ID: 1126417839

View in Genome Browser
Species Human (GRCh38)
Location 15:48436974-48436996
Sequence CCCTGCTAGAATATAACCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126417837_1126417839 -9 Left 1126417837 15:48436960-48436982 CCTACACATTCATTCCCTGCTAG 0: 1
1: 0
2: 2
3: 16
4: 169
Right 1126417839 15:48436974-48436996 CCCTGCTAGAATATAACCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 75
1126417836_1126417839 16 Left 1126417836 15:48436935-48436957 CCTATGGAAGAAAACTTATTACT 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1126417839 15:48436974-48436996 CCCTGCTAGAATATAACCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126417839 Original CRISPR CCCTGCTAGAATATAACCAA AGG Exonic
901129850 1:6955403-6955425 CCCTGCTTGTCTATAGCCAAAGG + Intronic
904957568 1:34297791-34297813 ACCTGCTTGGATATAACCATGGG - Intergenic
906144277 1:43550612-43550634 CCCTCCTAGAACATAACCCTGGG - Intronic
907816704 1:57925322-57925344 ACCTGTCAGAATATAACCAGTGG - Intronic
909986151 1:82162933-82162955 CCTTGCTAAAAAATAATCAAGGG - Intergenic
912092210 1:106093202-106093224 CCCTTATAGAATAAACCCAAAGG + Intergenic
916307479 1:163354486-163354508 CTCTGCTAGAATTTAAACTAAGG + Intronic
916831035 1:168491344-168491366 CCCTACTAGAATATAAGCTCTGG + Intergenic
921963254 1:221058693-221058715 CCGTGACAGAATATAGCCAAAGG - Intergenic
1068484600 10:57641373-57641395 CCCTTCTGGAATAAAACAAATGG + Intergenic
1081736023 11:45404862-45404884 CCCTACTAGAATATAAACTGAGG + Intergenic
1088140144 11:106606137-106606159 TCCTGCTAGAAGATTACAAAGGG + Intergenic
1096506145 12:52094848-52094870 TTCTGCTATAATATGACCAATGG + Intergenic
1099841102 12:87968437-87968459 CCCTGCTATAATATGTCCCAAGG + Intergenic
1114276537 14:21151006-21151028 TCTTGGTAGAATATAACGAATGG + Intergenic
1117323477 14:54646873-54646895 CCCTGCTTGCATTTAACTAATGG + Intronic
1119716193 14:76861118-76861140 ACCTGCTAGCGTATGACCAAGGG + Intronic
1124436604 15:29654777-29654799 CTCTGCTAGTGTATAATCAAAGG - Intergenic
1126417839 15:48436974-48436996 CCCTGCTAGAATATAACCAAAGG + Exonic
1130041588 15:80409719-80409741 CCCTGAGATAAAATAACCAAGGG + Intronic
1133406878 16:5531544-5531566 CTCTGCTACATTCTAACCAAGGG + Intergenic
1133670112 16:8010303-8010325 CCCTCTTAGAAGATAGCCAAAGG - Intergenic
1142951604 17:3485908-3485930 CCCTCCTAGAATGCAACCACTGG - Intronic
1148242630 17:46010592-46010614 CCCTCCTAGAATATGAGGAAGGG - Intronic
1153882219 18:9431425-9431447 CCCTGTTACAATATAAACTAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1164719539 19:30422499-30422521 CCCTGCAAGAGTATAGCCCATGG + Intronic
1166517907 19:43461155-43461177 CCCTGGCAGAATATATACAACGG + Exonic
930043224 2:47145401-47145423 CCCTGAGAGATTATAACCATGGG + Intronic
934927939 2:98394939-98394961 CCTAGCAAGAATATAACCACTGG + Intronic
938741826 2:134239414-134239436 TACTACTAGAATAGAACCAAAGG + Intronic
941065810 2:160901290-160901312 CCATCCTAGAATATAATCACAGG + Intergenic
1169395963 20:5229448-5229470 TTCTGCTAGAATAAAAACAATGG + Intergenic
1172924856 20:38523945-38523967 CCATACTAGCAAATAACCAATGG - Intronic
1173296585 20:41764590-41764612 CCCTGCTTGAAGATAACTACGGG + Intergenic
