ID: 1126427322

View in Genome Browser
Species Human (GRCh38)
Location 15:48542673-48542695
Sequence GGTTCCATGGGGAAAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126427322_1126427334 1 Left 1126427322 15:48542673-48542695 CCCCCAGTTTTCCCCATGGAACC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1126427334 15:48542697-48542719 GATTCAGTAGATGTGGCATGGGG 0: 1
1: 1
2: 25
3: 151
4: 736
1126427322_1126427329 -6 Left 1126427322 15:48542673-48542695 CCCCCAGTTTTCCCCATGGAACC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1126427329 15:48542690-48542712 GGAACCCGATTCAGTAGATGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1126427322_1126427332 -1 Left 1126427322 15:48542673-48542695 CCCCCAGTTTTCCCCATGGAACC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1126427332 15:48542695-48542717 CCGATTCAGTAGATGTGGCATGG 0: 1
1: 0
2: 4
3: 48
4: 352
1126427322_1126427333 0 Left 1126427322 15:48542673-48542695 CCCCCAGTTTTCCCCATGGAACC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1126427333 15:48542696-48542718 CGATTCAGTAGATGTGGCATGGG 0: 1
1: 0
2: 2
3: 47
4: 317
1126427322_1126427335 7 Left 1126427322 15:48542673-48542695 CCCCCAGTTTTCCCCATGGAACC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1126427335 15:48542703-48542725 GTAGATGTGGCATGGGGCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126427322 Original CRISPR GGTTCCATGGGGAAAACTGG GGG (reversed) Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901823393 1:11844820-11844842 GGATCCATGGGGGTAACAGGTGG + Intergenic
904000044 1:27333759-27333781 GGTGCCATGGGGGATCCTGGGGG - Intronic
907993711 1:59608223-59608245 GGGGCTATGGGGAAAACTGAAGG - Intronic
908733433 1:67250954-67250976 GGTTCCATGAGGAAAACAGAGGG + Intronic
913057507 1:115175983-115176005 GCTTCCCTGGGGACAACTGGGGG + Intergenic
915699814 1:157781184-157781206 GGTTCCATGAGAACAACAGGTGG + Intergenic
917881373 1:179339995-179340017 GGTTCCACGGGGCCAACTGTGGG + Intronic
918197991 1:182240629-182240651 GTTTCCATGAGGAAAGCTGAAGG - Intergenic
919169216 1:193932561-193932583 GATTCCATGAGGAAAAATAGAGG - Intergenic
919381626 1:196868148-196868170 GGTTACATGGGGAGAACTAAAGG - Intronic
921145653 1:212353517-212353539 AGTTCCATGGGAAACAGTGGTGG - Intronic
921407854 1:214800265-214800287 TATTCCAGAGGGAAAACTGGGGG - Intergenic
922327987 1:224546822-224546844 TGTTCCATGAGGATCACTGGAGG - Intronic
922978184 1:229802469-229802491 GGGTCAAATGGGAAAACTGGAGG + Intergenic
923428420 1:233895025-233895047 TATTCCATGGGGAAAACTTGGGG - Intergenic
923586168 1:235273842-235273864 GTTTACATAGGGAAAAGTGGTGG - Intronic
924029760 1:239874473-239874495 GGTTCCATGGGGCCAACTGTGGG + Intronic
1063079427 10:2751492-2751514 GCTTCCAGGGGGGAATCTGGGGG - Intergenic
1066207273 10:33201982-33202004 ATTTCCATGGGCAAAACTGAAGG - Intronic
