ID: 1126430847

View in Genome Browser
Species Human (GRCh38)
Location 15:48582718-48582740
Sequence ATGCAAGTACACCACAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126430847_1126430850 18 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430850 15:48582759-48582781 TCCAGTTCATTAACGTTTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 123
1126430847_1126430849 17 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430849 15:48582758-48582780 TTCCAGTTCATTAACGTTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1126430847_1126430853 20 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430853 15:48582761-48582783 CAGTTCATTAACGTTTCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 84
1126430847_1126430852 19 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430852 15:48582760-48582782 CCAGTTCATTAACGTTTCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 117
1126430847_1126430854 29 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430854 15:48582770-48582792 AACGTTTCTGGGGGAAAGCTAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1126430847_1126430855 30 Left 1126430847 15:48582718-48582740 CCATTTTTGTGGTGTACTTGCAT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 1126430855 15:48582771-48582793 ACGTTTCTGGGGGAAAGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126430847 Original CRISPR ATGCAAGTACACCACAAAAA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903199046 1:21718145-21718167 ATGTAAGTACAGGACACAAAAGG + Intronic
906359520 1:45141291-45141313 ATGCAAGTATACATCAGAAAGGG + Intronic
911350774 1:96751988-96752010 ATGCAGGTAGACAACATAAAAGG - Intronic
912567726 1:110600583-110600605 ATGCACATTCACCACAAAATAGG - Intronic
912852003 1:113134841-113134863 ATGCAAGAACAGCACAATATAGG - Intergenic
913461697 1:119093334-119093356 ATGGAAGTACACTAGAAAAATGG - Intronic
914815907 1:151062220-151062242 ATCCATGTACAACACAAAAAGGG + Intronic
915680589 1:157578527-157578549 TTTCCAGTACACCCCAAAAAGGG - Exonic
918074203 1:181158169-181158191 ATGCAAGTAAAAAAAAAAAAAGG + Intergenic
919993099 1:202722697-202722719 ATAAAAGTACTCCACAAACAGGG + Intergenic
920810012 1:209275741-209275763 TGGCAAGGACACAACAAAAAAGG - Intergenic
920946677 1:210535701-210535723 ATGCAGATACAGCACAAGAAGGG - Intronic
921751504 1:218799674-218799696 ATGGAATTAAACAACAAAAAAGG - Intergenic
1062800446 10:375476-375498 ATGCAAACACACCAACAAAAAGG + Intronic
1065047422 10:21756999-21757021 ATGCTAGTACGCCTCACAAACGG - Intronic
1066339358 10:34514929-34514951 ATACAAGTACAACACTACAACGG + Intronic
1068223434 10:54074083-54074105 ATGAAAGTAGACAATAAAAATGG + Intronic
1068240739 10:54298509-54298531 TTGCAAGGACACCTTAAAAAAGG + Intronic
1071056401 10:81515013-81515035 ATGGAAGCAGACCACAAAAATGG + Intergenic
1071794001 10:88986110-88986132 ATACAAGTAGACTACAGAAATGG + Intronic
1072319470 10:94234543-94234565 ATGTAAGTACAAGTCAAAAAGGG + Intronic
1074632466 10:115273658-115273680 ATGCAGGTACCACCCAAAAAAGG - Intronic
1077547540 11:3181897-3181919 ATACAACTATACCTCAAAAAAGG + Intergenic
1077860864 11:6178586-6178608 ATTCAAGTAACCCACAGAAATGG + Intergenic
1078952411 11:16149105-16149127 GTGCAAGTATACTACACAAATGG + Intronic
1078984894 11:16584237-16584259 ATGGAATCACACCACAAAAAAGG + Intronic
1081208431 11:40302150-40302172 ATGCAAGGAGACCACAAATCTGG - Intronic
1087164819 11:94991269-94991291 AAAAAAGTACAGCACAAAAAAGG - Intronic
1088353861 11:108921190-108921212 AGGCAAATAAACCACAGAAAAGG - Intronic
