ID: 1126412924

View in Genome Browser
Species Human (GRCh38)
Location 15:48390584-48390606
Sequence GGACTCAAGACAGGAAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126412924_1126412933 13 Left 1126412924 15:48390584-48390606 CCTACTCTTCCTGTCTTGAGTCC No data
Right 1126412933 15:48390620-48390642 GTGACTGCATCCTGAGATTTGGG No data
1126412924_1126412932 12 Left 1126412924 15:48390584-48390606 CCTACTCTTCCTGTCTTGAGTCC No data
Right 1126412932 15:48390619-48390641 GGTGACTGCATCCTGAGATTTGG No data
1126412924_1126412935 19 Left 1126412924 15:48390584-48390606 CCTACTCTTCCTGTCTTGAGTCC No data
Right 1126412935 15:48390626-48390648 GCATCCTGAGATTTGGGGAATGG No data
1126412924_1126412934 14 Left 1126412924 15:48390584-48390606 CCTACTCTTCCTGTCTTGAGTCC No data
Right 1126412934 15:48390621-48390643 TGACTGCATCCTGAGATTTGGGG No data
1126412924_1126412928 -9 Left 1126412924 15:48390584-48390606 CCTACTCTTCCTGTCTTGAGTCC No data
Right 1126412928 15:48390598-48390620 CTTGAGTCCTGGCCCTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126412924 Original CRISPR GGACTCAAGACAGGAAGAGT AGG (reversed) Intergenic
No off target data available for this crispr