1066499651 10:35978521-35978543 GGTTCCATGGGGCCCACTGCAGG - Intergenic
1066577098 10:36838153-36838175 GATTCCATAGGGCAAACTAGGGG + Intergenic
1067229540 10:44396881-44396903 GGCTCCATGGAGAAGGCTGGTGG + Intergenic
1068032395 10:51719722-51719744 GGTAACATTGGGAAAGCTGGGGG + Intronic
1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG + Intergenic
1070358512 10:75663855-75663877 GGTTCCATGGCGAGGACTGCTGG + Intronic
1071651406 10:87396276-87396298 GATTCCCCGGGGAGAACTGGAGG + Intergenic
1073677369 10:105663326-105663348 GTCTCCATGGGGAAAACTGCCGG + Intergenic
1074264414 10:111887227-111887249 GGTACCATGAGGAAAAATAGGGG - Intergenic
1075008288 10:118846153-118846175 CATTCCATGGGGAAAAAGGGAGG + Intergenic
1075321394 10:121494209-121494231 GGTGCCATGGAGGAAACAGGGGG - Intronic
1075913854 10:126149072-126149094 AGTTCCATGGGGAGGACCGGGGG + Intronic
1076281634 10:129251340-129251362 TGTACCATAGGGAAAACTGCTGG - Intergenic
1078668114 11:13342445-13342467 GGTTCCATGGGGCACACTAGGGG - Intronic
1078752049 11:14174521-14174543 GGTTTCATGAGGAAAACAGAGGG + Intronic
1079092269 11:17489381-17489403 GGTTCCAAAAGGAAAATTGGGGG - Intergenic
1079291358 11:19191074-19191096 TGTTACAAGGAGAAAACTGGGGG - Intronic
1079985366 11:27194606-27194628 GTGTCCATGTGGAAAACTAGAGG - Intergenic
1080108754 11:28541566-28541588 AGTTCCATGGGGTACATTGGAGG + Intergenic
1080977888 11:37364294-37364316 GTCTCCATGGGGAAAGCTTGCGG + Intergenic
1083968393 11:66057298-66057320 GCTCCCATGGGCAAAACTGTAGG - Exonic
1084702050 11:70793294-70793316 GGTTCCATGGAGATGACTGTGGG + Intronic
1084878125 11:72149125-72149147 GACTCCTTGGGGAAAACAGGAGG + Intergenic
1085730244 11:78991722-78991744 GGGTCCATGGGGAAAACCAAGGG - Intronic
1085974583 11:81636814-81636836 GGTTTCATGAGGAAAACAGAGGG - Intergenic
1089069672 11:115689681-115689703 GGTTCCTTGGGGTAGGCTGGGGG + Intergenic
1089076933 11:115745795-115745817 GGCCCCGTGGGGAAAACTTGGGG + Intergenic
1091399888 12:175304-175326 GGTCCAATGGGGGAAAGTGGTGG - Exonic
1091997147 12:5002541-5002563 GGTCCCATGGGGGGAACTGCAGG + Intergenic
1092211338 12:6648246-6648268 GGGTCCAAGGGGAAAACAAGAGG + Intergenic
1093257671 12:16890670-16890692 GGTAACATGGATAAAACTGGAGG + Intergenic
1094290925 12:28849222-28849244 AATACCATGGGGAAAAGTGGGGG + Intergenic
1095926600 12:47585341-47585363 GGTGTCATGGGGGAGACTGGAGG + Intergenic
1096580162 12:52579904-52579926 TGATCCCTGGGGAAAAGTGGTGG + Intergenic
1101188550 12:102307066-102307088 GATTCCTTGGGAAAAACAGGAGG + Intergenic
1101352644 12:103946307-103946329 GGTTCCACAGGGCAGACTGGGGG - Intronic
1102232902 12:111275827-111275849 GGTTCAAAGGGGAGAGCTGGTGG - Intronic
1103369040 12:120404318-120404340 AGTTCCCCAGGGAAAACTGGGGG - Intergenic
1105887429 13:24653652-24653674 GGCTCCATGAGGAAACCTGGCGG + Intergenic
