ID: 1126430724

View in Genome Browser
Species Human (GRCh38)
Location 15:48581070-48581092
Sequence CACTTTTTGCAATAGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126430724 Original CRISPR CACTTTTTGCAATAGGACAT GGG (reversed) Intronic
900737569 1:4308786-4308808 CACTTTTTGGAAAAGGAACTAGG + Intergenic
902575548 1:17375017-17375039 CACCTTATGGAGTAGGACATGGG + Intronic
907706483 1:56837032-56837054 TAATATTTGCAATAGGACTTGGG + Intergenic
918543292 1:185654569-185654591 CATTTTTTTAAATAGTACATAGG - Intergenic
918611341 1:186495969-186495991 CACTTTTTAGAATAAGTCATAGG + Intergenic
1063411639 10:5840850-5840872 CACTTTCTGCAGCAGGACCTGGG - Intronic
1063617067 10:7609487-7609509 TACTTTATGCTCTAGGACATTGG - Intronic
1067517298 10:46962221-46962243 AACTTATTGCCATAGGACAAAGG - Intronic
1067644950 10:48089608-48089630 AACTTATTGCCATAGGACAAAGG + Intergenic
1068536987 10:58251425-58251447 CATTTTTTTCAACAGCACATGGG - Intronic
1070140979 10:73737646-73737668 TACTATTTGTAATAGGAGATAGG + Intergenic
1070457160 10:76628909-76628931 CACTGTGTGCAAAATGACATGGG - Intergenic
1071243211 10:83732961-83732983 CTCTTTTTGCTATATGCCATAGG + Intergenic
1071251366 10:83823060-83823082 GGCTTTTTGCAGGAGGACATAGG + Intergenic
1071858140 10:89646024-89646046 CACTTCTAGCAATAGGAAACGGG + Intergenic
1071992095 10:91109476-91109498 CATCTTTTGCATCAGGACATTGG - Intergenic
1072315243 10:94196293-94196315 CACTTTATGCTATAATACATAGG - Intronic
1072822685 10:98573652-98573674 CACTTTTTCAAAAAGGCCATGGG + Intronic
1072836574 10:98721293-98721315 CACTTTCTACAAGAGGACACTGG + Intronic
1074039332 10:109772554-109772576 TACTGTTTGCAAATGGACATAGG + Intergenic
1074085381 10:110205816-110205838 CAGTTTTTGCAAAATGGCATTGG + Intergenic
1076622216 10:131797897-131797919 CACTGTTTGCTTTAGGACCTGGG - Intergenic
1078219125 11:9336576-9336598 CACTTATGGCAAGAGGAGATTGG - Intergenic
1078349864 11:10583724-10583746 CAGTCTTTGCAAAAGGAAATAGG + Intronic
1078984380 11:16577392-16577414 CTCTCTCTGAAATAGGACATAGG - Intronic
1082907151 11:58320868-58320890 CACCTTTTGCAATGTGACCTTGG + Intergenic
1087726777 11:101727300-101727322 CATTTTTTCCCCTAGGACATAGG - Intronic
1088805218 11:113346170-113346192 CACTTTTTACAAAATGACACTGG - Intronic
1089089533 11:115858720-115858742 CTCTTTTTTCAATATTACATTGG - Intergenic
1095503091 12:42862001-42862023 CACTGTTTGCATTAGAACAGTGG - Intergenic
1097616367 12:61888888-61888910 CACCTTTTGGAATAAGAAATAGG - Intronic
1099366453 12:81771161-81771183 CCCATTTTGCAATACAACATAGG - Intergenic
1100415901 12:94374311-94374333 CAGATGTCGCAATAGGACATGGG - Intronic
1102355192 12:112228139-112228161 CACTTCCTGCAACAGGAGATGGG - Exonic
1102953097 12:117042933-117042955 CAATTTTTGCAATCAGACCTTGG - Intronic
1103221600 12:119250954-119250976 AACTTTTCCCCATAGGACATTGG - Intergenic
