ID: 1126419658

View in Genome Browser
Species Human (GRCh38)
Location 15:48457916-48457938
Sequence CCTTATATGATAAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126419658_1126419664 -7 Left 1126419658 15:48457916-48457938 CCTGCCTCCCTTATCATATAAGG 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1126419664 15:48457932-48457954 TATAAGGGAAGATCGTATTATGG 0: 1
1: 0
2: 1
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126419658 Original CRISPR CCTTATATGATAAGGGAGGC AGG (reversed) Intronic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900909325 1:5583778-5583800 CCATGTATAAAAAGGGAGGCCGG + Intergenic
907485182 1:54773009-54773031 GCTCATATGATTATGGAGGCTGG + Intergenic
910999755 1:93150716-93150738 GCTAATATGAAATGGGAGGCTGG - Exonic
911703396 1:100982558-100982580 CGTTTTATGATAAGGGATTCAGG - Intergenic
911744041 1:101419492-101419514 CCTTAAAAAAAAAGGGAGGCAGG + Intergenic
911892529 1:103390331-103390353 CCTTATACGATTATAGAGGCTGG - Intergenic
913516070 1:119606619-119606641 CTTTAAATGATATGGGAGGGGGG - Intergenic
918182006 1:182092183-182092205 CCATTTATGATGGGGGAGGCTGG - Intergenic
921937419 1:220807982-220808004 CCCTATAAAATAAAGGAGGCAGG + Intronic
922131697 1:222786727-222786749 CTTCATTTGTTAAGGGAGGCTGG - Intergenic
922863059 1:228835942-228835964 GCTTAGAGGATAAGAGAGGCTGG - Intergenic
923973278 1:239229401-239229423 GCTTATGTGATTATGGAGGCTGG - Intergenic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
1068107638 10:52638902-52638924 ACTTATTTGATAAGGAAGGATGG - Intergenic
1069612261 10:69782269-69782291 TCTTATGAGATAAGGGAGGGTGG - Intergenic
1071115507 10:82214407-82214429 CCTGATATGGTGAGGAAGGCAGG + Intronic
1073566122 10:104536971-104536993 CCTTTTCTGATAAATGAGGCTGG + Intergenic
1077966823 11:7143125-7143147 GCTTATATGTTTATGGAGGCTGG - Intergenic
1079524691 11:21371246-21371268 CAGTAGATGATAAGTGAGGCAGG - Intronic
1079609847 11:22418571-22418593 GCTTAGATGATTATGGAGGCTGG + Intergenic
1080247724 11:30198414-30198436 CATCATATGATGATGGAGGCAGG - Intergenic
1081620148 11:44614635-44614657 CCTTGTGGGATAAGGGAGGCCGG + Intronic
1081675332 11:44965274-44965296 CCTGGTATGAGGAGGGAGGCTGG + Intergenic
1084785613 11:71440194-71440216 CCTGAGAGGGTAAGGGAGGCCGG + Intronic
1084923050 11:72487397-72487419 CCTTATGTGTCAATGGAGGCTGG + Intergenic
1087117573 11:94541975-94541997 CCTTATTTGATGTGGGAGGAGGG - Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1087574562 11:99974402-99974424 ACTGATATCCTAAGGGAGGCAGG - Intronic
1088438730 11:109844238-109844260 GATTATATGATTATGGAGGCTGG - Intergenic
1088456426 11:110037145-110037167 GCTAATATGATTATGGAGGCTGG - Intergenic
1088796820 11:113272244-113272266 CCTGAAAGGATAAGGGAAGCTGG + Intronic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1090975106 11:131673333-131673355 CCTTAGAGGACAAAGGAGGCTGG + Intronic
1092776877 12:11951470-11951492 CCTTATATGTTTGGGGAGCCAGG - Intergenic
1093275822 12:17124212-17124234 CCTTATTTGATAAATGATGCCGG - Intergenic
1094244369 12:28271162-28271184 CCTATGATGTTAAGGGAGGCAGG + Intronic
1095060739 12:37685235-37685257 CCTTATAAAATGAGTGAGGCAGG - Intergenic
1095978353 12:47955173-47955195 AAGTATATGCTAAGGGAGGCTGG - Intergenic
