ID: 1126407828

View in Genome Browser
Species Human (GRCh38)
Location 15:48339952-48339974
Sequence CATTATATGAGAAAATTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 420}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126407821_1126407828 11 Left 1126407821 15:48339918-48339940 CCGTGGTGGACCTAAGGGTTTGC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG 0: 1
1: 0
2: 3
3: 41
4: 420
1126407819_1126407828 13 Left 1126407819 15:48339916-48339938 CCCCGTGGTGGACCTAAGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG 0: 1
1: 0
2: 3
3: 41
4: 420
1126407820_1126407828 12 Left 1126407820 15:48339917-48339939 CCCGTGGTGGACCTAAGGGTTTG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG 0: 1
1: 0
2: 3
3: 41
4: 420
1126407822_1126407828 1 Left 1126407822 15:48339928-48339950 CCTAAGGGTTTGCTTTTTTCCCC 0: 1
1: 0
2: 2
3: 30
4: 303
Right 1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG 0: 1
1: 0
2: 3
3: 41
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126407828 Original CRISPR CATTATATGAGAAAATTGAA AGG Intronic
900044715 1:496263-496285 CATTATTTTAAAAAATTGACAGG - Intergenic
900066119 1:731169-731191 CATTATTTTAAAAAATTGACAGG - Intergenic
900066514 1:734577-734599 CATTATTTTAAAAAATTGACAGG - Intergenic
900066910 1:737984-738006 CATTATTTTAAAAAATTGACAGG - Intergenic
900725066 1:4210977-4210999 TATAATTGGAGAAAATTGAATGG - Intergenic
904191441 1:28747202-28747224 CATTCTATGAAAACATTAAAAGG - Intronic
905810433 1:40908799-40908821 CATTTTATGAGAAAAGAGAATGG + Intergenic
905827737 1:41038977-41038999 CATCAAATGAGAAAATGGAATGG + Intronic
906830268 1:49023718-49023740 AATTATATGTGAAAAGTTAATGG - Intronic
907094586 1:51766083-51766105 TATTATTTGGGAAAATTAAAAGG + Intronic
908412149 1:63877686-63877708 CTTTATTAGAGAAAATTTAAGGG + Intronic
908977341 1:69913951-69913973 GATTATGTGATAAAATTGACAGG + Intronic
908998451 1:70188044-70188066 AATTATATGAGAAAAGAGAAAGG + Intronic
909775539 1:79480191-79480213 CATACTATAAGAAAAGTGAATGG + Intergenic
910249185 1:85177003-85177025 GATTATATGAGAAAAGAAAAGGG - Intronic
910432094 1:87168747-87168769 AATTAAATGAGAAGATTGCATGG - Exonic
910484324 1:87695974-87695996 CATTACACGAAAAATTTGAATGG + Intergenic
910914194 1:92271833-92271855 GATTATATGACAAAAGTGAAGGG + Intronic
911119136 1:94277650-94277672 CTTTATATGCTAAAATAGAATGG - Intergenic
912236884 1:107861950-107861972 CATTAGGTTAGAAAAATGAATGG - Intronic
913543662 1:119845557-119845579 CAATATATGGGAAAATGAAATGG - Intergenic
913938624 1:125081939-125081961 CATTATACAATAGAATTGAATGG - Intergenic
915277428 1:154799258-154799280 TATTATATGATCAAACTGAAAGG + Intronic
915849427 1:159305269-159305291 CATTAAAGGAGAATTTTGAAAGG - Intronic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916661267 1:166924123-166924145 GATTGCATGATAAAATTGAATGG - Intronic
917945009 1:179960468-179960490 CATTATTTGAGAAATTTTAATGG + Intronic
918424505 1:184394591-184394613 TTTTACATGAGACAATTGAAAGG + Intronic
918672830 1:187241384-187241406 TAGTAGATGAGAAAATTAAATGG - Intergenic
918880652 1:190115381-190115403 CAGTGGTTGAGAAAATTGAATGG - Intronic
918920664 1:190705732-190705754 AATTATTTCAGAAAGTTGAATGG + Intergenic
918922831 1:190736319-190736341 CATTTTATGAGAAAATCTATAGG - Intergenic
918979765 1:191540896-191540918 CTTTATCTAAGAAAATTGAGTGG - Intergenic
919291264 1:195634712-195634734 CATTATATGAGAACATAAAAAGG - Intergenic
920989218 1:210920424-210920446 CATAATATGAAAAATTTTAAGGG + Intronic
921403161 1:214748985-214749007 CATAATATGAGAGAATTTATGGG - Intergenic
921416555 1:214895087-214895109 AATGAAATGAGAAAAATGAATGG - Intergenic
921579101 1:216874247-216874269 CACTATGTGAGAATTTTGAAAGG - Intronic
921667687 1:217892307-217892329 CATTATAAAATAAAATTGAGGGG + Intergenic
923358982 1:233188894-233188916 CATTATCTGGCAAACTTGAAGGG - Intronic
924111484 1:240703952-240703974 GTTTATATGAGAAAATAGTATGG + Intergenic
1063356638 10:5406196-5406218 CAAAATATGAGAATATGGAAAGG - Intergenic
1063647114 10:7896200-7896222 TATTTTATTAGAAAACTGAAAGG - Intronic
1063709871 10:8467146-8467168 CACTATATGCGACAAGTGAATGG - Intergenic
1063772697 10:9222278-9222300 CATTGTATGGCAAAAGTGAAGGG + Intergenic
