ID: 1126419553

View in Genome Browser
Species Human (GRCh38)
Location 15:48457066-48457088
Sequence TAGAATAGAGGGATGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126419547_1126419553 7 Left 1126419547 15:48457036-48457058 CCTCTGGGCACTGTGGATGCACC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG 0: 1
1: 0
2: 2
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126419553 Original CRISPR TAGAATAGAGGGATGGTCAA GGG Intronic
901297339 1:8170560-8170582 CAGCATAAAGTGATGGTCAAGGG + Intergenic
904031123 1:27533922-27533944 TAGAATATAGGGAGAGTCAGAGG + Intergenic
904696150 1:32332669-32332691 AAGAGTACAGGGATGGCCAAGGG - Intronic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
906762970 1:48395276-48395298 TGAAAGAGATGGATGGTCAAGGG - Exonic
908969756 1:69813421-69813443 CAGAACAGAGGGAGAGTCAATGG - Intronic
911832346 1:102568227-102568249 AAGATTAGAGGTATGGTCTATGG + Intergenic
915200132 1:154221075-154221097 GAGAAAAGAGGGAGGGTAAAAGG - Intronic
916404017 1:164479356-164479378 TAGAATAGAGTGATAGGCAGAGG - Intergenic
917156184 1:172001531-172001553 TACAATAGAGGGCTGTTCAAAGG + Intronic
917640978 1:176982915-176982937 AGGAATAGAGGGATGGAAAAGGG + Intronic
920730479 1:208479009-208479031 TAGATGAGAGGGAGGGGCAAAGG + Intergenic
921736827 1:218638028-218638050 TAGAATAGAAGGCTTGTTAATGG + Intergenic
922751026 1:228070117-228070139 TAGAATAGGGGGATAGTGTAGGG + Intergenic
922751272 1:228071161-228071183 TAGTGTAGAGGGATGGTGTAGGG + Intergenic
922894434 1:229089309-229089331 TAGCATTGAGGAATGGTTAAAGG + Intergenic
1063281788 10:4637729-4637751 TAGGATAGTGGGCTGGTCCAGGG - Intergenic
1065867673 10:29927957-29927979 TAGAAAAGAGGGATGATCAGGGG + Intergenic
1067671822 10:48330964-48330986 TAGAATGGATGGATTGTCATTGG + Intronic
1067956819 10:50800702-50800724 GAGAATAGAGGGAGGGAAAAAGG + Exonic
1070547102 10:77461255-77461277 AAGAAAAGAGGGAGGGTCCAGGG - Intronic
1071885749 10:89948994-89949016 TAGAGTAGAAGGATGGTTACAGG + Intergenic
1072977604 10:100072834-100072856 TAGAATAGAGATATGTTAAAAGG + Intronic
1074711698 10:116183389-116183411 TATAATAGAGGGAAGCTCATGGG - Intronic
1079048599 11:17132214-17132236 TAGAAAAGAGGTTTGGTAAAGGG + Intronic
1079251278 11:18790054-18790076 AAGCATAGACGGATGGTGAAGGG - Intronic
1079521243 11:21328897-21328919 TATAATAGAGGTATGGGCATTGG - Intronic
1080300791 11:30782967-30782989 GAGAACAGAGGGATGAACAAAGG + Intergenic
1080314576 11:30935077-30935099 TAGAACAGCTGGATTGTCAATGG + Intronic
1083122040 11:60522362-60522384 TCGAAAAGAGGAATGGCCAAGGG + Intronic
1084740063 11:71133624-71133646 TAGAGTGGAGGGGTGGTCTAGGG + Intronic
1085550790 11:77369332-77369354 GACAATAGAGGGTTGGTCAGGGG - Intronic
1086177202 11:83905381-83905403 AAGACTAGAGGGAAGGTCAAAGG - Intronic
1088206632 11:107399358-107399380 TAAAATAAAGGGATGGAAAAAGG + Intronic
1089004247 11:115077691-115077713 GAGAATTGTGGGAAGGTCAAGGG - Intergenic