1098958606 12:76714407-76714429 CCTGACATGATTATGGAGGCTGG + Intergenic
1100774342 12:97957957-97957979 CATTATATGGTAAGGGTGACAGG - Intergenic
1101489412 12:105197558-105197580 CCATATGGGATAAGGCAGGCTGG + Intronic
1103125590 12:118419544-118419566 CCATAGATGATAAGGCAGGGAGG - Intergenic
1103731998 12:123033832-123033854 CCTTAGAAGATAAGGAAGGGTGG + Intronic
1103884750 12:124192039-124192061 CCCTGTATGAGAAGGGAGGCTGG - Intronic
1105618209 13:22040781-22040803 CTTTAAATGATATGGGAGGGGGG + Intergenic
1106084884 13:26532509-26532531 ATTCATGTGATAAGGGAGGCTGG - Intergenic
1106760466 13:32862586-32862608 CCTGATAAGAAAAGGGAGGCTGG + Intergenic
1107003380 13:35577883-35577905 CCTTAGATAAAAAGGGAGCCCGG + Intronic
1107146258 13:37063533-37063555 TCTCATATGATAAAGGAAGCGGG + Intergenic
1109138588 13:58683716-58683738 CTTTAAATGATAAGGAAGGAGGG - Intergenic
1109502706 13:63258185-63258207 CCTAATTTGATAAATGAGGCAGG + Intergenic
1110733619 13:78909496-78909518 CCATATCTGTTAAGGGAGGATGG - Intergenic
1113084312 13:106551968-106551990 CCATATATGACAAGGAGGGCGGG - Intronic
1113802045 13:113091736-113091758 CCTGAGAATATAAGGGAGGCAGG - Intronic
1115468229 14:33739350-33739372 CTTTATATCATAAAGGAGGCTGG - Intronic
1115497141 14:34017105-34017127 CATTAAATGAAAAGGGAGCCAGG + Intronic
1118286025 14:64474029-64474051 CACTATTTGATAAGGGAGACAGG + Exonic
1120755487 14:88240127-88240149 CCTTCTGTGATGAGGCAGGCAGG + Intronic
1121144603 14:91573594-91573616 TCTTAGATGAAAAGGGAGGAGGG + Intergenic
1121227101 14:92328958-92328980 CTTTCTGTGATAAGGAAGGCTGG + Intronic
1126419658 15:48457916-48457938 CCTTATATGATAAGGGAGGCAGG - Intronic
1127868602 15:63051549-63051571 CCTTATATGGTAAGGAAAGGGGG - Intronic
1128556691 15:68636515-68636537 CCTGATAGCATGAGGGAGGCAGG + Intronic
1129287553 15:74538357-74538379 ACTTACATGATAAGGAAGTCAGG + Intergenic
1130201365 15:81830253-81830275 GCTTATGTGATTACGGAGGCTGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1138472739 16:57251068-57251090 CATTATATGAAAAGCAAGGCAGG - Intronic
1138474610 16:57263416-57263438 CATTATATGATAAGCAAGGGTGG - Intronic
1141815664 16:86407957-86407979 CCTTGTATGAAAAGTGTGGCAGG + Intergenic
1141867804 16:86762669-86762691 CCCTATTTCACAAGGGAGGCAGG + Intergenic
1143410607 17:6706287-6706309 TCTGATAGGATAAGGGAAGCAGG - Intronic
1144135525 17:12291337-12291359 GCTTATTTGGAAAGGGAGGCAGG + Intergenic
1145735187 17:27224584-27224606 TCTTATGTGATTATGGAGGCTGG + Intergenic
1155752588 18:29445905-29445927 CCTTATAAGAAAAGAGAGACTGG - Intergenic
1159126955 18:64235183-64235205 TATTATATGATGAGGGAGGAAGG + Intergenic
1161575440 19:5052103-5052125 CCTTAAAGGTCAAGGGAGGCTGG - Intronic
1164476525 19:28579786-28579808 CCCTCTAAGATATGGGAGGCTGG + Intergenic
1165240598 19:34463761-34463783 CCTTATAGGAGGAGGAAGGCAGG - Intronic
1166562884 19:43744973-43744995 TCATATATGATAAGGCAGGTGGG - Intronic
929689433 2:44062168-44062190 CCTTTTTTCATAAGGGAGGGGGG - Intergenic
935823573 2:106918370-106918392 CCTTACATGATTATGAAGGCAGG - Intergenic
936348729 2:111696380-111696402 CCTCACATGATTATGGAGGCTGG + Intergenic
936666154 2:114598112-114598134 CATAATATGAAAAGGGTGGCAGG + Intronic
937749170 2:125453831-125453853 CCTTATATTCTAAGGGAGAGAGG - Intergenic