1103831054 12:123779409-123779431 CAATTTTTGAAATAGTACAGTGG - Intronic
1107333118 13:39323079-39323101 CACTTTTAGCAAAAGCTCATGGG + Intergenic
1111422455 13:88032108-88032130 AATTCTTTTCAATAGGACATTGG - Intergenic
1113069371 13:106405444-106405466 CATTTTTGTCAATAGGATATAGG + Intergenic
1113249751 13:108439051-108439073 TACAGTTTGCAATAGGAGATAGG + Intergenic
1114990893 14:28287924-28287946 CACTTTTAGTCATAGGACAGGGG - Intergenic
1116347692 14:43815980-43816002 TACTTTTTACAATGGGACATGGG - Intergenic
1116670622 14:47837550-47837572 CACATTTTGAAAGAGGACAGTGG - Intergenic
1116996207 14:51327797-51327819 CACTTTTTACAATAGAAAGTAGG - Intergenic
1120323870 14:83000990-83001012 CAGACTTTGCAGTAGGACATAGG + Intergenic
1125952835 15:43768049-43768071 TTCTTTTTGAAATAGCACATGGG + Intronic
1126333720 15:47563872-47563894 TATTTTTTGCCACAGGACATTGG - Intronic
1126359641 15:47833356-47833378 CACTTATTGCAATGGAACACTGG - Intergenic
1126430724 15:48581070-48581092 CACTTTTTGCAATAGGACATGGG - Intronic
1128852853 15:70978421-70978443 CACTTTTGTCCATATGACATTGG + Intronic
1133488936 16:6248419-6248441 CTCTTTTAGCCATGGGACATGGG + Intronic
1134741328 16:16549681-16549703 CAGTTTTTGCATTAGGAAAATGG - Intergenic
1135062318 16:19281329-19281351 CTCTTTTTGCCTTTGGACATTGG - Intergenic
1137384629 16:48030142-48030164 CCCATTTTGCAATAGGAGGTAGG + Intergenic
1138319165 16:56096659-56096681 CTCTTTTTGCAATAATTCATAGG + Intergenic
1138504055 16:57468316-57468338 CACTTTTAGAAATATGAAATGGG - Intronic
1138728133 16:59163284-59163306 GACCTTTTGGAATATGACATTGG + Intergenic
1146293142 17:31627067-31627089 CACTTTTTGAATTAGGTCAAAGG + Intergenic
1153276705 18:3374581-3374603 CATTTTTTGGAATAAGACAAGGG + Intergenic
1153586224 18:6623548-6623570 CACTTTCTGTAATAGAACACAGG - Intergenic
1157567989 18:48692895-48692917 CACTTTATGCAATAAGGCAGTGG - Intronic
1157586979 18:48807255-48807277 GATTTTTTGCATTAGGACAGTGG - Intronic
1159316590 18:66782547-66782569 CAATATTATCAATAGGACATTGG + Intergenic
1159566172 18:70053044-70053066 CACCTTTTGCTATATGACCTTGG + Intronic
1160124574 18:76159094-76159116 TATTTTTTGAAATAGGCCATGGG + Intergenic
1160368872 18:78354202-78354224 CACTTTTGTCAATAGCAAATTGG - Intergenic
1161933869 19:7359001-7359023 CAATTTTAGCCATAGGACTTTGG - Intronic
1164300617 19:23959126-23959148 CACTCTTTGCAAGATGACACTGG + Intergenic
1168475584 19:56672688-56672710 AATATTTTGGAATAGGACATTGG - Intergenic
925979186 2:9163611-9163633 CATTTTTGGCATTAGGGCATGGG + Intergenic
926382043 2:12300711-12300733 AATTTTATCCAATAGGACATAGG - Intergenic
926793604 2:16600096-16600118 GACTTTGTGCTATATGACATGGG - Intronic
928016404 2:27662104-27662126 GACTTTTTCCAATAGGCAATGGG - Intronic
928507220 2:31966126-31966148 CACTTTTTGAATGAGGAGATTGG - Intronic
930541482 2:52712436-52712458 TACTTTTTGCTAGAGGCCATGGG + Intergenic