1063786039 10:9383804-9383826 CATAATATGAGAAATTTAGAAGG + Intergenic
1063805438 10:9634333-9634355 GATTATTTGAGACCATTGAATGG + Intergenic
1064835171 10:19519295-19519317 CATAATAGGAGAAAAGTCAAAGG - Intronic
1066118692 10:32262866-32262888 CATTATTTGAGAAGATTGTGTGG + Intergenic
1066361048 10:34731514-34731536 CATTTTATGAGAAACTTTATAGG - Intronic
1066567979 10:36740543-36740565 CATGATAGGAGAAAATTGATGGG - Intergenic
1066760563 10:38744077-38744099 GATAAAATGACAAAATTGAAAGG + Intergenic
1067795122 10:49315567-49315589 AATCATATTAGAAAACTGAAAGG + Intronic
1068824106 10:61413816-61413838 CATTATGGGAGAAAAATGATAGG + Intronic
1068987753 10:63122909-63122931 CATTATATGGCAAAGATGAAGGG - Intergenic
1070687657 10:78501194-78501216 CATTATGTGTTAAAATTGAAAGG + Intergenic
1071744607 10:88402247-88402269 CATTATAAGACAAAATAGAAAGG + Intronic
1071803891 10:89095251-89095273 CATTATCTGAGGAAAATGAAGGG + Intergenic
1072735760 10:97878426-97878448 CATGATATCAGAAAATGGCAGGG + Intronic
1073279351 10:102340858-102340880 CATTTTAGGAGAAAATGGGAGGG + Intronic
1074633199 10:115282610-115282632 GATAAAATTAGAAAATTGAAAGG + Intronic
1076971040 11:132738-132760 CATTATTTTAAAAAATTGACAGG - Intergenic
1078947723 11:16089351-16089373 AATTATAAGAGAAGAATGAAAGG + Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1081471301 11:43373680-43373702 ATTTATATGGGCAAATTGAAAGG + Intronic
1081835654 11:46151457-46151479 CATTATATGACAAATGTGAGAGG - Intergenic
1082203324 11:49400679-49400701 GAATAAATGAGAAAATTAAAAGG - Intergenic
1083553911 11:63610723-63610745 CATAATATGAGGAAATTGATAGG - Intronic
1085102112 11:73809721-73809743 TATTATGTGAGAAATTTCAATGG + Intronic
1085576335 11:77607163-77607185 CAATATATGACAAAATTCAATGG - Intronic
1087001859 11:93429036-93429058 AATTAAGTGAGGAAATTGAACGG - Intronic
1087029799 11:93691042-93691064 TACTATATAAGAAAAGTGAAGGG - Intronic
1087411399 11:97794220-97794242 CAGTATATAAGAATATTAAATGG + Intergenic
1087592782 11:100213168-100213190 CATTGTATGTGAAATTTGGAGGG - Intronic
1087738963 11:101866095-101866117 CTTTATATCTGTAAATTGAATGG + Intronic
1087793244 11:102429429-102429451 CATTACATGAGACTACTGAAAGG + Intronic
1088950412 11:114563976-114563998 CATTATATGAGAAAAGACACTGG + Intergenic
1089716006 11:120359828-120359850 CATTATAAAGGAAACTTGAAGGG + Intronic
1091410418 12:235432-235454 CATTAATTGTGAAAATTTAATGG + Intronic
1092923694 12:13255703-13255725 CATTGTAAGAGAAGAGTGAAGGG - Intergenic
1093603457 12:21059804-21059826 TCATATATGACAAAATTGAATGG - Intronic
1093991098 12:25591021-25591043 CTTTACTTGAGAAAAGTGAAGGG + Intronic
1095315931 12:40761295-40761317 TATTTTATGAGAAAATTAAATGG - Intronic
1095596941 12:43969972-43969994 CATGATCTGAGAATATTAAATGG + Intronic
1096046161 12:48564212-48564234 CAATAAATGAAAAAAATGAATGG + Intergenic
1096926975 12:55158608-55158630 TATTATGTGAGAAATTTGAATGG - Intergenic
1098049808 12:66441633-66441655 CATTGAAAGAGAAAATAGAAAGG - Intronic
1098909360 12:76193475-76193497 CCTTATAAGAGATAATTCAATGG + Intergenic
1099240425 12:80131629-80131651 TATTACAAGAGAAAATTGTATGG - Intergenic
1099394229 12:82118148-82118170 CAATATATCAGAAGATGGAAGGG - Intergenic
1099438969 12:82677996-82678018 CTTTTTGTGAGAAAATGGAATGG - Intergenic
1099700608 12:86077403-86077425 CATTACATGATAAAAAAGAAAGG + Intronic
1100079406 12:90829220-90829242 CATCATATGTGAAACTTAAATGG + Intergenic
1101141341 12:101798942-101798964 CATTACAAGAAAAAGTTGAATGG + Intronic
1103887272 12:124212085-124212107 CATTATATGGAAATATGGAAAGG - Intronic
1105333610 13:19441560-19441582 CATTAATTGAGATAATTGTAAGG - Intronic
1105922256 13:24974131-24974153 CATTAATTGAGATAATTGTAAGG - Intergenic
1106788889 13:33134499-33134521 CATTTTAAGAGTAACTTGAATGG + Intronic
1107487747 13:40846118-40846140 CATTAATTGAGATAATTGTAAGG - Intergenic
1107844120 13:44493434-44493456 CATTCTTTGAAAACATTGAAAGG + Intronic
1108223916 13:48267880-48267902 CAAAATATGAGCAAACTGAAGGG - Exonic
1109064707 13:57672421-57672443 CATTATATGGGGAATTAGAAAGG - Intronic
1109310372 13:60685796-60685818 CTTTAAATGAGTAAATTGTAAGG - Intergenic
1109765701 13:66893967-66893989 GATTTTATGAGGGAATTGAACGG - Intronic
