ID: 1126430314

View in Genome Browser
Species Human (GRCh38)
Location 15:48576549-48576571
Sequence CTGGAGGAATGAAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2414
Summary {0: 1, 1: 2, 2: 13, 3: 226, 4: 2172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126430305_1126430314 20 Left 1126430305 15:48576506-48576528 CCTTGTTTTATTGGTCTTTGTGC 0: 1
1: 0
2: 2
3: 34
4: 359
Right 1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG 0: 1
1: 2
2: 13
3: 226
4: 2172
1126430306_1126430314 -2 Left 1126430306 15:48576528-48576550 CCTTAGCACATCCAGTGCCTGCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG 0: 1
1: 2
2: 13
3: 226
4: 2172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126430314 Original CRISPR CTGGAGGAATGAAGGGAAGG TGG Intronic
Too many off-targets to display for this crispr