ID: 1126422522

View in Genome Browser
Species Human (GRCh38)
Location 15:48489950-48489972
Sequence CTGGGGTACTGAGGAATGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126422522_1126422535 19 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422535 15:48489992-48490014 AGCAGGCGTCCATGCGGTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1126422522_1126422533 13 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422533 15:48489986-48490008 AGCAGCAGCAGGCGTCCATGCGG 0: 1
1: 0
2: 2
3: 11
4: 205
1126422522_1126422529 2 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422529 15:48489975-48489997 TGCCCCGACGGAGCAGCAGCAGG 0: 1
1: 0
2: 3
3: 14
4: 223
1126422522_1126422537 30 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422537 15:48490003-48490025 ATGCGGTGGCGGCCAGCAATAGG 0: 1
1: 0
2: 0
3: 7
4: 114
1126422522_1126422534 16 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422534 15:48489989-48490011 AGCAGCAGGCGTCCATGCGGTGG 0: 1
1: 0
2: 1
3: 12
4: 91
1126422522_1126422525 -10 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126422522 Original CRISPR CTGGGGTACTGAGGAATGCG AGG (reversed) Exonic