1113168907 13:107475897-107475919 GGGTCCATGGGGAAAAAAAGAGG - Intronic
1114345842 14:21793906-21793928 GGTGCCATAGGCAAAACAGGGGG + Intergenic
1116678832 14:47939970-47939992 GACTCCATGGGAAAAACAGGAGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119740544 14:77011240-77011262 AGTTCCATAGGGCAGACTGGGGG + Intergenic
1121727681 14:96165200-96165222 GGTCCCCTGGGGAACCCTGGTGG - Intergenic
1121835928 14:97092322-97092344 GCTTCCATGGGCAGAGCTGGTGG + Intergenic
1124202323 15:27689213-27689235 GGCTCCATGGGGAAAACAAAAGG - Intergenic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1126753207 15:51898388-51898410 GGGTAGATGGGGAATACTGGGGG - Intronic
1127318559 15:57819747-57819769 GGCTACATGGGAAACACTGGAGG - Intergenic
1127603586 15:60563307-60563329 AATTCCATGTGGAAAACTGCAGG - Intronic
1130037042 15:80370335-80370357 GGTTTCATGAGGAAAACAGAGGG - Intronic
1130133533 15:81162773-81162795 GGTTTTTTGGAGAAAACTGGTGG - Intronic
1130667778 15:85884502-85884524 TGTTCCATGGGGTAAGCTGTAGG - Intergenic
1136714474 16:32266116-32266138 GGTTCCAGAGGGAAAAGAGGAGG - Intergenic
1136753415 16:32663299-32663321 GGTTCCAGAGGGAAAAGAGGAGG + Intergenic
1136814698 16:33207066-33207088 GGTTCCAGAGGGAAAAGAGGAGG - Intronic
1136821174 16:33317146-33317168 GGTTCCAGAGGGAAAAGAGGAGG - Intergenic
1136827737 16:33373685-33373707 GGTTCCAGAGGGAAAAGAGGAGG - Intergenic
1136832803 16:33472456-33472478 GGTTCCAGAGGGAAAAGAGGAGG - Intergenic
1139282326 16:65781290-65781312 TGTGCCATGGGGAAAAGTGTGGG + Intergenic
1202993274 16_KI270728v1_random:30040-30062 GGTTCCAGAGGGAAAAGAGGAGG - Intergenic
1203055576 16_KI270728v1_random:923653-923675 GGTTCCAGAGGGAAAAGAGGAGG + Intergenic
1143233623 17:5379057-5379079 GGCTGCATGAGGAACACTGGAGG - Intronic
1144255173 17:13460561-13460583 GGTCCCATGGGGATATTTGGGGG - Intergenic
1144593254 17:16542806-16542828 GGTTTCATGAGGAAAACAGAGGG - Intergenic
1145990131 17:29074367-29074389 GGGTCCATGGGGAGGATTGGGGG - Exonic
1146263334 17:31435704-31435726 GGTTCCCTGGGCAGGACTGGAGG + Intronic
1149598101 17:57875789-57875811 TGTTCCATGGGTAAACCTGGGGG - Intronic
1150149976 17:62801052-62801074 GGCTCCATGCCGAAAACTGAGGG + Intronic
1150268640 17:63848183-63848205 GGTACCATGGGGAAACAAGGAGG + Intergenic
1150623317 17:66824379-66824401 AATCCCATGGGGAAAGCTGGGGG + Intergenic
1151376032 17:73689804-73689826 TGTTCCACGGGACAAACTGGGGG - Intergenic
1152265009 17:79289009-79289031 GCATCCATGGGGACAGCTGGGGG + Intronic
1152848346 17:82616300-82616322 GATTTCCTGGGGGAAACTGGAGG + Intronic
1153944370 18:10006176-10006198 GATTCCATGTGCAAAAATGGAGG - Intergenic
1157563225 18:48663251-48663273 GGTCACATAGGGAACACTGGAGG + Intronic
1157812371 18:50706529-50706551 GCTTTCAAGGGGAAATCTGGTGG - Intronic