1110819174 13:79894321-79894343 CATTATTTGAAATAATTGAGTGG - Intergenic
1111376834 13:87391184-87391206 AATTATACCAAAAAATTGAAGGG - Intergenic
1112453898 13:99539938-99539960 GATTGTCTTAGAAAATTGAAGGG + Intronic
1112453905 13:99540096-99540118 GATTGTCTTAGAAAATTGAAGGG + Intronic
1112532533 13:100218713-100218735 CATTATATGGCAAAAGTGATGGG + Intronic
1112717018 13:102198548-102198570 CAATTTATGGGAAAATTGAACGG + Intronic
1113051838 13:106221000-106221022 TTTTAGATTAGAAAATTGAAGGG + Intergenic
1114006254 14:18316639-18316661 CATGATAGGGGAAAATTGATGGG - Intergenic
1115955489 14:38774496-38774518 CATTATAGGAGAGCAGTGAATGG - Intergenic
1117363981 14:55006602-55006624 AAAGATATGAGAAATTTGAAAGG - Intronic
1119123628 14:72103090-72103112 CATTATATGAGAGATAAGAAAGG - Intronic
1120440979 14:84539096-84539118 TATTATCTTAGAAAATTGTATGG + Intergenic
1120481090 14:85050358-85050380 CATTATATAGCAAAAATGAAAGG - Intergenic
1121669904 14:95701069-95701091 AATTATATGATAAAGATGAAAGG + Intergenic
1121984109 14:98484130-98484152 GATTATTTGAGAACATTGCATGG - Intergenic
1122590716 14:102848600-102848622 GACTATTGGAGAAAATTGAATGG - Intronic
1124071468 15:26396814-26396836 CATTATATCAGAAAACAGACTGG - Intergenic
1125639569 15:41218745-41218767 CATTATAAAAGAATATTCAAGGG + Intronic
1126075984 15:44910179-44910201 CTTTATATGAGTGAATTGTAAGG + Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1126901003 15:53314154-53314176 CAATATATGACAACATTGATGGG + Intergenic
1127577341 15:60304598-60304620 CAATATCTGAGTATATTGAAAGG - Intergenic
1127750221 15:62030679-62030701 CATATTATGAGAAAATGGGAAGG + Intronic
1129010254 15:72409657-72409679 CATTATATGACTAAATTGACAGG + Intergenic
1129492616 15:75943864-75943886 CTTTATATGTGAGACTTGAATGG - Intronic
1130846010 15:87746799-87746821 AATTAAATGAGAAAAATAAAAGG - Intergenic
1131668375 15:94594291-94594313 CATGAGATGAGAAAATTGCTTGG + Intergenic
1131919754 15:97311883-97311905 CATAATAACATAAAATTGAAAGG + Intergenic
1134756906 16:16675149-16675171 CTTTAAATGAGTAAATTGCATGG - Intergenic
1134989162 16:18684014-18684036 CTTTAAATGAGTAAATTGCATGG + Intergenic
1136947282 16:34668234-34668256 CATTATCGGATGAAATTGAATGG - Intergenic
1138885167 16:61068330-61068352 CACCATTTGAGAAAATTGATGGG + Intergenic
1139488931 16:67276194-67276216 GATTAAATGACAAAATTTAATGG + Intergenic
1139770149 16:69268120-69268142 CATTATACAAGTAAATTCAATGG + Intronic
1139771849 16:69283870-69283892 CATTTTATGGGAAAACAGAATGG + Intronic
1142364768 16:89644467-89644489 CATTCTAGGAGAAAGGTGAATGG + Exonic
1142449209 16:90164780-90164802 CATTATTTTAAAAAATTGACAGG + Intergenic
1142457886 17:67101-67123 CATTATTTTAAAAAATTGACAGG - Intergenic
1142458279 17:70521-70543 CATTATTTTAAAAAATTGACAGG - Intergenic
1144597453 17:16583022-16583044 CTTCATATGATAAAATTGGATGG + Intergenic
1144767757 17:17742000-17742022 CTTTTTATTAGAAAATTAAAGGG - Intronic
1146359578 17:32163004-32163026 CCTTATTTGAGCAAATTGAGTGG + Intronic
1149310977 17:55393269-55393291 CAATATATGAGAAGATGCAAAGG + Exonic
1150587718 17:66533606-66533628 CCTTAGATGGGAAAAATGAATGG - Intronic
1153110629 18:1582094-1582116 CATTATATGGCAAAAGTGAAAGG - Intergenic
1153123098 18:1755375-1755397 CATTACATCAAAAAATTGTACGG - Intergenic
1153379561 18:4422263-4422285 CATTATATTACCAAATTTAATGG - Intronic
1153542420 18:6170037-6170059 TATTAAATGAGATAAATGAATGG - Intronic
1153980645 18:10306111-10306133 CATTAAATGAGATGATTCAATGG - Intergenic
1154531222 18:15347548-15347570 CATGATAGGGGAAAATTGATGGG + Intergenic
1156205812 18:34884333-34884355 CCTTCTATGAGTAAAATGAAGGG + Intronic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1157375743 18:47162783-47162805 CAATGAATGAGAAAATTAAAAGG + Intronic
1157859591 18:51128970-51128992 CTTGAAATGAGAAAATTAAAGGG + Intergenic
1158194561 18:54869628-54869650 CATTCTAAGAGAAAAGTGAATGG + Intronic
1158451778 18:57573074-57573096 TATGATATCAGAAAATTGCAGGG - Intronic
1159704616 18:71672084-71672106 AATTATATGATAAAAATTAAAGG - Intergenic
1160116918 18:76087340-76087362 CATTATATGTGCAAAATGAAAGG + Intergenic
1160647997 19:203027-203049 CATTATTTTAAAAAATTGACAGG - Intergenic
1167405767 19:49307392-49307414 CAATATATGATAAAATTGAAGGG + Intronic
