ID: 1126422519 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:48489917-48489939 |
| Sequence | GAGAAATACTCCTGAGTACG AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 79 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 3, 4: 74} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1126422519_1126422523 | 11 | Left | 1126422519 | 15:48489917-48489939 | CCTCGTACTCAGGAGTATTTCTC | 0: 1 1: 0 2: 1 3: 3 4: 74 |
||
| Right | 1126422523 | 15:48489951-48489973 | CTCGCATTCCTCAGTACCCCAGG | 0: 1 1: 0 2: 0 3: 9 4: 87 |
||||
| 1126422519_1126422525 | 23 | Left | 1126422519 | 15:48489917-48489939 | CCTCGTACTCAGGAGTATTTCTC | 0: 1 1: 0 2: 1 3: 3 4: 74 |
||
| Right | 1126422525 | 15:48489963-48489985 | AGTACCCCAGGCTGCCCCGACGG | 0: 1 1: 0 2: 1 3: 11 4: 83 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1126422519 | Original CRISPR | GAGAAATACTCCTGAGTACG AGG (reversed) | Exonic | ||