1161627897 19:5337771-5337793 TGTTCCATGGTGGAAATTGGGGG + Intronic
1163138089 19:15327851-15327873 GCTTCCAGGGGCAAAAGTGGCGG + Intronic
1163154116 19:15430891-15430913 GGTGCCAGAGGGAAAACTGCGGG + Intronic
1163319799 19:16567950-16567972 GGTGGCATTGGGAAAACAGGCGG - Intronic
1163600026 19:18243491-18243513 ACTTGCATGGGGAAAATTGGGGG + Intronic
1163711776 19:18851336-18851358 GCTTCCGTGGGGAAAAGTGAGGG - Intronic
1163771516 19:19193932-19193954 AGCTCCATGGGGAAAGCTGGCGG - Exonic
1164399705 19:27894163-27894185 GTTTTCAGGTGGAAAACTGGAGG - Intergenic
1165444672 19:35850309-35850331 GTTCCCATGGGGAAAATTAGGGG + Intronic
1166498277 19:43321630-43321652 GGTTCCATGAGGAAAAACAGTGG - Intergenic
1166837129 19:45674283-45674305 GGTTCTATGGGGAGCAGTGGGGG + Intronic
1168127303 19:54292366-54292388 GGGTCCATGGGAAAGGCTGGTGG + Intergenic
1168173068 19:54602551-54602573 GGGTCCATGGGAAAGGCTGGTGG - Intronic
926927082 2:17997760-17997782 GGTTCCTTGAGGAAAACAGAGGG - Intronic
930876097 2:56218752-56218774 GGTGCCATAGGGAAAAATGTAGG - Intronic
933506846 2:83187482-83187504 GTTTCAAAGGGCAAAACTGGGGG - Intergenic
934855997 2:97730695-97730717 ACTTCCATGTGGAATACTGGGGG - Intronic
935022416 2:99244544-99244566 TGTTCCTTTGGGTAAACTGGAGG - Intronic
941390449 2:164907170-164907192 GATTCCATTGGGAAGACAGGGGG - Intronic
942064656 2:172259147-172259169 GGTTGATTGGAGAAAACTGGTGG + Intergenic
942600837 2:177639458-177639480 TGTTCTATGGGGAAGAATGGAGG - Intronic
945228512 2:207558593-207558615 TATTTCAGGGGGAAAACTGGTGG - Intronic
947188931 2:227481273-227481295 GGGACCATGTGGAAAGCTGGAGG - Intronic
1170473552 20:16691719-16691741 GGTGCCATTGGGAAAACTTTGGG - Intergenic
1171209975 20:23309476-23309498 GGTTCCATGGGCAAGCATGGAGG - Intergenic
1172272922 20:33664464-33664486 GGTGCCTTGGGGAAGACTGGGGG - Intronic
1172910992 20:38408650-38408672 GGTTCCAAGGAGCAAACAGGAGG + Intergenic
1173122429 20:40305992-40306014 GGTTACCTGGGGACAAGTGGAGG - Intergenic
1173194232 20:40900746-40900768 GGTTCCATGGAGAGCTCTGGAGG - Intergenic
1175055134 20:56191017-56191039 GCTTCCACTGGGAAAAATGGAGG + Intergenic
1176693603 21:9947842-9947864 GGTTTCATGAGGAAAACAGAGGG + Intergenic
1177018840 21:15827092-15827114 GGATGCATGGGCAAATCTGGAGG - Exonic
1178710429 21:34911872-34911894 GCAGCCATGGGGAAAACTGGGGG - Intronic
1182741807 22:32573122-32573144 GGCTCTCTGGGGAAAACAGGGGG - Intronic
1182771237 22:32797825-32797847 GATTCCATGGGGAATCCTGTAGG - Intronic
1184313908 22:43667447-43667469 GGTTCCAGGGCCAGAACTGGAGG + Intronic
951166894 3:19493342-19493364 GTGTTCATGGGGAGAACTGGTGG + Intronic
955080003 3:55649725-55649747 GGCTCCATGGGGAAATGAGGAGG - Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
958634203 3:96722103-96722125 ATTTCCCTGGGGAAAACTTGTGG + Intergenic
958889157 3:99763956-99763978 GGTTACTTGGGGAAGCCTGGCGG - Intronic
