ID: 1126430297

View in Genome Browser
Species Human (GRCh38)
Location 15:48576473-48576495
Sequence GATCCCAACAGACCATAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126430294_1126430297 -3 Left 1126430294 15:48576453-48576475 CCTTCATTTACCCATGGGTTGAT 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1126430297 15:48576473-48576495 GATCCCAACAGACCATAAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126430297 Original CRISPR GATCCCAACAGACCATAAGC TGG Intronic
902536949 1:17124790-17124812 GTTCCCAACAGACCACAGACTGG + Intergenic
904504878 1:30943583-30943605 GAACCCAGAAGACCATGAGCAGG - Intronic
916481576 1:165219249-165219271 AATCCCAACGGCCCATAAACAGG + Intronic
921334573 1:214073488-214073510 GATCTCAAGAGACCAAAAGGGGG + Intergenic
1065672525 10:28135888-28135910 GTTCCTAACAGGTCATAAGCGGG - Intronic
1066214152 10:33269610-33269632 GTTCCTAACAGACCACAAACTGG - Intronic
1066482473 10:35810252-35810274 GATCCCACCACACCAAATGCTGG - Intergenic
1067575739 10:47407273-47407295 AATCCCACCACACCAAAAGCGGG + Intergenic
1085083708 11:73652942-73652964 AATCCCACCAGACCATGAGGAGG - Intronic
1087144002 11:94793985-94794007 GATACCAAACGACCATAAGATGG - Intronic
1088608702 11:111556488-111556510 GAGCCCCTCAGACCATAAGAGGG - Intronic
1100986123 12:100203199-100203221 GTTCCCAACAGACCACAGACAGG + Intronic
1100992919 12:100269009-100269031 GATGCAAGCAGACCATAATCAGG - Intronic
1101084340 12:101220410-101220432 GATCCCATGAGGCCAAAAGCAGG + Intergenic
1102333960 12:112061331-112061353 GACACCAACAGAGGATAAGCTGG - Exonic
1106697161 13:32187835-32187857 TATCAAAACTGACCATAAGCTGG + Intronic
1111201250 13:84940319-84940341 GTTCCTAACAGACCATCAACTGG - Intergenic
1112594396 13:100794696-100794718 GTTCCCAACAGGCCAAAAACTGG - Intergenic
1124387664 15:29223825-29223847 TATCCCAGCAGACGAAAAGCAGG + Intronic
1124864485 15:33475579-33475601 GTTCCCAACAGGCCATGAACTGG + Intronic
1125458120 15:39881216-39881238 TTCCCCAACAGACCATAAACCGG + Intronic
1125860722 15:42997005-42997027 GTTCCCAACAGGCCATAGACTGG - Intronic
1126430297 15:48576473-48576495 GATCCCAACAGACCATAAGCTGG + Intronic
1128232116 15:66042697-66042719 GATGCCAGCAAACCAGAAGCTGG - Intronic
1138353509 16:56359761-56359783 GATCCCAAAAGAGAAAAAGCAGG - Intergenic
1140392727 16:74601615-74601637 AATCCCAACTCACCTTAAGCAGG - Intronic
1143921980 17:10337233-10337255 GAGGCCAACAGACCAGAAGATGG - Intronic
1145191673 17:20846457-20846479 GTTCCTAACAGGCCATGAGCAGG - Intronic
1152483014 17:80568563-80568585 AATGTCAACAAACCATAAGCAGG - Intronic
1155859652 18:30881084-30881106 GATACCAACATGCCATAGGCAGG - Intergenic
1157151968 18:45227457-45227479 GATCTCACCAGACCAAATGCTGG - Intronic
1162862901 19:13521232-13521254 GACCCCAGCAGACCACAAGGGGG - Intronic
1165524750 19:36344586-36344608 GTTCCCAACAGACCATGGACTGG - Intronic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1165828082 19:38716999-38717021 GATCCCATGTGCCCATAAGCTGG + Intronic
929797806 2:45073452-45073474 GATCCCAACAGACCTAAGACAGG - Intergenic
931489016 2:62724715-62724737 GTTCCCAACAGGCCATAGACTGG - Intronic
932380728 2:71279395-71279417 GATCCCACCTGCCCAGAAGCAGG - Intronic
935423349 2:102893879-102893901 GATCCCAACAGATTAAAAACCGG + Intergenic