1168303892 19:55423412-55423434 CATTATATGACATCATTGTATGG - Intergenic
925688511 2:6496193-6496215 AATAATATGAGAAATTTGAAAGG - Intergenic
925727796 2:6890786-6890808 CATTACATTAGAAAACTAAATGG - Intronic
925859986 2:8165254-8165276 TATTATTTGGGAAAACTGAAAGG - Intergenic
925998349 2:9310248-9310270 CAATTTATGAGAAACTTGAGAGG - Intronic
926233995 2:11025769-11025791 CATTAAAAGAGAAAATAAAAGGG - Intergenic
926993563 2:18707551-18707573 TATTATATGACAAACTAGAATGG + Intergenic
927130532 2:20054651-20054673 CCTTTTTTGAGAAAATTGTAAGG + Intergenic
928060341 2:28106210-28106232 CAATATAAGTGAAATTTGAATGG - Intronic
928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG + Intergenic
929175403 2:38970512-38970534 CATTAAAGGGGATAATTGAAGGG + Intronic
929311805 2:40434184-40434206 CATTATCAGAGAAAAAGGAAGGG + Intronic
929332859 2:40704918-40704940 CATGGTATGAGAAAGTCGAATGG - Intergenic
929358303 2:41052396-41052418 TATTATAAGAGAAAATAAAAAGG - Intergenic
930152244 2:48070516-48070538 CATTCCATGAGAAAAGTAAAGGG + Intergenic
930220077 2:48737240-48737262 CATTATCTGTGGAAAATGAATGG - Intronic
930845739 2:55901770-55901792 CAGTATATGGCAAAATTGATGGG + Intronic
931145589 2:59513296-59513318 GATTATCTTAGAAAACTGAAAGG + Intergenic
931796495 2:65715157-65715179 CATTATTTCAGAAAATCAAATGG - Intergenic
931956173 2:67428071-67428093 CCATATTTTAGAAAATTGAATGG + Intergenic
931972350 2:67602782-67602804 TATTACATGAGAAAATTTAGCGG + Intergenic
933176734 2:79182568-79182590 TATTATAAGTGAAAATTAAATGG - Intergenic
933203233 2:79475431-79475453 CATTAAATAAGAATACTGAATGG - Intronic
933510979 2:83241361-83241383 GAATATATGAGAAAATTCTAAGG + Intergenic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
935474807 2:103505804-103505826 CATTATATGAGTAAAGTAAGAGG - Intergenic
936001578 2:108836193-108836215 CATTGAAGCAGAAAATTGAATGG - Intronic
936109550 2:109653695-109653717 AAGAATATGAGAAAATTGAAAGG - Intergenic
936744914 2:115563448-115563470 AATCAAATGAGAAAATGGAAAGG + Intronic
937162120 2:119774261-119774283 CATTACAAGAAAAAGTTGAATGG + Intronic
938530314 2:132178831-132178853 CATGATAGGGGAAAATTGATGGG + Intronic
939981504 2:148787607-148787629 CAGTATAAGTGAAAATTTAAGGG + Intergenic
940176680 2:150885205-150885227 CATAGTAAGAGAAAATTGACAGG - Intergenic
940210336 2:151250212-151250234 TAACATATGAGAAATTTGAAAGG - Exonic
940333205 2:152498088-152498110 CATTATATGGCAAAGGTGAAAGG - Intronic
940477628 2:154184786-154184808 TATTATATGAAAAAATGTAAAGG - Intronic
940774012 2:157867920-157867942 CATTAAATGAGATAATGAAAGGG + Intronic
940997793 2:160168877-160168899 CATTAGATGAAATAATTCAAGGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941963720 2:171279727-171279749 CATTAAAAGAAAAAGTTGAATGG + Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943171170 2:184402397-184402419 CATAAAATGAGAATATGGAAGGG + Intergenic
943593813 2:189831237-189831259 TTTTAAATGAGAAAATTGGAAGG + Intronic
944714002 2:202360988-202361010 GATTCTATTTGAAAATTGAATGG - Intergenic
944759101 2:202794892-202794914 CATTAAATGTGAAAACTGACAGG - Intronic
945672033 2:212813870-212813892 CATTAGAAAGGAAAATTGAAGGG - Intergenic
947226791 2:227848383-227848405 CTTTATAAGAGAAACTAGAATGG + Intergenic
947368629 2:229422752-229422774 CATTAAAGAAGAAAATGGAAGGG + Intronic
947497217 2:230646630-230646652 TAATATATAAGGAAATTGAAGGG + Intergenic
948975801 2:241463153-241463175 CATTATATTTGAAAACTGGATGG + Intronic
1168902382 20:1376026-1376048 CATTATATGTGAAAGATGATGGG - Intronic
1169703002 20:8469791-8469813 CTTTATATGAGTGAATTGTATGG - Intronic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1170473757 20:16693983-16694005 AATTTTATGACAAAAATGAAGGG + Intergenic
1171014333 20:21526128-21526150 CATTAAATGGGTAAATTGTATGG + Intergenic
1172540369 20:35709994-35710016 GATTATATGAGAAAATATATTGG - Intronic
1172723821 20:37020404-37020426 CATTAAATGAACAAATGGAATGG + Intronic
1173431461 20:42990984-42991006 TATTATATTAGAAAATTTAGGGG + Intronic
1173885574 20:46455424-46455446 TTTTATAAGTGAAAATTGAACGG - Intergenic
1174595632 20:51681162-51681184 CATTACATGAGGACATTTAATGG - Intronic