1095383335 12:41620430-41620452 TAGAAAACAGGGAAGGTGAAAGG + Intergenic
1098958532 12:76713502-76713524 TACAATAGAGGGTTAGCCAATGG - Intergenic
1102785952 12:115604959-115604981 AAGAATAGATGGATGGACAATGG + Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1108935111 13:55873194-55873216 TAGAATGGCTGGATTGTCAATGG + Intergenic
1110251538 13:73385843-73385865 TAGTATTGTGGGATGGGCAAGGG + Intergenic
1111744373 13:92248180-92248202 TAAAATAGAGGTATGGCCATAGG + Intronic
1115469220 14:33750843-33750865 TATAATAGAGGTATGTTCCAAGG + Intronic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG + Intronic
1127062120 15:55197293-55197315 GAGAATCGAGGGCTGGTCTAGGG - Intergenic
1127545318 15:59989019-59989041 TAAAATAGAGGTATGGACAAAGG + Intergenic
1128231462 15:66038388-66038410 TAAAATCGAGGGATGGTTAAGGG + Intronic
1131352561 15:91714783-91714805 AAGAATAAAGGGATGATCTACGG + Intergenic
1135049688 16:19182698-19182720 TAGAAGAGAGGGATGTGCAAAGG + Intronic
1140854157 16:78963125-78963147 TAGACAAGAGGAATGGTAAATGG - Intronic
1140974556 16:80046413-80046435 TAGAATAGGGTAATGGACAAAGG + Intergenic
1141212883 16:81997331-81997353 CAGAAGAGGGAGATGGTCAAAGG - Exonic
1145978730 17:28999073-28999095 TTGAATAGAGGGTTGCTGAATGG + Intronic
1146336442 17:31975966-31975988 AAGAAAAGAGGGATGGGCAGGGG - Intronic
1146450738 17:32972019-32972041 TAGAACAGCTGGATTGTCAATGG - Intronic
1150903744 17:69314736-69314758 TTGAATTGAGGAATGGGCAAGGG + Intronic
1150919543 17:69468739-69468761 CAGAAAAGAGGGATGATGAAGGG - Intronic
1151027871 17:70700292-70700314 TAACATAGAGGGATGGACACTGG - Intergenic
1151078113 17:71297550-71297572 AAGAACAAAGGGAGGGTCAAGGG - Intergenic
1152987432 18:333573-333595 TAGAATAGCGGTTGGGTCAAAGG + Intronic
1155832427 18:30534479-30534501 TAGACTTGATGGATGGACAATGG + Intergenic
1158753828 18:60298752-60298774 AAGAATAGAGAGATGGGAAAAGG + Intergenic
1158779303 18:60627415-60627437 AAAGATAGATGGATGGTCAATGG + Intergenic
1161329110 19:3678034-3678056 GAGAATGGAGGGATGGAGAATGG + Intronic
1163902695 19:20119439-20119461 AAGAGTAGAGGGGTGGTCAAAGG - Exonic
1164738971 19:30562813-30562835 TGGAAAAGTGGGATGGTCACAGG - Intronic
1164949658 19:32326519-32326541 TAGAACAGAGAAATGGTCAAGGG - Intergenic
1165566975 19:36738843-36738865 CAGAGTAGAAGGATGGTTAATGG + Intronic
1166277464 19:41764035-41764057 CATAATAGAGGGATACTCAATGG - Intronic
1166342153 19:42144609-42144631 TAGAATAGTGGGATGGTCTAGGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925809726 2:7687243-7687265 TAGAGTAGAGGGCTGGGTAAAGG + Intergenic
926360898 2:12085662-12085684 TAGATTAGAAGGATGAGCAAAGG + Intergenic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
929369681 2:41207544-41207566 TAGAAGAGAGGCATGGGGAATGG + Intergenic
930944395 2:57055204-57055226 GAGAATAGGAGGATGGTCACAGG - Intergenic
932568158 2:72922398-72922420 TGGAATAGACAGATGGTCAGGGG - Intronic