960583267 3:119298209-119298231 GGTTCCCAGGGGAGAGCTGGGGG - Intronic
960657223 3:120018389-120018411 GGTTCCATAGGGCCAACTGCAGG + Intronic
960659628 3:120043663-120043685 GGTTCCTTTGGTAAAAGTGGAGG - Intronic
962152191 3:132904640-132904662 GGTGCCATAGGGAAAACATGGGG + Intergenic
963174481 3:142283557-142283579 GGTTACATGAGGAAAATAGGGGG - Intergenic
965193865 3:165568477-165568499 GGCTACATGGCGAAAGCTGGGGG - Intergenic
966463360 3:180202505-180202527 TGTTCCATGGGACAAGCTGGGGG + Intergenic
968177260 3:196561745-196561767 GGTTCCATATGAAAGACTGGAGG - Intronic
968600682 4:1507883-1507905 GAGTCCATGTGGAAAAGTGGAGG - Intergenic
968628036 4:1636927-1636949 GGGGCCATGGGTAACACTGGAGG - Intronic
973237956 4:47926442-47926464 GGTTCCACAGGGCCAACTGGAGG + Intronic
974702423 4:65468941-65468963 AGTTCCATGGGGAAGTCTGTGGG + Intronic
976367307 4:84245622-84245644 GGATACTAGGGGAAAACTGGAGG - Intergenic
976555115 4:86441806-86441828 GCTTCCATGGGGACAATAGGGGG - Intronic
978484917 4:109241673-109241695 AGTGCCAAGGTGAAAACTGGTGG - Intronic
978567487 4:110099426-110099448 GGTTCAACAGGAAAAACTGGTGG + Intronic
980195315 4:129580438-129580460 GGTTCCATGAGGCAGACTGCAGG + Intergenic
980366224 4:131808080-131808102 GGTTTCATGAGGAAAACAGAGGG + Intergenic
984088388 4:175340286-175340308 GTTTCCATGTGGTAACCTGGAGG - Intergenic
984994581 4:185417054-185417076 TTTACCATGGAGAAAACTGGTGG + Intronic
985699392 5:1361365-1361387 GGTTCCAGGGGGCACACTGGAGG + Intergenic
986041807 5:4001063-4001085 GGGTCCAGTGGGAAAACTCGGGG - Intergenic
988414715 5:30931548-30931570 GGATGCATGGGGAAAGCTGAGGG + Intergenic
990554279 5:56914899-56914921 AGTTCTATAGGGAAAACTGCAGG - Exonic
993127029 5:83847820-83847842 GGTGCCATGTGGATATCTGGAGG - Intergenic
993422441 5:87719161-87719183 GGTTTCATGAGGAAAACAGAGGG + Intergenic
993832848 5:92780719-92780741 GGTTCCATGAAGAAGACAGGGGG - Intergenic
994128912 5:96201597-96201619 GGTCCCATAGGGAAAAATGTAGG - Intergenic
998173694 5:139887225-139887247 GGTTCCATGGGTGAGTCTGGGGG + Intronic
999596374 5:153209832-153209854 GGTTCCATGGGGCAAGCCAGCGG + Intergenic
1001398981 5:171435627-171435649 GGGTCCATGGGGAAAGAAGGAGG - Intronic
1002465062 5:179404117-179404139 GCTCCCATGGGGAAGACTGGAGG + Intergenic
1002931992 6:1641114-1641136 AGTTCCCTTGGGGAAACTGGTGG + Intronic
1004966120 6:20853443-20853465 GGTTCCATGGTCAATTCTGGGGG + Intronic
1006725751 6:36197643-36197665 GGTGCCGAGGGGAAATCTGGGGG + Intronic
1006819466 6:36880269-36880291 GAATCCATGGGAAAAACAGGAGG + Intronic
1008404239 6:51100950-51100972 GGAGCCATGGAGAAAAGTGGAGG - Intergenic
1010896565 6:81371846-81371868 TGTTCCATTGGTAAAACTGTAGG + Intergenic
1013878020 6:114857711-114857733 GGTGCCACAGGGAAATCTGGGGG + Intergenic
1018189327 6:161295061-161295083 GGTTCCATGAGGAAAACAGAGGG - Intergenic