1174801908 20:53571347-53571369 CATTATATTAGACAACTTAATGG + Intronic
1176739441 21:10587065-10587087 CATTAATTGAGATAATTGTAAGG + Intronic
1176766186 21:13020911-13020933 CATGATAGGGGAAAATTGATGGG - Intergenic
1177246842 21:18537005-18537027 TATTATATTAAAAAATTCAAAGG + Intergenic
1177401913 21:20615424-20615446 CATTATCTCATAAAATTAAATGG + Intergenic
1177520736 21:22220269-22220291 CAAAATATTAGAAAAGTGAATGG - Intergenic
1177636366 21:23791853-23791875 CAAATTATGAGAAAATTGACTGG + Intergenic
1178740420 21:35195004-35195026 AATTATATGAGTGAATTGATAGG - Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180430765 22:15247452-15247474 CATGATAGGGGAAAATTGATGGG - Intergenic
1181292045 22:21802762-21802784 CTTTAAATGAGCAAATTGTATGG - Intronic
1203327722 22_KI270738v1_random:43187-43209 CATTATAGAATAGAATTGAATGG + Intergenic
949441663 3:4087690-4087712 TATTATATAATCAAATTGAAAGG + Intronic
949832599 3:8231827-8231849 AATTATTTGAGAAAGATGAAAGG + Intergenic
950698061 3:14719777-14719799 CATCCTATGAGAAAATTTCATGG + Intronic
953176276 3:40555762-40555784 AATTATAGGACAAAACTGAAAGG - Intronic
955095084 3:55789175-55789197 CATTATAGGATAAAATTGGCGGG - Intronic
955332280 3:58057364-58057386 CAAAACATTAGAAAATTGAAAGG - Intronic
955641268 3:61087891-61087913 CAGTATCTCACAAAATTGAAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957178910 3:76850803-76850825 CATAATATCCTAAAATTGAATGG - Intronic
957990916 3:87626569-87626591 CATTATAAGAGAAAAGAGAGAGG - Intergenic
958136754 3:89503894-89503916 CATTATATAAGAAACATAAAAGG - Intergenic
959316827 3:104820187-104820209 CATTATATGAGAGAAATAAAAGG + Intergenic
959358576 3:105363167-105363189 CATGATATGAGAAGATGAAAGGG - Intergenic
959429065 3:106229614-106229636 CATTATATGGCAAAAGTGAGGGG + Intergenic
960167390 3:114419005-114419027 CATCAAATTATAAAATTGAAGGG + Intronic
963237464 3:142969874-142969896 CATTATATTAAAAAACTTAAGGG - Intronic
963321458 3:143813769-143813791 GAGTATATGAGAATCTTGAAGGG - Intronic
963599054 3:147361386-147361408 CATTAGAAGAGAAAAGTGCACGG - Intergenic
963961169 3:151310809-151310831 AATTATATGAGTACATTGGAAGG + Intronic
964578635 3:158204874-158204896 CATTATATGGGGAATTTTAAAGG + Intronic
965018705 3:163197167-163197189 TTTTATATGAGAGAATTGTAAGG + Intergenic
965833318 3:172823067-172823089 CAGTATAGGAGAAAAATAAATGG + Intergenic
965867827 3:173226962-173226984 CATTATATGAAAACAGTGCATGG - Intergenic
968263239 3:197341733-197341755 CATTTTAAGAGAAAATAGTATGG - Intergenic
968369850 3:198217088-198217110 CATTATTTTAAAAAATTGACAGG + Intergenic
969256498 4:6005695-6005717 GATTACATGAGAAAACAGAATGG + Intergenic
969923986 4:10568481-10568503 CATAAAATGCGTAAATTGAATGG + Intronic
970246221 4:14066698-14066720 AATCAAATGAGAAAATGGAAGGG - Intergenic
972966458 4:44516652-44516674 CATTATTTTAGAGTATTGAAAGG - Intergenic
974346290 4:60686137-60686159 CATTATATCAGAGAATTCTATGG + Intergenic
974466001 4:62257096-62257118 AATTATATGAGCAATTTTAAAGG + Intergenic
974646435 4:64699347-64699369 CTTTATATTAGAAAATAAAAAGG + Intergenic
975053730 4:69900347-69900369 AATTATGTGAGAAAGTGGAAAGG + Intergenic
975056614 4:69940664-69940686 AATTATATTAGAATATTAAATGG - Intronic
975151072 4:71021514-71021536 TATTATATTAGAAGATTGGAGGG + Intronic
975213967 4:71732480-71732502 GATTAGATGAGAAAATAGATAGG + Intergenic
975318959 4:72988369-72988391 CATTATATTAGAAAACTGAGAGG + Intergenic
975759264 4:77602656-77602678 CATAAAATGAGAAAATTATAGGG - Intronic
975930545 4:79517172-79517194 CATTTTAAGAGAAAATTACATGG + Intergenic
976480961 4:85544808-85544830 AATTATCTGAGAAAGATGAAAGG - Intronic
977202013 4:94128432-94128454 GAATAAATGAGAAAATTTAATGG + Intergenic
977663361 4:99616488-99616510 CATTATATCTTAAGATTGAAAGG - Intronic
978265690 4:106821877-106821899 CATTAAATGATTAAAATGAAGGG - Intergenic
979776885 4:124600498-124600520 CATTTAAAGAGAAGATTGAAGGG + Intergenic
979849523 4:125559148-125559170 CAAAATTTGAGAAAATTAAATGG - Intergenic
980303388 4:131023758-131023780 CATTATATGAGCCACTTTAAGGG + Intergenic
980608073 4:135119828-135119850 TATTTTATGGGAAAACTGAAGGG - Intergenic
980986368 4:139698927-139698949 TATTACAAGAAAAAATTGAATGG - Intronic
