ID: 1126425808

View in Genome Browser
Species Human (GRCh38)
Location 15:48525910-48525932
Sequence CTGGATCATCCCTCTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126425805_1126425808 -10 Left 1126425805 15:48525897-48525919 CCTGTAAGGTCTCCTGGATCATC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG 0: 1
1: 0
2: 0
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126425808 Original CRISPR CTGGATCATCCCTCTTTTAT GGG Intronic
903094540 1:20957664-20957686 TTGGATCTTCTCTCTTTTCTTGG - Intronic
905508537 1:38500136-38500158 CTGGATTTTCCTTCTTTTACAGG + Intergenic
906269007 1:44459724-44459746 GTGGATATTCCCTCTTTCATCGG - Intronic
907826212 1:58019180-58019202 CTGAATCACCCTTCATTTATTGG - Intronic
907982101 1:59493549-59493571 CTGTATGATCCTTCTTATATGGG + Intronic
911364736 1:96923949-96923971 TTGGATCATCTCTTTTTAATTGG - Intergenic
911767325 1:101693548-101693570 TTGGGTCATCCTTCTTTTACTGG + Intergenic
912208858 1:107536628-107536650 CTGGATGATCACTCTTTTAGAGG - Intergenic
913313609 1:117530378-117530400 CTGTATTATCCTTCTTTTAGAGG - Intergenic
913532839 1:119744908-119744930 ATGGATCATCCCTTATTAATGGG - Intergenic
914483554 1:148088293-148088315 CTGGAACACCCCTCCTTTAAAGG + Intergenic
915923065 1:159992558-159992580 CTGGATAATTCCTCCTCTATGGG + Intergenic
916004031 1:160643148-160643170 CTGCCTCCTCCCTCTTTTATAGG - Intronic
916439010 1:164803902-164803924 CAGGATTATCCCTGTTTTACAGG - Intronic
917209089 1:172613491-172613513 CTGAATCATCCCAGTTTTAGTGG + Intergenic
920797656 1:209156143-209156165 TTGGATTATCTATCTTTTATTGG + Intergenic
923174420 1:231449872-231449894 CTGGATCTTCTCTCTTTTCCTGG - Intergenic
1064556957 10:16556622-16556644 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1064727794 10:18298774-18298796 ATGGATAATCCCTCATTTAAAGG + Intronic
1064844170 10:19632840-19632862 CTGGATAATCTCTTATTTATTGG - Intronic
1064846819 10:19664794-19664816 CTGTATGATCCCACTTTTAAAGG - Intronic
1072428990 10:95354708-95354730 CTCAATCATGCCTCTTTTAGTGG - Intronic
1072939939 10:99753272-99753294 CAGTATTATCCCTCTTTTATTGG + Intronic
1074445561 10:113518580-113518602 CTGCATCATCTCTTGTTTATAGG - Intergenic
1074985292 10:118652817-118652839 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1077624948 11:3762549-3762571 CTAGTTCTTCCCTCTTTTGTAGG - Intronic
1079411319 11:20190526-20190548 CTTTATGATCCCTGTTTTATAGG - Intergenic
1080486240 11:32710079-32710101 TTGGATCGTCTCTCTTTTCTTGG + Intronic
1080923767 11:36734627-36734649 TTGGATCATCTCTCTTTTCTTGG - Intergenic
1083127106 11:60581109-60581131 TTGGATCATCTCTCTTTTCTTGG - Intergenic
1088413262 11:109559975-109559997 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1090545347 11:127759751-127759773 TTGGATCATCTCCCTTTTCTTGG + Intergenic
1094806555 12:34099937-34099959 CTGGATAATCCTTCCTTCATGGG - Intergenic
