ID: 1126422519

View in Genome Browser
Species Human (GRCh38)
Location 15:48489917-48489939
Sequence GAGAAATACTCCTGAGTACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126422519_1126422525 23 Left 1126422519 15:48489917-48489939 CCTCGTACTCAGGAGTATTTCTC 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83
1126422519_1126422523 11 Left 1126422519 15:48489917-48489939 CCTCGTACTCAGGAGTATTTCTC 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1126422523 15:48489951-48489973 CTCGCATTCCTCAGTACCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126422519 Original CRISPR GAGAAATACTCCTGAGTACG AGG (reversed) Exonic