981543224 4:145867513-145867535 CATTCAATGAGAAGACTGAAAGG + Intronic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982340920 4:154297820-154297842 CAATATATGAAAAACTTGAAGGG + Intronic
982818933 4:159922312-159922334 CATAATATAGGAAAATGGAAAGG + Intergenic
982833451 4:160092009-160092031 TATTATATGAGAAATTATAATGG - Intergenic
982982322 4:162155157-162155179 CATTATATGGCAAAAAGGAAGGG + Intronic
983050004 4:163034963-163034985 ATATATATGACAAAATTGAAAGG - Intergenic
983100696 4:163622354-163622376 CAGTATATCAGGAAATGGAAGGG + Intronic
983198407 4:164834108-164834130 AATTATAAAAGCAAATTGAAAGG - Intergenic
983858836 4:172679061-172679083 TATGACATGAGAAAATTCAATGG - Intronic
984816638 4:183843661-183843683 CATCATATGTGAAAATTATATGG - Intergenic
984817904 4:183855542-183855564 CATTATTGGAGAAAAACGAATGG + Intronic
985364309 4:189210898-189210920 TTTTATATGAGAATATTGAAAGG + Intergenic
987080904 5:14424472-14424494 CAGTGAATGAGAAAATTAAAGGG + Intronic
987154542 5:15076035-15076057 CTTTAAATGAGTAAATTGCATGG + Intergenic
987223951 5:15820430-15820452 GATTATATAAGAAAAGTAAAAGG - Intronic
987517557 5:18933121-18933143 CATGAAATGAGAATTTTGAAAGG + Intergenic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987942602 5:24561366-24561388 AATTATATGAGAAAATTGTGAGG + Intronic
988005539 5:25405773-25405795 CTATATATGAAAAAATTTAATGG - Intergenic
988101478 5:26684879-26684901 CTTTATGTGATAAAGTTGAAAGG + Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
989271391 5:39537636-39537658 AATTATTTGAAAAAATTAAATGG - Intergenic
990040220 5:51370466-51370488 CATTATATGGCAAAAGTGAAAGG + Intergenic
990128984 5:52556277-52556299 CATAATATTTAAAAATTGAAAGG + Intergenic
991426971 5:66502348-66502370 CAATATTTGAGAAAATGGTATGG - Intergenic
991635942 5:68705807-68705829 CATTGTAGGATAGAATTGAAAGG - Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992938201 5:81733961-81733983 AATTATATGAAAAAAATCAAAGG + Intronic
992952896 5:81878261-81878283 CATTATGTAAGAATCTTGAATGG + Intergenic
992973622 5:82088625-82088647 CATTTAAAGAAAAAATTGAAAGG + Intronic
993301183 5:86212698-86212720 CAATATATGAAAAACTTCAAAGG + Intergenic
994403363 5:99311706-99311728 AAATAGATGAAAAAATTGAAGGG - Intergenic
995357055 5:111250791-111250813 TAAAATATGAGAAAACTGAAGGG - Intronic
995874834 5:116779585-116779607 CATTATATGACACATTTCAAAGG - Intergenic
995976217 5:118038596-118038618 AATTATATTAGCAAATAGAATGG + Intergenic
996612433 5:125398500-125398522 CATTATTTTTGAAAATAGAATGG + Intergenic
996616517 5:125448068-125448090 CAATTTATGAGAAACTTGAATGG + Intergenic
997915927 5:137925152-137925174 CATTATATGAGAACCTTATAAGG + Intronic
998248551 5:140532699-140532721 CTTTAAATGAGTAAATTGTATGG + Intronic
999568820 5:152895630-152895652 CATTATTTTACACAATTGAAAGG - Intergenic
1000123252 5:158218471-158218493 CTTAACATGATAAAATTGAAGGG - Intergenic
1000172563 5:158717008-158717030 CATTATGTAAGTAGATTGAAAGG + Intronic
1000304795 5:159985272-159985294 CATTACATGTGATAATTAAAAGG - Intergenic
1001879079 5:175227445-175227467 CATTTTCTGAGAAACTGGAATGG + Intergenic
1002729129 5:181322666-181322688 CATTATTTTAAAAAATTGACAGG + Intergenic
1003958516 6:11188546-11188568 CATTATATATGAGATTTGAAGGG - Intronic
1007544172 6:42679406-42679428 CATTAAATGATAAAAATGTATGG - Intronic
1008134621 6:47759651-47759673 CATTAGATGTGAAAAATGGAAGG - Intergenic
1008309219 6:49944743-49944765 AATTTTATAAGAAAATAGAAAGG - Intergenic
1008309481 6:49949183-49949205 TATTGTATGAGACAATTTAAAGG - Intergenic
1009437901 6:63638458-63638480 GATTTTATGAGAAATTTAAATGG - Intronic
1009753641 6:67905306-67905328 TTTTATATGAGTAAATTTAAAGG - Intergenic
1009776549 6:68212740-68212762 TATTGGATGAGAAAATAGAAGGG - Intergenic
1010148311 6:72698552-72698574 CATTATATGAACATGTTGAAAGG + Intronic
1010808920 6:80275492-80275514 ATTAATATGAGAAATTTGAAAGG + Intronic
1011458767 6:87581046-87581068 CATTGTATCAGAAAAATAAATGG - Intronic
1011631338 6:89327975-89327997 CATTATATGAGGAAAATCATAGG - Exonic
1011986402 6:93452146-93452168 TATCAAATGAGAAAATTGATTGG - Intergenic
1011991064 6:93518421-93518443 CATTATAATATAAAATTAAAAGG - Intergenic
1012220875 6:96647776-96647798 CATAGTATGAGAAATATGAAGGG - Intergenic