941342599 2:164326909-164326931 CCTTATAAGATGAAAGAGGCAGG - Intergenic
942746040 2:179234281-179234303 GCTTACATGATCATGGAGGCTGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945199664 2:207268428-207268450 GCTTATATGATAGTGGGGGCAGG - Intergenic
947450542 2:230204316-230204338 CGTTATAGGATTAGGGAGACAGG - Intronic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1173489899 20:43471407-43471429 CTCTAGATTATAAGGGAGGCTGG - Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1175206880 20:57317902-57317924 GCTTTTATGCTGAGGGAGGCGGG - Intergenic
1176342663 21:5713219-5713241 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176474917 21:7145370-7145392 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176502164 21:7611237-7611259 CCTTATAAAAGAAGGGAGGAGGG - Intergenic
1176536984 21:8111288-8111310 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1179450378 21:41464492-41464514 CCTTATAAGGAAATGGAGGCTGG + Intergenic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1183930231 22:41231831-41231853 CCATAAAGGACAAGGGAGGCAGG - Intronic
1183965307 22:41438187-41438209 CCTTAAATGAAAAGGGATACAGG + Intronic
1184696621 22:46142992-46143014 CCTGGTGTGATGAGGGAGGCAGG + Intergenic
1203241935 22_KI270733v1_random:27692-27714 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
950626684 3:14252695-14252717 CCTTATAGGATATGGAAGTCAGG - Intergenic
952103285 3:30039668-30039690 CCTTATTTGATAAATGATGCTGG - Intergenic
955296563 3:57740642-57740664 AGATATATAATAAGGGAGGCAGG - Intergenic
957280689 3:78147171-78147193 AATTATATGAGAAGGGGGGCCGG - Intergenic
958266701 3:91446260-91446282 CCAGACATGAAAAGGGAGGCTGG - Intergenic
958667314 3:97158196-97158218 CTTTACATGATAAGGGAGTAGGG + Intronic
959017732 3:101154792-101154814 GCTCATATGATTATGGAGGCTGG + Intergenic
961813700 3:129536636-129536658 CCTGAGATGATGAGGGAGGGAGG - Intergenic
967257124 3:187604813-187604835 ACTTCAATCATAAGGGAGGCTGG - Intergenic
968825236 4:2891150-2891172 CTTTTTAAGATAAAGGAGGCTGG + Intronic
969686817 4:8680104-8680126 CCTTATGGGACAAGGTAGGCAGG + Intergenic
969688747 4:8691740-8691762 CCTTATATTTAAAGTGAGGCAGG + Intergenic
969761356 4:9185779-9185801 TCTTATATCATTAGGGATGCAGG - Intergenic
970287503 4:14534465-14534487 ACTCATATGATTATGGAGGCTGG + Intergenic
971228080 4:24773355-24773377 GCTTACATGATTATGGAGGCTGG - Intergenic
976836119 4:89376048-89376070 CCTTTTATGTTAGGGGAGGGGGG + Intergenic
977586588 4:98781269-98781291 GCTCACATGATAATGGAGGCTGG - Intergenic
978349949 4:107811196-107811218 CCTCATATGCCAAGGCAGGCTGG - Intergenic
980572668 4:134641251-134641273 GCTTATATGATTATGGAGTCTGG + Intergenic
981128545 4:141133129-141133151 CCTTCTCTCATAAGGGTGGCCGG + Intronic
982217654 4:153095984-153096006 CCTTCTATTATGAGGAAGGCTGG + Intergenic
982700544 4:158656476-158656498 TCTTATATGATTATGGAGACTGG + Intergenic
982711566 4:158763188-158763210 CTTTAAAGGATAAGAGAGGCTGG + Intergenic
982928138 4:161366076-161366098 GACCATATGATAAGGGAGGCGGG - Intergenic
983197910 4:164827949-164827971 CATTGTATCATAAGGGAGGTAGG - Intergenic
984261173 4:177444941-177444963 CTTTAAATGATAAGGAAGGGGGG + Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