1018395442 6:163374809-163374831 GGCTCTATGGTAAAAACTGGGGG + Intergenic
1019029885 6:169000872-169000894 GACCCCATGGGGAAAACAGGAGG + Intergenic
1019275196 7:172498-172520 GGGTCCCTGGGGCAAGCTGGAGG + Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1023784815 7:43695426-43695448 TGTGCCATGTGGATAACTGGAGG - Intronic
1025636892 7:63328819-63328841 GGCTCCATGAGGAAAAATAGAGG + Intergenic
1025645803 7:63419283-63419305 GGCTCCATGAGGAAAAATAGAGG - Intergenic
1028351999 7:89860141-89860163 GGTTTCATGAGGAAAACAGAGGG - Intergenic
1028683864 7:93570404-93570426 GCATCCATGGGAAAAACTGGAGG + Intronic
1033636525 7:143217234-143217256 GGTTCTATGAGGAACACAGGAGG + Intergenic
1034456537 7:151174009-151174031 GGATCCCTGGGAAGAACTGGGGG - Intronic
1035232937 7:157477179-157477201 GGTCCCATGTGCAAAAGTGGTGG - Intergenic
1035610245 8:957263-957285 GGTGCCATGGGGAAGACAGGAGG - Intergenic
1035717738 8:1766698-1766720 CCTTCCATGGGTAAAACTGGAGG - Intronic
1036915867 8:12803202-12803224 GATTTCAGGGGGAAAACTGGGGG - Intergenic
1036998617 8:13689833-13689855 GATACCCTGGGAAAAACTGGGGG - Intergenic
1039074519 8:33677755-33677777 GGTTCCATGCTGAAAGCAGGAGG - Intergenic
1039256667 8:35726368-35726390 GTTTCCATGGGGAAAAGTCCTGG - Exonic
1042361782 8:67891968-67891990 AGTTCCATGGGACAAGCTGGGGG - Intergenic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1043973718 8:86562259-86562281 GGTTCCATGTGGAACTCTGTGGG - Intronic
1047632306 8:126721639-126721661 TGTTCCATGGGGAAAAAAGATGG - Intergenic
1048774579 8:137931857-137931879 GGATCCATGGAGAAAACTCCTGG - Intergenic
1052521226 9:29550342-29550364 GGTTTCATGAGGAAAACAGAGGG - Intergenic
1052831385 9:33218713-33218735 GCATCCATGGGGAAAAAGGGAGG + Intronic
1053367602 9:37534660-37534682 GTGTTCATGGAGAAAACTGGGGG + Intronic
1056498660 9:87186414-87186436 GGTTACAAAGGGAAAAATGGAGG - Intergenic
1056667051 9:88589409-88589431 GGTTCCATGGAGAAACCTCAAGG + Intergenic
1061510057 9:131055050-131055072 GTTGTAATGGGGAAAACTGGAGG - Intronic
1185978992 X:4755515-4755537 GGTTTCAAGAGGTAAACTGGAGG + Intergenic
1189161357 X:38812596-38812618 GGCTCCATGTGGAAAAAAGGAGG + Intergenic
1189179788 X:38992838-38992860 GGCTCCATGGGGCTGACTGGAGG - Intergenic
1190300212 X:49053114-49053136 GGTTTGATGGAGCAAACTGGGGG + Intergenic
1190737743 X:53266869-53266891 GGTCCCATGGGGGAATCTGCGGG + Intronic
1192609512 X:72553685-72553707 GGTTCCATGGGGCCAACTGTGGG - Intronic
1194131473 X:90087734-90087756 GACTCCATGGGAAAAACAGGAGG - Intergenic
1194447381 X:94005357-94005379 GGTTTCATGAGGAAAACAGAGGG + Intergenic
1197635735 X:128912955-128912977 GGTTCCATGCAGAAAAGAGGAGG + Intergenic
1201157320 Y:11143636-11143658 GCTTCCATGTGGAAAACTTGTGG - Intergenic
1201932386 Y:19365286-19365308 GGGGCCATGGGGGAAAGTGGAGG + Intergenic