931997143 2:67849661-67849683 CACTTTTTGTATTTGTACATTGG - Intergenic
932716604 2:74104815-74104837 CAGTTTCTGCAGTAGGAGATAGG + Exonic
935787034 2:106558721-106558743 CACCTTTTCCAAAAGGACTTAGG - Intergenic
936073310 2:109385404-109385426 GCATTTTTGCAACAGGACATGGG - Intronic
939293817 2:140230594-140230616 AAATTTTTGCAATAGAAAATTGG + Intergenic
940015691 2:149101686-149101708 CACTTTTTTCATTTGGACAAAGG + Intronic
946507937 2:220321593-220321615 GACTTTTACCAAGAGGACATGGG - Intergenic
947474750 2:230433516-230433538 CAATTTCTGCAAAAGGCCATTGG + Intronic
1169128422 20:3148165-3148187 CAATTTTTGCATTAGGTCCTGGG + Exonic
1172612152 20:36260306-36260328 CACTTTTTGGAAGTGGACAGAGG - Intronic
1174099138 20:48113837-48113859 GGCTTTCTGCAATAGGAAATTGG + Intergenic
1174101336 20:48128395-48128417 CATTTTCTACAATAGGAAATTGG - Intergenic
1177689913 21:24492629-24492651 CACTTTTTGAACTGTGACATTGG + Intergenic
1179115991 21:38493238-38493260 CACTTTATACACTAGGATATTGG + Intronic
949405230 3:3706993-3707015 CAGTTTTTCCAATGGAACATAGG + Intronic
951637023 3:24790946-24790968 CATTTTATGGAATAGGAAATGGG + Intergenic
955571885 3:60316133-60316155 CACTTTTTGCATTAGCCCAAAGG + Intronic
957432796 3:80134397-80134419 GGCTTTTTGCAATTTGACATAGG - Intergenic
964327140 3:155559408-155559430 CACTATTTCCAATAAGAAATAGG + Intronic
965020638 3:163225775-163225797 CACTTTATACAATATAACATAGG + Intergenic
966078074 3:175963270-175963292 AACTCTTGGCAATAGGAGATTGG + Intergenic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
969182490 4:5452841-5452863 CAATTTTAGCAGTGGGACATTGG - Intronic
969481013 4:7446882-7446904 CAGTTTCTGCAATGGGAAATGGG - Intronic
971387842 4:26157722-26157744 CACTTTTACCAATAGGACAATGG + Intergenic
971953339 4:33382955-33382977 CATGTTTTGCAATGGGACCTGGG - Intergenic
973072297 4:45878028-45878050 TACTTTTTGCAATCAGACTTTGG + Intergenic
973279473 4:48342965-48342987 CACTTTCATAAATAGGACATGGG + Intronic
977419727 4:96783732-96783754 CAATTTTTTCAAAAGAACATAGG - Intergenic
978362948 4:107950180-107950202 TACTTTTTGAAATAGGAGAAGGG + Intronic
981198529 4:141949394-141949416 AACTTTTTGAAATAGAAAATTGG - Intergenic
989497723 5:42128670-42128692 CACTTTTAGCAAGTGAACATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991174900 5:63676211-63676233 CATCTTTTGCAATAGGACATCGG - Intergenic
993857706 5:93096651-93096673 CAGTTTTTGCAATAGTTTATAGG + Intergenic
994944810 5:106373707-106373729 GAATTTTTGCAATCAGACATTGG + Intergenic
995993103 5:118266456-118266478 CAATATTTGCACTAGAACATCGG + Intergenic
997661004 5:135589631-135589653 CCCTTTTTGCAATACTACATGGG - Intergenic
1003728145 6:8790068-8790090 CACTTTTTGCTGTGTGACATTGG - Intergenic
1004863175 6:19827139-19827161 CATTTTTACCAATAGGACAGAGG + Intergenic
1005641000 6:27796192-27796214 CAATTTTTGCAAAACGACCTTGG + Intergenic
