ID: 1126422525

View in Genome Browser
Species Human (GRCh38)
Location 15:48489963-48489985
Sequence AGTACCCCAGGCTGCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126422522_1126422525 -10 Left 1126422522 15:48489950-48489972 CCTCGCATTCCTCAGTACCCCAG 0: 1
1: 0
2: 1
3: 18
4: 120
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83
1126422519_1126422525 23 Left 1126422519 15:48489917-48489939 CCTCGTACTCAGGAGTATTTCTC 0: 1
1: 0
2: 1
3: 3
4: 74
Right 1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG 0: 1
1: 0
2: 1
3: 11
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126422525 Original CRISPR AGTACCCCAGGCTGCCCCGA CGG Exonic
901020500 1:6252841-6252863 AGGACCCCAGGCAGCCCCTCTGG + Intronic
904991780 1:34598960-34598982 AGTTGCCCAGGCTGCCCTGAAGG + Intergenic
907485639 1:54776206-54776228 AGCACCCCAGGCTGCACAGCCGG - Intergenic
915818566 1:158996465-158996487 ATTTCCCCAGCCTGCCCTGAGGG + Intergenic
921123503 1:212157022-212157044 TGTACCCCAAGCTGCCGGGATGG + Intergenic
922649025 1:227320739-227320761 AGTGCCACAGGCTGCCTCGCAGG + Intergenic
924416293 1:243859979-243860001 TGGGCCCCAGGATGCCCCGAGGG - Intergenic
1063381999 10:5591456-5591478 AGTGCCGCAGGCTGCCCTGCTGG + Intergenic
1071547503 10:86539594-86539616 AGGACCCCTGGCTGCCGCGGAGG - Intergenic
1079772122 11:24475226-24475248 AGTAGCCCAGGCTGTACCCATGG + Intergenic
1089033334 11:115357181-115357203 AGAAGCCCAGGCTCCCCCAAAGG + Intronic
1091935166 12:4429207-4429229 AGTACCTCAGGCTGGTCCCAGGG - Intronic
1094701435 12:32874294-32874316 AGTTCCCCAGGCTGCTCCCTGGG - Intronic
1102869553 12:116402827-116402849 AGTTCCCCAGGCTGTACAGAAGG - Intergenic
1102992927 12:117327756-117327778 AGGACTCCAGGCTGTCCCCAGGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106708804 13:32310070-32310092 AGAACAGCAGGCTGCCCCTAAGG - Intronic
1106773609 13:32986783-32986805 AGTACCCCAGGATAGCCCCATGG - Intergenic
1109690282 13:65879225-65879247 TGTACCCCAAGCTGCCTAGATGG - Intergenic
1110630325 13:77698627-77698649 AGTCACCCCGGCTGCCGCGAGGG - Intronic
1113054803 13:106256733-106256755 AGGACCCCAGGCTACCCTGTAGG + Intergenic
1113913125 13:113854005-113854027 AGGACCCCAGGCTGACCTGGAGG + Intronic
1115802699 14:37013418-37013440 AGTACACCAGGATGCTCCAAGGG + Intronic
1119789001 14:77332367-77332389 TGTACCACAGGCTGCCCTGGAGG + Intergenic
1121227008 14:92328460-92328482 AGTCCCCCAGGCTACACAGAAGG - Intronic
1122116605 14:99530695-99530717 AGCACCCCAGGCGGTCCCAAGGG - Intronic
1122799530 14:104222751-104222773 AGGACCCCAGGCAGGCCTGAGGG - Intergenic
1126422525 15:48489963-48489985 AGTACCCCAGGCTGCCCCGACGG + Exonic
1126890302 15:53197679-53197701 AGTACCCAGTGCTGCCTCGATGG - Intergenic
1130253761 15:82316425-82316447 AGGACCCCAGGCAGCACTGATGG - Intergenic
1130284127 15:82541259-82541281 ACCAGCGCAGGCTGCCCCGATGG + Intronic
1132354262 15:101159561-101159583 TGTGCCCAAGGCTGCCCCGGAGG + Intergenic
1135474310 16:22760809-22760831 AGCACCCCAGGTGGCCCCCAGGG - Intergenic
1135866329 16:26105741-26105763 ATTTCCCCAGGCTTCCCCCATGG + Intronic
1136567589 16:31079510-31079532 GGTTCACCAGGCTGCCCCCATGG - Exonic
1140411151 16:74741153-74741175 TGAAACCCATGCTGCCCCGAAGG + Intronic
1142084710 16:88170933-88170955 ACTTCCCCGGGCTGCCACGAAGG + Intergenic
1142552850 17:751803-751825 AGCACCCCTGGGCGCCCCGACGG - Intronic
1144414007 17:15029261-15029283 AGTCCCCCAGGCTTCCTTGATGG + Intergenic
1148758603 17:49987710-49987732 GGAACCCCAGCCTGCCCTGAGGG - Intergenic
1152245398 17:79182591-79182613 AGATCCCCAGGATGCCCCGTGGG - Intronic
1152446803 17:80349540-80349562 ACGACCCCACCCTGCCCCGAGGG - Intronic
1159594476 18:70369864-70369886 AGTACCCCAGGCTGCACTCAAGG + Intergenic