943145070 2:184033159-184033181 CAACCCAAAAGACCATCAGCGGG - Intergenic
945635236 2:212340758-212340780 GTTCCTAACAGACCATAGACTGG + Intronic
1169550365 20:6695936-6695958 GTTCCTAACAGACCATAGACTGG + Intergenic
1178296268 21:31412957-31412979 GTTCCTAACAGACCATAGACAGG + Intronic
1178491335 21:33054235-33054257 CACTCCTACAGACCATAAGCTGG + Intergenic
955124022 3:56091496-56091518 GCTCCCAACACAACAGAAGCTGG + Intronic
955740805 3:62089639-62089661 GCTCCCAACAGACCCCAAACGGG - Intronic
957168197 3:76702608-76702630 CATCACAACACACCATACGCTGG - Intronic
958943308 3:100337357-100337379 CGTCCCACCAGACCATAAGCAGG + Intronic
959106908 3:102075358-102075380 GATGCCAACAGAGCATATTCAGG + Intergenic
959358624 3:105363638-105363660 TATCTCAACAGACCGTAAGTAGG + Intergenic
961195033 3:124994313-124994335 GTTCCTAACAGACCACAAACTGG + Intronic
967503531 3:190227206-190227228 GCTCCCCACAGACCAGAAGCAGG + Intergenic
969192229 4:5531425-5531447 GTTCCTAACAGGCCATAGGCCGG - Intergenic
972580949 4:40395183-40395205 ATTCCCAACAGAGCATATGCTGG - Intergenic
974796093 4:66752178-66752200 GATAACAAAATACCATAAGCTGG + Intergenic
974868440 4:67608709-67608731 GATCTCAACAAATCTTAAGCAGG + Intergenic
976080369 4:81348032-81348054 GATCCCAGCAGCCCAAGAGCAGG + Intergenic
977417458 4:96750969-96750991 GATCCCAAAAGACAAGAGGCTGG - Intergenic
981106887 4:140891738-140891760 GATCCTAACAGACCATGGACTGG - Intronic
982423017 4:155220384-155220406 GATCCCATCAGACCATATTGAGG + Intergenic
988956617 5:36326458-36326480 GATCCAAACATACCACAAGTTGG - Intergenic
992782928 5:80144252-80144274 CATCCCAAATGACCATCAGCTGG - Intronic
999502873 5:152164393-152164415 GTTCCTAACAGACCACAACCTGG - Intergenic
1001636226 5:173212301-173212323 GAACCCAACTGACCATCAACAGG + Intergenic
1004518530 6:16341103-16341125 CATCCCAACAGACCAAATGGAGG + Intronic
1005809888 6:29507386-29507408 GATCCCACCAGGCCAGCAGCAGG - Intergenic
1008085604 6:47240848-47240870 GATCCCAACAGACAAGTGGCTGG + Intronic
1013065092 6:106676422-106676444 GATCCCACCTAACCATAAGAGGG - Intergenic
1018410513 6:163541362-163541384 CATCAAAACAGACCATATGCTGG - Intronic
1019933555 7:4239662-4239684 GATCAAAACAGGCCATAGGCCGG - Intronic
1023436608 7:40146813-40146835 GTTCCCAACAGACAACAAGGTGG + Intronic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1034943152 7:155244968-155244990 GATGGCAACAGACAAGAAGCTGG - Intergenic
1035314591 7:157990246-157990268 GAGTTCAACAGATCATAAGCAGG + Intronic
1043029621 8:75117169-75117191 CAACCCAAAAGTCCATAAGCAGG - Intergenic
1043781305 8:84339250-84339272 GTTCCCAACAGGCCACAAACTGG - Intronic
1044365144 8:91336293-91336315 GTTCCTAACAGACCATGAACTGG - Intronic
1047659637 8:127019125-127019147 CAACCCATCAGACCAGAAGCTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1059585280 9:115599340-115599362 TATCCCAACATATCACAAGCTGG - Intergenic
1059855638 9:118394440-118394462 GAGCTCAACAGCCCATAGGCAGG + Intergenic
1193690562 X:84636160-84636182 CATCCCAAAAGATCATAACCTGG + Intergenic
1199570216 X:149260120-149260142 CATCCAACCCGACCATAAGCAGG + Intergenic
1199588744 X:149445256-149445278 GATCCCAACAGACCAAAAAATGG + Intergenic
1201692457 Y:16782258-16782280 GATACCAACAGATAATAAGTTGG - Intergenic