1096012061 12:48226728-48226750 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1097349922 12:58537432-58537454 CTGGAACATTCTTCTTTTAAGGG - Intergenic
1097499872 12:60388673-60388695 CTGGACCCTCCCTGCTTTATGGG - Intergenic
1099574247 12:84361551-84361573 CTGGGTCATCCATCTTCTCTCGG + Intergenic
1100725082 12:97399960-97399982 ATTGATCTTACCTCTTTTATGGG - Intergenic
1101247589 12:102899498-102899520 CTTCATCATTCCTCTATTATGGG - Intronic
1101908742 12:108847244-108847266 CAGTGTCATCCCTGTTTTATAGG + Intronic
1105423311 13:20272234-20272256 CTGAATCAGCCCTCTTTGAGGGG - Intergenic
1109035141 13:57248805-57248827 CAGGATGTTCCCTCTTTTCTTGG + Intergenic
1111867540 13:93788305-93788327 CTGTATGAAGCCTCTTTTATAGG + Intronic
1111922514 13:94427243-94427265 CTTGATTATACTTCTTTTATGGG - Intergenic
1116064170 14:39961554-39961576 TTGGATCATCTCTCTTTTCTTGG - Intergenic
1116741328 14:48758899-48758921 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
1119496232 14:75081828-75081850 AAGGATCATCCTTCTTTTAGTGG + Exonic
1121690410 14:95874306-95874328 CTGGCACATACATCTTTTATTGG - Intergenic
1122212945 14:100184619-100184641 CTAGATCATCTCTTTTTTTTTGG - Intergenic
1123196001 14:106617305-106617327 CTGGATCTTCTCTATTTTAAAGG - Intergenic
1125717249 15:41826309-41826331 TTGGAACATCCCTCGTTTACGGG + Exonic
1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG + Intronic
1126872418 15:53003835-53003857 CTCAATCATTCATCTTTTATTGG + Intergenic
1126977546 15:54200932-54200954 TTGGATCTTCTCTCTTTTCTTGG - Intronic
1127014744 15:54671589-54671611 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
1128923402 15:71632303-71632325 CGGAATCATCCCTCCTTTAAAGG - Intronic
1131856615 15:96603778-96603800 CTGGATTATCTTTCTATTATTGG - Intergenic
1132380245 15:101361253-101361275 CTTGATTATCTCTCTATTATAGG + Intronic
1134370865 16:13623145-13623167 CTGGAGTATTCTTCTTTTATAGG - Intergenic
1138112080 16:54331703-54331725 CAGTATCATCCCCATTTTATAGG - Intergenic
1139639640 16:68281800-68281822 CGGGATCCTCCCTCTTGTGTAGG + Intronic
1150282297 17:63935804-63935826 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1150767417 17:68013161-68013183 CTGGATCATCATTTTTTTGTGGG + Intergenic
1150896025 17:69211859-69211881 TTGGATCTTCTCTCTTTTCTTGG + Intronic
1152088477 17:78234202-78234224 ATGGCTCATCCCTTTGTTATTGG + Intronic
1158024012 18:52874580-52874602 CTACATCATATCTCTTTTATGGG + Intronic
1159945441 18:74441379-74441401 TTGGATCATCTCTCTTCTTTTGG - Intronic
1159961670 18:74559949-74559971 CAGGATCATCCATGTTTTCTAGG + Intronic
1164254591 19:23516375-23516397 CTGGATTATCCCTCTTCCAATGG + Intergenic
1168707864 19:58480043-58480065 CTGAATCACCCCTCCTGTATCGG + Intronic
927328082 2:21829669-21829691 CTGGATTGTCTCTCTTTTCTTGG + Intergenic
928832138 2:35500074-35500096 CTGGATCATCAATCTTTTGTTGG - Intergenic
930595430 2:53381685-53381707 CTCAAAAATCCCTCTTTTATGGG - Intergenic
930794154 2:55370049-55370071 TTGGATCCTTCCTCTTTTCTTGG + Intronic