1161155464 19:2730282-2730304 AGCTCCCCAGGGTGGCCCGAGGG - Intronic
1161290931 19:3492957-3492979 CGTACCCCCGGCTGCCCCGGAGG + Intronic
1161355882 19:3819405-3819427 AGTACCTCGGGCTGCCCCGATGG + Intronic
1162066144 19:8126490-8126512 GCTCCCCCAGGCTGCCCCGAGGG + Exonic
1162581807 19:11536030-11536052 GGTACCCGGGGCTGCCCCGTTGG + Intergenic
1162778989 19:12996753-12996775 TGTGCCCGAGGCTGACCCGACGG - Intronic
926127943 2:10283410-10283432 AGAGCCACAGGCTGCCCCAAGGG + Intergenic
932024714 2:68121343-68121365 GGTACCCCAGGCTTCTCGGAGGG + Intergenic
933749380 2:85593315-85593337 AGTACAGCAGGCTGCCCTCAAGG - Exonic
936154166 2:110037363-110037385 CCTGCCCCAGCCTGCCCCGATGG - Intergenic
936190518 2:110334052-110334074 CCTGCCCCAGCCTGCCCCGATGG + Intergenic
938378633 2:130824379-130824401 AGCACCCCACGCTGCCCAAAGGG + Intergenic
942071869 2:172323591-172323613 TGTTCCCCATGCTGCCCCCAGGG + Intergenic
947793622 2:232881105-232881127 AGTTCCCCTGGGGGCCCCGAGGG + Intronic
1171905001 20:30893464-30893486 AGTAACCCAGGCGATCCCGAGGG + Intergenic
1172446142 20:34994444-34994466 AGTACCCCTGGCTGCTCTGAGGG + Intronic
1172592681 20:36128608-36128630 ATTACCACAGGCTGCCCAGGAGG + Intronic
1175572765 20:60036694-60036716 AGCCCTCCTGGCTGCCCCGATGG + Intergenic
1176259129 20:64169986-64170008 AGTGCCCCAGGCTGCCATGGAGG + Intronic
1179953993 21:44727737-44727759 AAGACCCCAGGCTTCCCCGAAGG + Intergenic
1180338437 22:11599649-11599671 AGTAACCCAGGCGATCCCGAGGG + Intergenic
1182504368 22:30771386-30771408 AGCACCCCAGGTTGCCCCTCTGG - Intronic
1184690818 22:46116537-46116559 AGTGGCCCAGGCTGCCCAGGCGG - Intergenic
1185110462 22:48897600-48897622 AGGACCCCAGGCAGCCCTGTGGG - Intergenic
950550592 3:13663756-13663778 ATTACACCAGGCTGCCCAGGTGG - Intergenic
961543728 3:127617891-127617913 GGGACCCCAGGCTGCTCTGATGG - Intronic
968607897 4:1544132-1544154 GGGACCCCAGGCTGCGTCGAGGG - Intergenic
996825594 5:127678116-127678138 TGTCCCCCAGCCTGCACCGATGG + Intergenic
998347469 5:141477196-141477218 AGTACCCGAGGATGCCCCTCTGG + Exonic
999285411 5:150391573-150391595 ACTGACCCAGGCTGCCCTGAAGG + Exonic
1006802685 6:36769420-36769442 AAAACGCCAGGCTGCCCCCACGG + Intronic
1015591510 6:134827233-134827255 AGTAGCCCAGGCTGACCGCAGGG + Intergenic
1018426704 6:163689643-163689665 AATACCCCAGTCTGCTCTGAGGG + Intergenic
1020014230 7:4821498-4821520 AGCCCCCTAGACTGCCCCGATGG + Intronic
1027868125 7:83673552-83673574 AGTCCCCAGGCCTGCCCCGAGGG - Intergenic
1029149582 7:98470570-98470592 AGGACCCCAGGCTGGGGCGACGG - Intergenic
1029385810 7:100242819-100242841 AGGAACCCAGGCTCCCCCCAAGG + Intronic
1029550056 7:101232783-101232805 AGTCCCACCCGCTGCCCCGAGGG + Intronic
1035232239 7:157472339-157472361 AGGCTCCCAGGCTGCCCCGAGGG + Intergenic
1047088478 8:121546121-121546143 AGTATCCCAGGCTGCTCCAATGG - Intergenic
1049598734 8:143497440-143497462 TGGACCCCAGGCTGCCCCCCTGG - Intronic
1053287383 9:36858800-36858822 AGGACCCCTGGCTGCTCTGAGGG - Intronic
1053832888 9:42102834-42102856 AATACTCCAGGCTACCACGAGGG + Intronic
1054597664 9:67084576-67084598 AATACTCCAGGCTACCACGAGGG - Intergenic
1057357048 9:94340596-94340618 AGTGCCACAGGTTTCCCCGACGG + Intergenic
1057650704 9:96917031-96917053 AGTGCCACAGGTTTCCCCGACGG - Intronic
1060921724 9:127425066-127425088 CGTACCCCAGTCTGCCCAGATGG + Intronic
1061577764 9:131518250-131518272 AGCACCCCGGGCTGCTCCGAGGG - Intronic
1061630113 9:131866994-131867016 AGCCCCCCAGGCTCCCCCGATGG + Intronic
1062324025 9:136004009-136004031 AGTTCCCCAGGGAGCCCCAAGGG + Intergenic
1203772033 EBV:54343-54365 AGCAGCCGAGGCTGCCCTGACGG - Intergenic
1188906080 X:35793521-35793543 AATACCCTAGGCTGGCCCGTCGG + Intergenic
1200101046 X:153689157-153689179 AGGAGCCCTGGCTGCCCCCACGG + Intronic