ID: 1126430314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:48576549-48576571 |
| Sequence | CTGGAGGAATGAAGGGAAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2414 | |||
| Summary | {0: 1, 1: 2, 2: 13, 3: 226, 4: 2172} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1126430305_1126430314 | 20 | Left | 1126430305 | 15:48576506-48576528 | CCTTGTTTTATTGGTCTTTGTGC | 0: 1 1: 0 2: 2 3: 34 4: 359 |
||
| Right | 1126430314 | 15:48576549-48576571 | CTGGAGGAATGAAGGGAAGGTGG | 0: 1 1: 2 2: 13 3: 226 4: 2172 |
||||
| 1126430306_1126430314 | -2 | Left | 1126430306 | 15:48576528-48576550 | CCTTAGCACATCCAGTGCCTGCT | 0: 1 1: 0 2: 1 3: 23 4: 187 |
||
| Right | 1126430314 | 15:48576549-48576571 | CTGGAGGAATGAAGGGAAGGTGG | 0: 1 1: 2 2: 13 3: 226 4: 2172 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1126430314 | Original CRISPR | CTGGAGGAATGAAGGGAAGG TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||