936756655 2:115722012-115722034 CTGCATGATTCCCCTTTTATGGG + Intronic
939582394 2:143966111-143966133 CAGAATCATCCCTGTTTTACAGG - Intronic
942369930 2:175272872-175272894 CTGAAACATCCCTCTTGGATTGG + Intergenic
943157409 2:184200843-184200865 CTTCATTATCACTCTTTTATTGG - Intergenic
944108537 2:196105969-196105991 CTGGATCATTGCTCTTTTCCTGG - Intergenic
944780297 2:203010627-203010649 CTGGATAATCCCTAGTTTCTTGG - Intronic
946608810 2:221436220-221436242 CTTCAAAATCCCTCTTTTATTGG + Intronic
947100847 2:226619832-226619854 CTGGAGGCTCCCTCTTTTCTAGG - Intergenic
1169304676 20:4478498-4478520 CTGTATGATCTCACTTTTATGGG + Intergenic
1171124453 20:22589335-22589357 ATGGATTGTCCATCTTTTATGGG + Intergenic
1171198298 20:23220021-23220043 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1183444670 22:37845437-37845459 AAGGACCATCCCTATTTTATAGG + Intronic
949493909 3:4613733-4613755 CAGGATCATCCTTCTTTTCATGG + Intronic
949517995 3:4824634-4824656 CTGCATCTTGCCTCTTTTAAAGG - Intronic
949924589 3:9031254-9031276 ATGGACCATGGCTCTTTTATGGG + Intronic
950273188 3:11635654-11635676 CAGTATCAGCCCTCTTTTATTGG + Intronic
952002590 3:28803633-28803655 CTGGATCATTTCTAGTTTATGGG + Intergenic
952243430 3:31558831-31558853 CTGTATCATTACTCATTTATTGG + Intronic
953092886 3:39747194-39747216 CTGGGTCATCCCTCTTTCCATGG + Intergenic
956961797 3:74411463-74411485 CTGGATTATTCCTCTTTGATAGG + Intronic
957311149 3:78520437-78520459 CTGTCTCAGGCCTCTTTTATAGG - Intergenic
958968917 3:100589630-100589652 ATGGAACAACCCTCTTTCATCGG + Intergenic
959110676 3:102118623-102118645 CTGCATGATCTCACTTTTATGGG - Intronic
962258562 3:133888268-133888290 TGGGATCATCCCTGTTTTGTGGG - Intronic
964299648 3:155274219-155274241 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
964772891 3:160243134-160243156 TTGGATCTTCTCTCTTTTCTAGG - Intronic
965395431 3:168155540-168155562 CAGGAACATCCTTCTTTTATGGG + Intergenic
966485062 3:180459643-180459665 CTGGAACATCCATCTTCTTTTGG - Intergenic
970338488 4:15079565-15079587 CTGGATAATCTCTGTATTATAGG + Intergenic
971802052 4:31305310-31305332 GTGGATTATCCCTGTTTTAATGG - Intergenic
972182258 4:36482636-36482658 GTGTATCATCCCAATTTTATGGG + Intergenic
973604230 4:52570719-52570741 CTGTATTATCCCTATTTTACAGG - Intergenic
974412312 4:61557356-61557378 CTGAACCATCCATCTATTATAGG - Intronic
979020572 4:115491998-115492020 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG + Intronic
979700261 4:123658895-123658917 CAGGAGCATCCCACATTTATTGG - Intergenic
979757220 4:124356386-124356408 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
980019747 4:127694445-127694467 TTGGATCTTCTCTCTTTTCTTGG + Intronic
981449438 4:144879442-144879464 CTGGCACATACCTCTATTATTGG - Intergenic
981923549 4:150113626-150113648 TTGAATCTTCTCTCTTTTATTGG + Intronic
982746547 4:159109392-159109414 CTTGATAATCCGTATTTTATGGG + Intronic