1090575174 11:128094571-128094593 ATGCAGGCATAACACAAAAAGGG + Intergenic
1093081463 12:14816533-14816555 ATGCATGTACACTACCAAACTGG - Intronic
1094805474 12:34086571-34086593 ATGCAAATAAACTAGAAAAATGG + Intergenic
1095066382 12:37781310-37781332 ATGAATGCACACAACAAAAAGGG - Intergenic
1095517571 12:43023542-43023564 CTCCAAGTATACCTCAAAAATGG - Intergenic
1097937286 12:65267122-65267144 ATGCAAATACAAGACAAAAAGGG + Intergenic
1099197652 12:79637921-79637943 ATGTAAGTACACTTCAAAATGGG - Intronic
1100513499 12:95301624-95301646 ATGCAATCACAACACAAAACAGG - Exonic
1101572835 12:105970922-105970944 ATGCAAGTACAAGACAAATTTGG + Intergenic
1101771255 12:107753475-107753497 AAGGAAGTACACCAAAAAGATGG + Intronic
1103057876 12:117835828-117835850 CTCCAATTACAGCACAAAAAGGG - Intronic
1105984444 13:25551544-25551566 CTGCAAGAACATCTCAAAAATGG - Intronic
1107386032 13:39910416-39910438 ATGCAATTACACCAAGAAATAGG - Intergenic
1107399604 13:40056431-40056453 ATCCAAGAATACAACAAAAAAGG - Intergenic
1109255671 13:60078188-60078210 CTCCAAGTGCAACACAAAAAGGG + Intronic
1109688670 13:65855593-65855615 ATGCAGGTTGACCATAAAAATGG - Intergenic
1110135156 13:72058855-72058877 AGGAAAGTACACCATATAAAAGG - Intergenic
1112408266 13:99139750-99139772 ATGCAAGAACACCAGAATCATGG - Intergenic
1112419730 13:99237154-99237176 ATGGAAGTATACAACAAAGAAGG - Intronic
1112792768 13:103021378-103021400 ATGTGAGTAGACCACAAAGAAGG - Intergenic
1114444951 14:22781289-22781311 AGGCCAGGACACCACAAAATAGG - Intronic
1115562885 14:34599015-34599037 ATGTGAGGACACAACAAAAAGGG + Intronic
1117504102 14:56384348-56384370 AAGAAAGTACACCAAAAAAAAGG - Intergenic
1120110135 14:80544439-80544461 ATGTGAGGACACCTCAAAAAGGG - Intronic
1123899201 15:24859167-24859189 ATGAAAGCACACCAGAACAAAGG - Intronic
1124851769 15:33346721-33346743 AAGTAAGTACACCAGAAAAGGGG + Intronic
1126284273 15:46993605-46993627 ATGCAATTAAAAAACAAAAAGGG - Intergenic
1126347780 15:47715323-47715345 ATGCTAATAAACCACAACAATGG + Intronic
1126430847 15:48582718-48582740 ATGCAAGTACACCACAAAAATGG - Intronic
1127574616 15:60278906-60278928 AACCATGTTCACCACAAAAATGG + Intergenic
1128931819 15:71711496-71711518 ATGCAAGTACAAAAAAAGAAAGG + Intronic
1130324366 15:82867427-82867449 AAGCTAGTACAACAGAAAAAGGG + Intronic
1137306563 16:47206610-47206632 ATGGAATAATACCACAAAAATGG + Intronic
1137628142 16:49922409-49922431 ATGTAAGTACACTACAAAGGTGG + Intergenic
1139001441 16:62515306-62515328 ATACTATGACACCACAAAAAAGG - Intergenic
1145096251 17:20030338-20030360 ATACAAAAATACCACAAAAAGGG - Intronic
1145889536 17:28405283-28405305 CTGCAGCTGCACCACAAAAACGG + Exonic
1145997415 17:29112653-29112675 ATGCAGGAACTCCACAGAAAAGG - Intronic
1146813846 17:35926264-35926286 ATGTAAGAAATCCACAAAAATGG - Intronic
1151365137 17:73612185-73612207 ATGCAAGTACACCACAGTGGTGG + Intronic
1153103008 18:1496129-1496151 ATACAAATAAACCATAAAAACGG - Intergenic
1153466513 18:5394480-5394502 ATGCAAAAACTCCACAAGAATGG + Intronic
1154371745 18:13769539-13769561 ATCCTAATCCACCACAAAAATGG + Intergenic
1155454115 18:25992818-25992840 ATGTAAATACTCCACAATAAAGG + Intergenic
1155885982 18:31208662-31208684 ATAGAAGTAAACTACAAAAAGGG - Intergenic
1157608552 18:48941477-48941499 GAGCAGGTACCCCACAAAAAAGG + Intronic
1159188157 18:65006024-65006046 ATATAAGCACACCACAAATAAGG - Intergenic
1159216953 18:65404755-65404777 AAGCAATTGCAACACAAAAATGG + Intergenic
1162680569 19:12337546-12337568 ATGAAAGTACCCCAGAAAACCGG - Intergenic