933255211 2:80072777-80072799 AAGAAAATAGGGAGGGTCAAGGG + Intronic
933290100 2:80428422-80428444 TAGAAGAGAGGCAAGGTCAGTGG + Intronic
933382945 2:81573060-81573082 AAGAATAGAGGGATTGGAAAGGG - Intergenic
935138638 2:100331558-100331580 TGGAAGAGAGGGATGTTCAGTGG + Intergenic
935900418 2:107786326-107786348 TAGAATATAATGATGCTCAAAGG - Intergenic
935976106 2:108580540-108580562 TAGGAAAGAGGGATGTTCAGAGG + Intronic
936263580 2:110982338-110982360 GAGAAGAGAGGGAAGGGCAAAGG - Intronic
936596313 2:113851562-113851584 TAGAGTTGAGAGATGGTCAAAGG - Intergenic
936938014 2:117856955-117856977 TAGGATAGAGGGGTGGGAAATGG + Intergenic
937822036 2:126321317-126321339 TAAAATAGAAGGTTGCTCAATGG + Intergenic
940272700 2:151909054-151909076 TAGGATTCAGGGATAGTCAATGG - Intronic
941169401 2:162118642-162118664 TAGAAGAGAGACATGGTAAAGGG - Intergenic
941248192 2:163127068-163127090 TAGAATATAGCCATGATCAAAGG + Intergenic
941867690 2:170351609-170351631 TAGAATAGGAGGGTGGGCAAAGG + Intronic
942283271 2:174389108-174389130 TAGAATGGAGGGCTGCTAAAAGG + Intronic
943153789 2:184148112-184148134 TAAAATAGAAGGATGGTCCATGG - Intergenic
945363215 2:208917443-208917465 TATAATAGAAGGATAGTCATTGG + Intergenic
1169112680 20:3044017-3044039 GAGGATAGATGGATGGTCAGGGG - Intronic
1169515122 20:6308587-6308609 TGGAATAGGGAGTTGGTCAAAGG - Intergenic
1169541960 20:6609400-6609422 GAGACTAGAAGGATGGTCACCGG + Intergenic
1169572552 20:6922433-6922455 TAGAATTGAGAGATGGTGAGGGG + Intergenic
1173203592 20:40972802-40972824 CAGAGTAGAAGGATGGTTAATGG - Intergenic
1173612240 20:44378181-44378203 TACAATAGATAAATGGTCAAAGG - Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1178744454 21:35235146-35235168 AAGAACAGAGAGATGGGCAAAGG + Intronic
1181289662 22:21782093-21782115 CACAATTGAGGGATGGTGAAGGG + Intronic
1182038711 22:27219661-27219683 CAGCATAGAGAGATGCTCAAAGG - Intergenic
1183298420 22:37045819-37045841 TAGAACAGAGATATGGTTAAGGG - Intergenic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1203304328 22_KI270736v1_random:98683-98705 TAGAGTAGAGTGAAGTTCAATGG + Intergenic
949871169 3:8590348-8590370 TCGAATACAGGGATGGCCACAGG - Intergenic
952180859 3:30915008-30915030 TAGAATAGAATGATGGTTATCGG + Intergenic
955044351 3:55345917-55345939 TGGAATTAAGGGCTGGTCAAAGG + Intergenic
956685384 3:71822520-71822542 TAGGCTATAGGGATGGTCAAGGG - Intergenic
957692579 3:83591234-83591256 TAGATTAGTGGGATGGACAAAGG - Intergenic
959994905 3:112669867-112669889 AAAAAGAGAAGGATGGTCAATGG - Intergenic
960229390 3:115207662-115207684 AAGAAAAGAGTGATGATCAATGG + Intergenic
960973459 3:123155265-123155287 TGGAGGAGAGGGATGGTTAAAGG + Intronic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
961975418 3:131019349-131019371 TAGATTAGAGGTATATTCAAGGG + Intronic
963766004 3:149336511-149336533 ATGAAGAGAGGGATGGGCAAAGG + Intergenic
