ID: 1126422532

View in Genome Browser
Species Human (GRCh38)
Location 15:48489979-48490001
Sequence GACGCCTGCTGCTGCTCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126422532_1126422537 1 Left 1126422532 15:48489979-48490001 CCGACGGAGCAGCAGCAGGCGTC 0: 1
1: 0
2: 1
3: 15
4: 98
Right 1126422537 15:48490003-48490025 ATGCGGTGGCGGCCAGCAATAGG 0: 1
1: 0
2: 0
3: 7
4: 114
1126422532_1126422538 5 Left 1126422532 15:48489979-48490001 CCGACGGAGCAGCAGCAGGCGTC 0: 1
1: 0
2: 1
3: 15
4: 98
Right 1126422538 15:48490007-48490029 GGTGGCGGCCAGCAATAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 127
1126422532_1126422535 -10 Left 1126422532 15:48489979-48490001 CCGACGGAGCAGCAGCAGGCGTC 0: 1
1: 0
2: 1
3: 15
4: 98
Right 1126422535 15:48489992-48490014 AGCAGGCGTCCATGCGGTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1126422532_1126422539 6 Left 1126422532 15:48489979-48490001 CCGACGGAGCAGCAGCAGGCGTC 0: 1
1: 0
2: 1
3: 15
4: 98
Right 1126422539 15:48490008-48490030 GTGGCGGCCAGCAATAGGCAGGG 0: 1
1: 1
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126422532 Original CRISPR GACGCCTGCTGCTGCTCCGT CGG (reversed) Exonic