927037764 2:19198202-19198224 ATGCAATAAGACCCCAAAAAAGG + Intergenic
927805867 2:26145989-26146011 ATGGAAGTTCACCAACAAAAAGG + Intergenic
930292109 2:49508094-49508116 ATACAAGAACAGCACTAAAAAGG - Intergenic
931016781 2:57991317-57991339 ATGGAACTACACTAAAAAAAAGG + Intronic
931834928 2:66088944-66088966 AGGAAAGGACACGACAAAAAAGG + Intergenic
933097601 2:78206717-78206739 AGCCAAGAACACAACAAAAAAGG + Intergenic
934893936 2:98096081-98096103 ATGCAAGGTCACAACAAAAGAGG - Intronic
935180593 2:100687116-100687138 ATATAAGTATACTACAAAAAAGG + Intergenic
936683218 2:114798793-114798815 ATTTAAGTATAACACAAAAATGG - Intronic
936884692 2:117296328-117296350 ATGCTAGTAATCCACAAACATGG - Intergenic
937934775 2:127234494-127234516 ATGCAAGTACAAGAAAAGAAAGG + Intergenic
940144504 2:150532153-150532175 ATGCAACTACATCAGAAAATTGG - Intronic
940361236 2:152798402-152798424 AGGTAAGTACAGGACAAAAAAGG + Intergenic
941547589 2:166871837-166871859 CTGCACGTAGAACACAAAAACGG + Intergenic
942627528 2:177918012-177918034 ATGCAACTAAAACACAAAAGTGG + Intronic
943648948 2:190436383-190436405 CTGCAACTACACCCCAAAAGGGG - Exonic
946658842 2:221977878-221977900 ATGCAAGTACACAACACTAAAGG - Intergenic
947695509 2:232184076-232184098 ATGCAATTACTCAAGAAAAATGG - Intronic
1171570266 20:26243203-26243225 GTCCAAGTACACCAGAAAAGTGG + Intergenic
1174891084 20:54394973-54394995 AAGTAAGCACACCACATAAAAGG - Intergenic
1175679583 20:60976349-60976371 ATGCATGCTCACCACCAAAACGG + Intergenic
1178249843 21:30991931-30991953 ATTTAAGTACACATCAAAAATGG - Intergenic
1179422039 21:41244278-41244300 ATGTAAGGAGACCACAAAACAGG + Intronic
1181663291 22:24370023-24370045 ACAGAAGTACAACACAAAAAGGG + Intronic
950547073 3:13644646-13644668 ATGCAAAGAAACAACAAAAAAGG - Intergenic
956237283 3:67087741-67087763 ATGCAAATACATATCAAAAAAGG + Intergenic
956259549 3:67323779-67323801 ATGTATATACACCACCAAAAAGG + Intergenic
957109208 3:75930998-75931020 GTCCAAGTACACCAGAAAAGCGG - Intronic
957421803 3:79980706-79980728 ATGCAGGTACCACCCAAAAATGG - Intergenic
959196908 3:103195277-103195299 ATCAGAGAACACCACAAAAACGG + Intergenic
959635668 3:108565073-108565095 ATACAAATACAACACAAGAAAGG + Intronic
962404704 3:135090989-135091011 TATCAAGTACACCACAGAAAGGG + Intronic
962587379 3:136856107-136856129 ATGCAAGTAGATGACAAAACAGG - Intergenic
962841185 3:139234225-139234247 GTGAAAGTACAGCACAAGAAAGG + Intronic
962959630 3:140298803-140298825 ATGCAAATAAACTACAAAATTGG + Intronic
963750577 3:149175145-149175167 TTGCATGTAAACCACACAAAAGG - Intronic
965089596 3:164145753-164145775 ATGCAAATACAGCCCAAAGAAGG - Intergenic
965143432 3:164867885-164867907 ATGAAAATATTCCACAAAAAAGG - Intergenic
965328892 3:167344631-167344653 CTGCAAGAATACCACCAAAAAGG - Intronic
966630017 3:182062057-182062079 ATGCAATCTCACTACAAAAATGG - Intergenic
967616639 3:191576695-191576717 AGGCAAGTATACCACTAAAATGG + Intergenic
973831253 4:54761884-54761906 ATGCAAACACAGCAGAAAAAAGG - Intergenic
973879724 4:55257317-55257339 AGGCTAATACACCATAAAAAAGG + Intergenic
974429568 4:61778597-61778619 ATGTAAGTACAACATAAAAAGGG - Intronic
974748784 4:66109910-66109932 ATACATGGACACCACAAAGATGG - Intergenic
975065083 4:70051526-70051548 TTGCAAGTACAAAATAAAAAAGG - Intronic
975706397 4:77116144-77116166 GTTCAAGTACAATACAAAAAGGG - Intergenic
976005616 4:80425994-80426016 GTGCAAGTACACAAAAGAAAGGG + Intronic
976672700 4:87671849-87671871 AGGCAAGGACACCACAGAAAAGG + Intergenic