1012467787 6:99534784-99534806 AATTGTATGTGAAAATTGTAAGG - Intergenic
1013154142 6:107476986-107477008 CATTCTATTAGGAAAGTGAATGG + Intergenic
1013166042 6:107593133-107593155 CTTTATATAGGAAAAGTGAAAGG - Intronic
1014148019 6:118020865-118020887 AGTTATCTGAGAAAATTGACTGG + Intronic
1014647135 6:123987974-123987996 CAGTATATGAGACAGGTGAATGG + Intronic
1016124110 6:140378607-140378629 AATTTTATGAGAAAGTTGCATGG + Intergenic
1016505768 6:144777336-144777358 AATTAAATGAAAAAATTAAATGG + Intronic
1016656508 6:146524418-146524440 CAACATATGAGGAAATTGCAGGG - Intergenic
1017362375 6:153589847-153589869 CATTACATCATAAAATTAAAGGG + Intergenic
1017370631 6:153702529-153702551 CTTTAAATGAGCAAATTGTATGG - Intergenic
1017541088 6:155404166-155404188 GCTTATATGAGAAAACTCAAGGG - Intronic
1017667673 6:156736866-156736888 CATTATTTTAGGAAATTGAATGG + Intergenic
1020605410 7:10331160-10331182 CATTTTATCAGAAAACTAAAGGG - Intergenic
1020708592 7:11576793-11576815 TCTTATAAAAGAAAATTGAAGGG - Intronic
1020906878 7:14074341-14074363 CATTATAGGAGAGAATTCAAGGG - Intergenic
1021059835 7:16097960-16097982 TATCCTTTGAGAAAATTGAAAGG - Intronic
1021141760 7:17034163-17034185 CATTATGTGTTAAAATTGAAAGG - Intergenic
1022256941 7:28667936-28667958 CATTATGTGAGACAATTTAAAGG + Intronic
1023071608 7:36440313-36440335 CAATAGAAGAGAACATTGAAAGG + Intronic
1023243120 7:38170450-38170472 CATTACAGGAGAAAAATGGAGGG - Intergenic
1023664993 7:42513683-42513705 CATTTTATGAGAAAAGTCATAGG - Intergenic
1024133441 7:46381215-46381237 AATTTCATGATAAAATTGAATGG + Intergenic
1024515880 7:50255162-50255184 CATTATAAAAATAAATTGAAAGG + Intergenic
1027137107 7:75632297-75632319 CAGTATGTGAGTGAATTGAATGG + Intronic
1027421532 7:78021635-78021657 CATTCTATGTGAAATTCGAATGG + Intronic
1027539459 7:79450907-79450929 AAATCTATGAGAAATTTGAAAGG - Intronic
1027715418 7:81663323-81663345 CATTCTCTGAGAAAAGAGAAAGG + Intergenic
1028545150 7:91990840-91990862 CATTATCTGAAAATATTAAATGG + Intronic
1030012553 7:105184966-105184988 CATTCTATGAGATCATTAAAAGG + Intronic
1030529876 7:110699271-110699293 CATTAAATGAGATATTAGAAAGG - Intronic
1030764895 7:113396579-113396601 CATTGAATGATAAAATTCAATGG + Intergenic
1030796861 7:113799410-113799432 CATTACATGACAAGATTAAAGGG + Intergenic
1030984438 7:116224493-116224515 AATTATATTTCAAAATTGAAAGG - Intronic
1031091899 7:117367554-117367576 CATTAGATTACATAATTGAAAGG + Intronic
1031673276 7:124578400-124578422 CATTATATGACAAAAGTAAAGGG + Intergenic
1031757143 7:125659326-125659348 TTTTATATGATAAAGTTGAAGGG - Intergenic
1031940942 7:127788452-127788474 TATTAAATGAGTAAATTAAAAGG - Intronic
1032050860 7:128649803-128649825 CATTATTTTAAAAAATTGACAGG + Intergenic
1034565794 7:151914609-151914631 CATTATATGGCAAAAATGAGGGG + Intergenic
1036027101 8:4921603-4921625 CATTATCTGAGTAAAATAAAAGG - Intronic
1036136639 8:6167783-6167805 CTTTAAATGAGAAAATTGTATGG + Intergenic
1037202243 8:16270061-16270083 AAATACATGAGAAATTTGAAAGG - Intronic
1037212403 8:16406974-16406996 AATTATATGAAAACCTTGAAAGG + Intronic
1037542826 8:19888740-19888762 CATTTCATGTGAAACTTGAAAGG + Intergenic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1038301484 8:26354286-26354308 GATTAAATGAGAAAACTTAACGG - Intronic
1038386156 8:27148023-27148045 CATTAAAAGAGGAAAATGAAAGG - Intergenic
1038991523 8:32873545-32873567 CATAATATGAGACACTTCAAAGG - Intergenic
1039974863 8:42354033-42354055 GCTTATATGAGAGAATTGATTGG + Intronic
1040665401 8:49625586-49625608 TATTAGATGAGAAAAATAAAAGG - Intergenic
1041151187 8:54936284-54936306 TTTTATAGGTGAAAATTGAAAGG - Intergenic
1042013641 8:64281902-64281924 CATTTTAGGACAAAATTAAATGG - Intergenic
1042237773 8:66630985-66631007 AATTATATGATAACCTTGAATGG + Exonic
1042673058 8:71285326-71285348 CACTAAATGAGAAACTAGAAAGG + Intronic
1042673919 8:71296511-71296533 CATAATATAATGAAATTGAAAGG + Intronic
1042701606 8:71621537-71621559 TATTATAAAGGAAAATTGAATGG - Intergenic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043170515 8:76960151-76960173 AAGTATATGAGTTAATTGAAAGG - Intergenic
1043740649 8:83807519-83807541 CAATATATGTGAAGATTGAAGGG - Intergenic
1044022204 8:87118442-87118464 TATTATTTGAGAAAATTTGAAGG + Intronic
