ID: 1126422525

View in Genome Browser
Species Human (GRCh38)
Location 15:48489963-48489985
Sequence AGTACCCCAGGCTGCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126422519_1126422525 23 Left 1126422519 15:48489917-48489939 CCTCGTACTCAGGAGTATTTCTC 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83
1126422522_1126422525 -10 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126422525 Original CRISPR AGTACCCCAGGCTGCCCCGA CGG Exonic