986399901 5:7370558-7370580 CCCTATCTGCTAAGGGAGGAGGG - Intergenic
986520005 5:8605168-8605190 GCTTATGTGATTATGGAGGCTGG - Intergenic
988101318 5:26682722-26682744 CGATATAAGATAAGGGAGACTGG + Intergenic
988401054 5:30760873-30760895 ACTTACATGATTATGGAGGCTGG + Intergenic
988582716 5:32482159-32482181 GCTTACATGATTATGGAGGCTGG - Intergenic
992392751 5:76344323-76344345 CATTATATTATAAGGAAGTCTGG - Intronic
992697134 5:79301124-79301146 CCTTAAATAAAAAGGGAGCCAGG - Intronic
997189721 5:131919986-131920008 TCTCATATGCTAAGGGAGGTGGG + Intronic
999895422 5:156027546-156027568 CCTTAGATGACAGGGGAGGTGGG + Intronic
1000122520 5:158210767-158210789 GCTTATATGATTATGGAGGCTGG + Intergenic
1005280796 6:24271378-24271400 GCATCTATGAAAAGGGAGGCAGG + Intronic
1005513326 6:26531450-26531472 CCTCAAATGATAAGACAGGCTGG - Intergenic
1006430912 6:33995166-33995188 CCTGATATGATGTGGGAGGGAGG + Intergenic
1008775659 6:55034504-55034526 CCTGATAAGAAAAGAGAGGCCGG - Intergenic
1008988512 6:57575333-57575355 CCAGACATGAAAAGGGAGGCTGG + Intronic
1009177119 6:60473924-60473946 CCAGACATGAAAAGGGAGGCTGG + Intergenic
1011382116 6:86753221-86753243 GCTTATATGATTATGGAGGTTGG - Intergenic
1011873412 6:91925713-91925735 CCTTAAAGGACAAGGGAGGAGGG + Intergenic
1012191713 6:96287820-96287842 CCTATTTTGATAAGGGTGGCAGG - Intergenic
1013386610 6:109638084-109638106 CCTTTTATGAAAAAGGAGGCAGG + Intronic
1017006471 6:150031076-150031098 CCATAAATGATGAAGGAGGCTGG - Intergenic
1018659129 6:166068759-166068781 CCTTATTTAATAAGTGAGGGAGG - Intergenic
1022029102 7:26476119-26476141 GCTTATGTGATTATGGAGGCTGG + Intergenic
1022220491 7:28309173-28309195 TCTCACATGATAATGGAGGCTGG - Intronic
1026290215 7:68999316-68999338 CCTCATATGGTAAAAGAGGCAGG + Intergenic
1030604361 7:111623433-111623455 ACTTATTTGATGAGGGAAGCAGG - Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1032846553 7:135756430-135756452 CCTTATTTGCTAAAGAAGGCAGG + Intergenic
1036602262 8:10272277-10272299 GCTCATATGATTATGGAGGCTGG + Intronic
1036845166 8:12163263-12163285 TCTTATATCATTAGGGATGCAGG + Intergenic
1036866535 8:12405586-12405608 TCTTATATCATTAGGGATGCAGG + Intergenic
1037537082 8:19834889-19834911 CCTTCTATGATCCGGGAAGCAGG - Intronic
1039823112 8:41151317-41151339 GCTTACATGATTATGGAGGCTGG - Intergenic
1041889035 8:62847912-62847934 CCCTATATGATAAATGATGCTGG - Intronic
1044691417 8:94883417-94883439 TCTTAAAAGATAAGGGAGCCAGG + Intronic
1046282832 8:112056193-112056215 CCTCATAGAATAAGGGAGGGAGG + Intergenic
1047184705 8:122622207-122622229 GCTCACATGATTAGGGAGGCTGG - Intergenic
1050961396 9:11737991-11738013 GCTCATATGATAATGGAGGCTGG + Intergenic
1051522678 9:18007560-18007582 CCTTATTTGTAAAGCGAGGCAGG + Intergenic
1056444106 9:86648037-86648059 CCTTAGATGATAGGGCAGTCGGG + Intergenic
1057028309 9:91754046-91754068 ACCTTTATGACAAGGGAGGCAGG + Intronic
1061130676 9:128706169-128706191 CCTGATATGATGACGGAGGCAGG + Intronic
1203458252 Un_GL000220v1:10769-10791 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1188279728 X:28250551-28250573 CACTATATGATAAGTGATGCGGG - Intergenic
1197905671 X:131422742-131422764 CCTTCTATGATAAAAGAGGTTGG - Intergenic
1198270926 X:135055554-135055576 CTTTAAATGATATGGGAGGGGGG + Intergenic