1044504841 8:93005681-93005703 CAGAATGTGGGAAAATTGAAAGG + Intronic
1044520758 8:93196666-93196688 AAGTATATGAGAAAAATAAAGGG + Intergenic
1044944344 8:97376707-97376729 CATCATGTGAGAAACATGAAAGG + Intergenic
1045216479 8:100154109-100154131 CATTATATGAAAATACAGAAAGG - Intergenic
1045908186 8:107374118-107374140 CTTTTTATGAGTAAATGGAAAGG - Intronic
1046241368 8:111499094-111499116 GCTTATATGGGCAAATTGAATGG + Intergenic
1046290455 8:112153208-112153230 CATTATGATAGAAAATTCAAGGG - Intergenic
1046447340 8:114340117-114340139 CATTCTATGAGAAAACTATAGGG + Intergenic
1047310519 8:123687972-123687994 CATTATTTGAAAACATTGAAAGG + Intronic
1047596470 8:126382675-126382697 AATTATGTGAGAGAATGGAATGG - Intergenic
1047686447 8:127309487-127309509 CATTAGATGAAAGAATGGAAAGG - Intergenic
1048522165 8:135166455-135166477 GAATAGATGAGAAAAATGAAAGG - Intergenic
1049008122 8:139870139-139870161 AAATATATGAGAAAAGTGATTGG + Intronic
1050069210 9:1792701-1792723 GATGAGATGAGAAAAATGAATGG - Intergenic
1051243698 9:15086687-15086709 TATTCTCTGAGAAAATTGATTGG + Intergenic
1051672232 9:19522414-19522436 CATTTTTTGAAAAAATTTAAAGG + Intronic
1051978527 9:22984312-22984334 CTTTATATGGTAAAATTGAGTGG + Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1052570011 9:30208709-30208731 CATAATATGATAGAAATGAAAGG + Intergenic
1053340038 9:37318167-37318189 CATTATATGACTATATTGTAAGG - Intronic
1053708926 9:40785289-40785311 CATGATAGGGGAAAATTGATGGG + Intergenic
1054418836 9:64906086-64906108 CATGATAGGGGAAAATTGATGGG + Intergenic
1055589692 9:77799092-77799114 CATAATATGATAGAATTGAGTGG + Intronic
1056462423 9:86820948-86820970 GATTTTATGAGAAAACAGAAGGG - Intergenic
1057029591 9:91765245-91765267 CATGAAATGAGAAACTTGATGGG - Intronic
1058692429 9:107530959-107530981 TATTACATGAGAAATTTTAAAGG + Intergenic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059462326 9:114440966-114440988 CATTATAAGAAAAAGTTGCATGG + Intronic
1059653714 9:116338139-116338161 CAGTTTATTATAAAATTGAATGG + Intronic
1059733750 9:117081556-117081578 CATTATATGACAAGGGTGAAAGG + Intronic
1059951969 9:119475417-119475439 CATTATATAAAATATTTGAAAGG + Intergenic
1060766754 9:126299973-126299995 CATTATCTCAGAAAGTTGTATGG + Intergenic
1203576709 Un_KI270745v1:14546-14568 CATTATTTTAAAAAATTGACAGG + Intergenic
1203577106 Un_KI270745v1:17968-17990 CATTATTTTAAAAAATTGACAGG + Intergenic
1186968808 X:14817527-14817549 CATTAAAAGAGTAAATTAAAGGG + Intergenic
1188218229 X:27505676-27505698 CAGAATATGACAAAAGTGAAGGG + Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1192110523 X:68359422-68359444 AAATATAAGAGACAATTGAAAGG + Intronic
1193263884 X:79444428-79444450 CATTATATCAACAAAATGAAGGG - Intergenic
1193500755 X:82271292-82271314 TGTTATATTAGAAAATTCAAAGG - Intergenic
1193807479 X:86012331-86012353 CATTATCTGAGGAATTTAAAAGG + Intronic
1193862915 X:86693347-86693369 CAGTATATGTAAAGATTGAAGGG - Intronic
1193934259 X:87596300-87596322 CATTATATATGAACATGGAAAGG - Intronic
1195244420 X:102982726-102982748 CATCATATGACAAAAAGGAAAGG + Intergenic
1195449351 X:104992775-104992797 AATTATAAATGAAAATTGAAAGG - Intronic
1196317326 X:114243466-114243488 CATCATATGTGCAAAGTGAAAGG + Intergenic
1197462390 X:126758368-126758390 CAATTTATGGGAAAATGGAATGG + Intergenic
1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG + Intergenic
1198025279 X:132699541-132699563 TCTTATATGAGAAAATGAAATGG - Intronic
1198153926 X:133938978-133939000 AATTATTTAAGAAAATTGAATGG - Intronic
1198162877 X:134025069-134025091 CATTATATGAGATGATATAAAGG - Intergenic
1198735979 X:139785756-139785778 CAGTATTTGAGAAACTAGAAGGG - Intronic
1199231179 X:145437584-145437606 CAATATATGATAAAATTGAAGGG + Intergenic
1199275515 X:145937682-145937704 CATTACAAGAAAATATTGAATGG - Intergenic
1199277841 X:145967091-145967113 CACTGAATGGGAAAATTGAAAGG + Intergenic
1199813646 X:151376523-151376545 CATTAAATCACAAAAGTGAAAGG + Intergenic
1201548731 Y:15196221-15196243 CATTAAATGAAAAAATTATATGG - Intergenic
1202140260 Y:21714078-21714100 AATTATTTGAGTAATTTGAAAGG - Intergenic
1202597746 Y:26560868-26560890 CATTAACTGAGATAATTGTAAGG + Intergenic