1006713810 6:36100387-36100409 AACATCTTGCAATAGCACATAGG - Intronic
1008024738 6:46622442-46622464 CATTTTTTTTAATGGGACATTGG - Intronic
1008370309 6:50723791-50723813 CACTTTTTGCACTGGGGAATGGG + Intronic
1009842690 6:69096530-69096552 CACTTTTAAAAATAGGACAATGG - Intronic
1010073148 6:71768072-71768094 CACATTTAGAAGTAGGACATGGG + Intergenic
1013440816 6:110165981-110166003 CAGTTTTTGTAAAAGGACAAGGG + Intronic
1018207726 6:161451195-161451217 CATTTGTTGCAATGGGAGATTGG - Intronic
1018611352 6:165650637-165650659 TATTGTTTGAAATAGGACATTGG - Intronic
1020756315 7:12208079-12208101 CACTGTTTGAAATAAGATATGGG + Intergenic
1020967768 7:14893821-14893843 CACATGTTGCTATAGGAGATGGG - Intronic
1021764762 7:23937083-23937105 CACTTTTTTCATAAGCACATAGG - Intergenic
1022164877 7:27748568-27748590 CACATTTTGAAAGATGACATGGG - Exonic
1023774769 7:43594512-43594534 CACAGTTTGAAATAAGACATTGG + Intronic
1025863007 7:65350646-65350668 CATTATTTGCAAAAGGAGATAGG - Intergenic
1028002106 7:85512189-85512211 CACTTTATGCAAAATGACAGAGG - Intergenic
1030827897 7:114184434-114184456 AATTTTTAGCTATAGGACATTGG + Intronic
1035014400 7:155752370-155752392 TATTTTTTGAAATAGGTCATTGG + Intronic
1035968190 8:4218087-4218109 GAATTTTTGCAATCGGACATTGG + Intronic
1039654194 8:39381205-39381227 CAGTTTTTTCAATAGTAAATGGG - Intergenic
1040946357 8:52889244-52889266 CACTTTTTGATAAAGCACATGGG + Intergenic
1041798594 8:61772988-61773010 CAATTTTTGCCATAAGACCTTGG + Intergenic
1041890934 8:62868036-62868058 CACTCTTTGCAAAATGACATGGG - Intronic
1042662124 8:71166214-71166236 CACTTTTTGCAATAGGTTGGGGG + Intergenic
1044712967 8:95074524-95074546 CAGTTTTAGACATAGGACATTGG - Intronic
1046546877 8:115664146-115664168 CACTGTTTGCTATAGAACAATGG + Intronic
1051040222 9:12800307-12800329 CACTTTTTGGATTAGAAAATTGG + Intronic
1055117673 9:72623260-72623282 CACTTTTTGATAGAGGACTTGGG - Intronic
1057066104 9:92053477-92053499 CACTATTTGCAATAGCAAAAAGG + Intronic
1058218246 9:102261774-102261796 CACCTTCTGCAATAGCTCATGGG + Intergenic
1060143827 9:121234077-121234099 CACTTCAGGCAATAGGACAGAGG + Intronic
1060673963 9:125495521-125495543 TACATTTTCCAATAAGACATTGG + Intronic
1186753790 X:12648891-12648913 CACTTTTTACATGAGGAAATGGG - Intronic
1186806540 X:13145814-13145836 CACTTTATGAATGAGGACATGGG - Intergenic
1187701277 X:21966497-21966519 CACTTTTGGGAGTAGGACACTGG + Intronic
1188232348 X:27680123-27680145 GACTTTTTGCAGTAGGATCTAGG - Intronic
1188691410 X:33133453-33133475 TTCTTTTTGTAATAGGAGATGGG - Intronic
1190414142 X:50165152-50165174 GAATTTTTGCAATCGGACCTTGG + Intergenic
1194065498 X:89255712-89255734 CAATTGTTGCAATAGGAATTTGG - Intergenic
1194993846 X:100572388-100572410 CTCTTTTTTCCATAGGAAATTGG + Intergenic
1199008605 X:142731763-142731785 CACTTTATTCATTAGGTCATTGG - Intergenic