181600701 TACATAGTCTTTAATACTCCAGG - Intergenic
970645768 4:18118588-18118610 TACTCAGACTTTCTTCCTCCTGG - Intergenic
971273641 4:25174706-25174728 CTCCTACACTTTCCTCCTCCTGG - Intronic
972118873 4:35675604-35675626 TCTCTATACCTTCCTACTCCTGG - Intergenic
972805814 4:42528659-42528681 TACCTTTACTGTCCTACCCCAGG + Intronic
973726374 4:53780939-53780961 TACCTAGACTTTCACATTCTTGG + Intronic
975295269 4:72727052-72727074 TACCTAGATTTCCTGACTCCAGG + Intergenic
975353711 4:73374851-73374873 TACTAAGAATTACCTACTCCTGG - Intergenic
980692466 4:136313254-136313276 TACCTTCACTATCCTACTTCAGG + Intergenic
983542619 4:168929271-168929293 GGCCTAGGCTTTCCTACTACGGG + Intronic
984882523 4:184422954-184422976 TACCTAGTTTTTCATACTTCAGG + Intronic
986488051 5:8260504-8260526 TACCTAGACATTCCTCTGCCAGG - Intergenic
987429899 5:17820081-17820103 TGGCTAAACTTTCCTACTTCTGG + Intergenic
988122551 5:26985684-26985706 TACTTAGCCTTTCCCAATCCTGG + Intronic
989962329 5:50430980-50431002 TACCCAGACTTCCCTACCTCTGG - Intronic
990947592 5:61265019-61265041 TAACTAATCTTTCCTTCTCCTGG - Intergenic
991946054 5:71899462-71899484 TACCTTTACTGTCCTACTTCAGG + Intergenic
993882408 5:93378791-93378813 TACCTGGACTTTGCTAGTCAGGG + Intergenic
995875902 5:116789245-116789267 GACCTAGACCTTCCTTTTCCAGG - Intergenic
996313930 5:122140098-122140120 TACCTAGGGTTTCCAATTCCAGG - Intronic
998667334 5:144312968-144312990 TACCTACACTTTTCAACTCAAGG - Intronic
998888704 5:146723033-146723055 TTCCTTGACTTTCCTATTCTGGG + Intronic
1002150792 5:177228607-177228629 TACCTCGACTTTCCTAGTTCTGG - Intronic
1006107783 6:31727189-31727211 TTCCTATACTATCCTACCCCTGG + Exonic
1008267008 6:49439974-49439996 TACCTTTACTGTCCTACTGCAGG - Intronic
1016000725 6:139038356-139038378 TACCTTGACTTTCTCATTCCTGG + Intronic
1018087944 6:160321134-160321156 ATCCTATACTTTCCTACTCTGGG - Intergenic
1024923526 7:54587259-54587281 TTGCTAGACTTTCCTACGACCGG + Intergenic
1024952748 7:54881868-54881890 TATCCAGACTCTGCTACTCCAGG + Intergenic
1027540239 7:79455621-79455643 TATCAAGTCTTGCCTACTCCTGG - Intergenic
1029547791 7:101219841-101219863 AACCTAGACTTACCTTCTTCTGG + Intronic
1030450987 7:109710777-109710799 TAGCTTGAGTTTCCTACTTCAGG + Intergenic
1031676474 7:124617656-124617678 TACCTTTACTCTCCTACCCCAGG + Intergenic
1034341780 7:150361882-150361904 TGCCTAGACGATCCTCCTCCAGG - Intergenic
1043093722 8:75937762-75937784 CACCTGGACTTTGCTATTCCAGG + Intergenic
1043214999 8:77574487-77574509 TACCTAAGGTTTCCAACTCCAGG + Intergenic
1046150988 8:110225184-110225206 TACTTAAGCTTTCATACTCCTGG + Intergenic
1049871216 8:144978831-144978853 GATCTTGCCTTTCCTACTCCAGG - Intergenic
1051106053 9:13581556-13581578 TTCCTTGACTTTCCTACCACAGG + Intergenic
1054986230 9:71264673-71264695 TACCTAGATTTTCCTAGTCTTGG - Intronic
1055804157 9:80074494-80074516 TATCTAAACTTTCCTGCCCCTGG + Intergenic
1188192018 X:27182899-27182921 TACCTAGGGTTACCAACTCCAGG + Intergenic
1188648716 X:32602750-32602772 TATCTAGACATTCCCAATCCTGG + Intronic
1192573562 X:72225251-72225273 TACCTGGACTGTCCTCCCCCAGG + Intronic
1192814516 X:74576937-74576959 TACCTATCCTTTCCTTCCCCAGG - Intergenic
1195334534 X:103838024-103838046 TACATAGTATTTCCTACTCTGGG - Intergenic
1197425824 X:126296293-126296315 TACCTTTACTGTCCTACTTCAGG - Intergenic
1198783132 X:140258472-140258494 TACCTTTACTGTCCTACTTCAGG - Intergenic
1199144527 X:144349643-144349665 TACCTTTACTATCCTACTTCAGG - Intergenic