964942591 3:162177505-162177527 CAGATGAGAAGGATGGTCAAGGG + Intergenic
966223454 3:177573071-177573093 TAGAATGGAGGCATTGTCTAGGG - Intergenic
967630640 3:191740215-191740237 TAGAACAGCTGGATTGTCAATGG + Intergenic
967656980 3:192062121-192062143 TGGACTATAGGGATGGTCTAGGG + Intergenic
968364820 3:198176050-198176072 TAGAAAAGATAGATGGTAAATGG + Intergenic
969996579 4:11318661-11318683 TAGAAGATAGGGATGGGGAATGG + Intergenic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
970386910 4:15565439-15565461 TAGACTAGAGGGATGGTCAGAGG - Intronic
970507464 4:16745912-16745934 CTGAATAGTGGGATGGTAAAGGG + Intronic
974447848 4:62009869-62009891 TAAATTTGAGGGATGGTCATGGG - Intronic
976775593 4:88702753-88702775 TAGCACAGTGGCATGGTCAAGGG + Intronic
980388495 4:132117298-132117320 TAGATACAAGGGATGGTCAAAGG - Intergenic
982110389 4:152047972-152047994 TAGAATAAATGGATTGTCACAGG + Intergenic
983274027 4:165596004-165596026 TAGAATAGTGGGAAAGGCAATGG + Intergenic
984087515 4:175330961-175330983 TAGAATAGAACCATGGTGAAAGG + Intergenic
984263468 4:177469612-177469634 TTCAAAAGAGAGATGGTCAAAGG + Intergenic
985194587 4:187414929-187414951 CAGAATAGTGAGATTGTCAAGGG + Intergenic
988607746 5:32694823-32694845 GAGAACATAGGGATGGTTAATGG - Intronic
989126853 5:38062747-38062769 TAGAAGAGAGAGATGTTAAAAGG - Intergenic
993144143 5:84072839-84072861 AAGAATGGAGGGATGGTGGAGGG + Intronic
993710726 5:91222006-91222028 GAGGATATAGGGAAGGTCAAGGG + Intergenic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
996332681 5:122348360-122348382 TTGAATAGTGGGATGGTAAAAGG + Intronic
1002784059 6:388126-388148 AAGAATAAAGTGAAGGTCAATGG + Intergenic
1003313265 6:4987455-4987477 TAGAGCAGGGGGATGGCCAATGG + Intergenic
1005313247 6:24579656-24579678 TAGAATAGACGAAAGGTGAAGGG + Intronic
1005607855 6:27493342-27493364 TAGAAGAGAGGGATGGAGGAAGG - Intergenic
1007883905 6:45203831-45203853 TTCATAAGAGGGATGGTCAAGGG - Intronic
1008274786 6:49530199-49530221 AAAAATGGAGGGATGGTCAATGG + Intergenic
1008841247 6:55907381-55907403 TATGATAAAGGGATGGTTAATGG - Intergenic
1010412331 6:75574663-75574685 TAGAATATAGACATGGGCAAAGG + Intergenic
1011057744 6:83224180-83224202 GAGAATAGAGTGATGGTCTTAGG - Intronic
1011328878 6:86182031-86182053 TAAAGTAGAGGGATGGAAAAAGG - Intergenic
1013024273 6:106254258-106254280 TAAAATAGAGTGATGGTATAGGG - Intronic
1014126859 6:117786203-117786225 TAGAACACTGGGATGGTTAAAGG + Intergenic
1014276724 6:119397204-119397226 TAGAGTTGAGAGTTGGTCAAAGG + Intergenic
1014367891 6:120567156-120567178 TAGAATAAAGCAATGTTCAAGGG + Intergenic
1015522382 6:134144749-134144771 TAGATTAGAGATATGATCAAAGG + Intergenic
1016066444 6:139688057-139688079 TGGATTAGACGGATGGTCAGTGG + Intergenic
1017082951 6:150685990-150686012 TAGCATACAGAGATGGCCAAGGG + Intronic
1019144650 6:169968985-169969007 TAGAAGGGAGGGCTGGGCAAAGG - Intergenic