1182983500 22:34695159-34695181 CCATGTTAGAATATCCCCAAGGG + Intergenic
949905797 3:8857407-8857429 CCCTGCTGCAAAATAACCGAAGG - Intronic
952809056 3:37385326-37385348 CTCTGAGAGAATATAATCAAAGG - Intergenic
955240492 3:57173864-57173886 CCCTGCTAAAATGTAAACAGGGG - Intergenic
957559815 3:81808877-81808899 TCCTGCCAGAAAATAACAAAAGG - Intergenic
959690220 3:109190222-109190244 CCCTGCTTTAACACAACCAAAGG - Intergenic
962248253 3:133816355-133816377 CCCTGATTGAATATAAGGAAGGG + Intronic
963379762 3:144513627-144513649 GCCTGGTAGAAGTTAACCAAAGG + Intergenic
963660053 3:148114060-148114082 CTCTTCTATAATATAACCTAAGG + Intergenic
964691166 3:159451721-159451743 TCCTTCTAGATTATAACCTAAGG - Intronic
965487608 3:169297240-169297262 GCCTGTTAGATTATAACCAAAGG - Intronic
974028943 4:56758541-56758563 CACAGCTAGTATATAACAAAAGG - Intergenic
976178310 4:82375807-82375829 ACCTGCCAGAATATTAGCAAAGG + Intergenic
980632956 4:135461166-135461188 CTCTGCTAGATTAAAACCACTGG + Intergenic
982093397 4:151899103-151899125 CACTGCTGGAATATAAAGAAAGG - Intergenic
985192739 4:187394184-187394206 CCCTGCTATAATCTAACTATGGG + Intergenic
988104558 5:26727391-26727413 CATTGTTAGAATAAAACCAAGGG - Intergenic
991257377 5:64629930-64629952 CCCTCCAAGAATATTAACAATGG - Intergenic
992430478 5:76705965-76705987 CACTGCCAGCATATAAACAAAGG - Intronic
992721065 5:79561745-79561767 CACTACTAGAATAGCACCAAGGG + Intergenic
992895626 5:81242717-81242739 CCCTGCTGGCTTATAAGCAAGGG + Intronic
999950641 5:156646145-156646167 CCCAGCAAGAACATAATCAAAGG + Intronic
1005273284 6:24189224-24189246 CCCTGCTAGGATGTAGCCAGAGG - Intronic
1014814648 6:125922118-125922140 CTCTTCAAGAATATTACCAAAGG - Intronic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1016775330 6:147898560-147898582 TCCTGTTAGAATATAGCTAATGG + Intergenic
1019870257 7:3754475-3754497 CCTTGATAGAATATCTCCAAAGG - Intronic
1024014659 7:45301570-45301592 CACTTCTAGTATATATCCAAAGG + Intergenic
1028790089 7:94843990-94844012 CTTTGCTAAAACATAACCAAGGG - Intergenic
1029905721 7:104091531-104091553 CCCTCCTAGAATAAAACAAAGGG - Intergenic
1030279507 7:107757797-107757819 CCCAGCAAGAAAAAAACCAACGG - Intronic
1032766658 7:135000399-135000421 GCCTGCTTGAATAGAACAAAAGG + Intronic
1034828699 7:154290394-154290416 CTCTGCAAAAATAAAACCAAAGG - Intronic
1035415682 7:158683564-158683586 CCTTGCTATAAGAAAACCAAAGG - Intronic
1038119949 8:24601979-24602001 CCCTCCTAGAAAATCACTAAGGG + Intergenic
1039784205 8:40818246-40818268 CCCTGCTGGAATAAAACAAAAGG + Intronic
1043170251 8:76957223-76957245 TCCTGATAGAATAAACCCAATGG + Intergenic
1046698948 8:117377950-117377972 CTATGTTAGAATATACCCAAAGG + Intergenic
1046941047 8:119931804-119931826 ACCTGCTAGAATTTTACAAAAGG - Intronic
1046998330 8:120548585-120548607 CCCTACTAAAATGTAACCTAAGG - Intronic
1051350905 9:16197152-16197174 GGCTGCTAGAACATGACCAAAGG + Intergenic
1061875896 9:133543840-133543862 CCCAGCTAGAAAGAAACCAAGGG - Intronic
1199816326 X:151400553-151400575 CTCTTCTGGAATATAAGCAAAGG - Intronic
1201624518 Y:15999681-15999703 CCCTGCAAGAACATAGCAAAAGG - Intergenic