982992052 4:162288965-162288987 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
983255691 4:165397685-165397707 CAGGATTATCTCCCTTTTATAGG + Intronic
984546805 4:181114641-181114663 CTTGATAATGCCTCTTTCATAGG - Intergenic
985662740 5:1165460-1165482 CAGGTTCAGCCCTCTCTTATCGG + Intergenic
990102441 5:52208903-52208925 CTGCCTCATCCTTCTTTCATTGG - Intergenic
990891493 5:60655502-60655524 TTGGATCGTCTCTCTTTTCTTGG + Intronic
991461547 5:66864225-66864247 TGGGAGCATCCCTCTTTTAGAGG + Intronic
993693394 5:91031061-91031083 CTGTATCATCCCTATATGATTGG - Intronic
998734255 5:145117401-145117423 CTGGATCTTCTCTCATTTAACGG - Intergenic
1000119197 5:158180488-158180510 CTGGATGATGCCTGTTTTATGGG - Intergenic
1002093944 5:176819933-176819955 CTGGATCAACACTATTTTATTGG + Intronic
1002884524 6:1281696-1281718 CTGGAACATCCCACTTGTGTAGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1004739927 6:18449011-18449033 CTTGAACATCTCTATTTTATAGG + Intronic
1006038177 6:31230488-31230510 CTGGATCAACCTTCTTTTTCTGG - Intergenic
1006283214 6:33072926-33072948 CTGTATCCTCCCTCTCTTCTAGG - Intronic
1007503865 6:42319305-42319327 CTGGAGCATGCATCTTTAATGGG - Intronic
1008185514 6:48385498-48385520 TTGGATCATCTCTCTTTTCTTGG + Intergenic
1012716743 6:102683375-102683397 CTGGATCAATCATATTTTATTGG - Intergenic
1012965898 6:105672662-105672684 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
1014909647 6:127076028-127076050 CAGTATCAGCCCTTTTTTATAGG + Intergenic
1016484789 6:144525557-144525579 TTGGATCCTCTCTCTTTTCTTGG + Intronic
1019044155 6:169130265-169130287 CTGGAACATCCATCTTCTCTGGG - Intergenic
1019122839 6:169817776-169817798 TTGGATCTTTTCTCTTTTATTGG + Intergenic
1030263702 7:107594081-107594103 CTGGATTTTCCCTATTTTTTTGG + Exonic
1030553916 7:110999348-110999370 CTGGATTGTACCTCTTTTATTGG + Intronic
1035822941 8:2614369-2614391 CTGGGTCATCCCTATGTTATAGG + Intergenic
1037194040 8:16166101-16166123 CTGGATGATTCCTCGTTTCTAGG - Intronic
1043553931 8:81407600-81407622 CTGAATCACCCCTCTTGGATTGG + Intergenic
1047777457 8:128084845-128084867 CTGGATGAACCCTCTTGCATTGG + Intergenic
1055584917 9:77748823-77748845 CTGGATCATACCTCACTTGTGGG - Intronic
1186308690 X:8293159-8293181 TTGGATCCTCTCTCTTTTCTTGG - Intergenic
1187597557 X:20790394-20790416 CTGGATGTGCCCTCTTTTATTGG + Intergenic
1189240481 X:39520723-39520745 CTTGATCATCCTCCTTTTATTGG - Intergenic
1193255664 X:79345761-79345783 TTGGATCTTCTCTCTTTTCTTGG - Intergenic
1193371536 X:80703899-80703921 CTTGATTATCACTATTTTATTGG - Intronic
1193950705 X:87794635-87794657 TTGGATCTTCTCTCTTTTCTTGG + Intergenic
1195664741 X:107418791-107418813 ATGTATCAGCCCTCTATTATAGG - Intergenic
1196383788 X:115124805-115124827 GAGGATCATACCTATTTTATGGG + Intronic
1196646097 X:118118533-118118555 CTGGATTATCCCATTTTTACTGG - Intergenic
1198987161 X:142468065-142468087 TTGGATCTTCCCTCTTTTCTTGG + Intergenic