1020999097 7:15305164-15305186 GAGAATAGCAGGATGGTAAAAGG - Intronic
1022900679 7:34807588-34807610 GGAAATAGAGGGATGGCCAAAGG - Intronic
1024745164 7:52398102-52398124 TAAAATAAAGGGATGGAAAAAGG - Intergenic
1028782036 7:94748415-94748437 CAGAGTAAAGGGATGGTGAAAGG + Intergenic
1031853201 7:126890745-126890767 TAGAATAGAGACATGGCCAGAGG + Intronic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1033266521 7:139891900-139891922 TAAAATAGAGGGTTGGATAAGGG + Intronic
1033821194 7:145135916-145135938 GAGAATAGAAGGATGGTTACCGG - Intergenic
1037636895 8:20708164-20708186 TAAAATAGAAGGATGGCAAAGGG + Intergenic
1038338341 8:26663147-26663169 TAGCAAAGTGGGATGGTCTAAGG - Intergenic
1040072885 8:43202454-43202476 TAGAGCAGAGGAATGGTCAGGGG + Exonic
1043463039 8:80479613-80479635 TAGAATAAATGGAAGGTCAAGGG + Intergenic
1043524822 8:81084823-81084845 TATAATAAAGGGTTGGTTAAAGG - Intronic
1043651686 8:82602191-82602213 TAGAAAAGAGGAATGTTCTAAGG + Intergenic
1044928118 8:97226344-97226366 TAGAAGAGAGGGAAGGAAAAGGG + Intergenic
1045713346 8:105012061-105012083 TAGAATAGAGAGGTGGAAAATGG - Intronic
1047798967 8:128289067-128289089 GAGAGGAGAGGGATGGTAAAAGG - Intergenic
1048538492 8:135320290-135320312 TAGCATAGAGGGAAGGGCAGAGG - Intergenic
1050024229 9:1317166-1317188 TAGAATAGAGAGATCATAAATGG + Intergenic
1051182889 9:14429598-14429620 GAGAATTGAGGGATGATGAAGGG - Intergenic
1051989969 9:23140870-23140892 AAGAAGAGAGTGATTGTCAAAGG - Intergenic
1057479690 9:95434790-95434812 GAGAAGAGAGGGAAAGTCAAGGG - Intergenic
1057920665 9:99094038-99094060 CAGAATAGAGGGAAGGGCCAAGG - Intergenic
1059615930 9:115950487-115950509 TGGACTAGAGTGATGGACAAAGG - Intergenic
1060018137 9:120104903-120104925 TAGACGAGAGGGAGGGTGAATGG + Intergenic
1060308702 9:122439782-122439804 TAGGACAGAGGGATGGTAGATGG + Intergenic
1060822172 9:126667767-126667789 CAGAAGAAAGGGATGGCCAAAGG + Intronic
1061743406 9:132723316-132723338 GAGAATAGAGGAATGTTTAATGG + Intergenic
1185622382 X:1460137-1460159 TAGAATAGATAGATGATAAATGG - Intergenic
1188661043 X:32758955-32758977 TAGAGAAGAGGGATGGGCATAGG - Intronic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1189451288 X:41133608-41133630 AAGAATAGCGGGATGGTTAATGG - Intronic
1192994933 X:76503605-76503627 TAGAGTAGAGGGGTGGAAAAAGG - Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1195380289 X:104264223-104264245 TAGAATTTAGGGATGGGAAAGGG + Intergenic
1196469053 X:116004892-116004914 TAGCTTAGATGGATGGTCTAGGG + Intergenic
1197306724 X:124851536-124851558 TAGAATAGTGAGATGGACATTGG - Intronic
1198039758 X:132838441-132838463 TGGATTAAAGGGATGGTCTAAGG + Intronic
1200305467 X:155022117-155022139 TGGAGTAGAGGGAGGGTGAAGGG - Intronic
1200493063 Y:3851826-3851848 TAGAAGAGAGAGATTGCCAAGGG + Intergenic
1201117780 Y:10847781-10847803 TAGAATGGAGGGAAGGAGAATGG - Intergenic
1201144806 Y:11058311-11058333 TAGAGTGGAGGGGTGGTCTATGG + Intergenic