976836841 4:89384191-89384213 CTGTAAATACACCAAAAAAAAGG + Intergenic
977916418 4:102599209-102599231 ATGCACATACACCAAGAAAAAGG - Intronic
977925369 4:102694602-102694624 ATGCAAGATCACTTCAAAAATGG + Intronic
979976151 4:127198226-127198248 AGGCAAGGAAACAACAAAAATGG + Intergenic
980064954 4:128176828-128176850 ATGCAGACACAGCACAAAAAGGG + Intronic
981107915 4:140902373-140902395 ATGCAAATACAGCATGAAAAAGG + Intronic
982195411 4:152907138-152907160 ATGCAAGCAATCAACAAAAAAGG - Intronic
982356603 4:154476403-154476425 ACGAAATTACAACACAAAAAGGG + Intronic
983093661 4:163537326-163537348 AAGAATGTACACCACAAAAAAGG + Intronic
984449538 4:179881882-179881904 ATGTAAGGACACAACAAGAAGGG + Intergenic
984490189 4:180424509-180424531 ATGCAAACACACCACACACATGG - Intergenic
984523905 4:180833494-180833516 ATGGAACTACACAACACAAAGGG - Intergenic
985185703 4:187313138-187313160 AAGCAACTAAACCACAAAATTGG + Intergenic
985471835 5:51400-51422 AACCAAATACACAACAAAAATGG - Intergenic
985947454 5:3197529-3197551 GTGCACGTACCCCACACAAAGGG - Intergenic
988590597 5:32545528-32545550 ATGCAATTACACCATTATAATGG + Intronic
991234213 5:64375547-64375569 ATGCAAGTACCACTCAAAAGTGG + Intergenic
993268093 5:85754239-85754261 ATGCAAGTACGCCTGAATAAGGG - Intergenic
993846529 5:92951395-92951417 ATGCAAGCACAAAACAAAAGGGG - Intergenic
996400464 5:123056407-123056429 AGGAAAGGACACAACAAAAAAGG + Intergenic
996566823 5:124888691-124888713 ATGAAAGCACCCCCCAAAAAAGG - Intergenic
997628302 5:135346619-135346641 ATGCAAATACAAAATAAAAATGG + Intronic
998949438 5:147377313-147377335 ATGGAAGGAAACCACAAAACAGG - Intronic
998978357 5:147673082-147673104 ATGCAAGAAGACCACATAGAAGG + Intronic
1011222129 6:85065694-85065716 TTGCAAAAACACCACAAAAAAGG + Intergenic
1012528446 6:100205322-100205344 ATTCCCGTACACCACGAAAATGG + Intergenic
1014128796 6:117807736-117807758 ATGCAAGTAAACTAGAAAATAGG - Intergenic
1014688331 6:124531506-124531528 AGGCAAGAACACTACAAAAAAGG - Intronic
1015097241 6:129430397-129430419 AGGCAAGGACAGCATAAAAATGG - Intronic
1015489240 6:133806693-133806715 AAGCAAGTACACCAGGCAAATGG + Intergenic
1016835331 6:148471031-148471053 TTTCAACTACACCACAAATAGGG - Intronic
1018049225 6:159993899-159993921 AGGCAAGGACACAACAAAAAAGG - Intronic
1019127899 6:169853381-169853403 ATGCCAACACACCACACAAATGG - Intergenic
1019791837 7:3019258-3019280 ATGCAAAGACAGCACAAAACAGG - Intronic
1020820919 7:12966436-12966458 AGAAAAGTACTCCACAAAAATGG - Intergenic
1021395131 7:20138503-20138525 AAGCAAAATCACCACAAAAAAGG + Exonic
1022635477 7:32130334-32130356 ATGAAAGTACACTACAAATTAGG + Intronic
1024876022 7:54024675-54024697 ATGCAAATGGACAACAAAAAAGG - Intergenic
1025587832 7:62815034-62815056 ATGAATGTACACATCAAAAATGG + Intergenic
1027887781 7:83931514-83931536 AAGCAAGCACACCACAGAAAAGG + Intergenic
1028141785 7:87282360-87282382 ATGCAGGTACAACCCAAAAGTGG + Intergenic
1029867211 7:103646799-103646821 AGGCAAGGACACAACAAAAAAGG + Intronic
1032967067 7:137110209-137110231 ATGCAAGGACACTAAAGAAATGG + Intergenic
1033186732 7:139232621-139232643 ATGAACGAACTCCACAAAAAAGG - Intronic
1033556717 7:142494618-142494640 ATGCTGGTACACCACAAATTGGG + Intergenic
1033930353 7:146511736-146511758 ATGCAAGGACAACACAAAAAAGG - Intronic
1036759890 8:11500871-11500893 ATCCAATTGCACCACAGAAATGG - Intronic
1037790445 8:21934926-21934948 GTGAAAGTACACCACAAAGCAGG + Intronic
1038989209 8:32847414-32847436 ATGAAAGAGCAACACAAAAAGGG + Intergenic
1039180226 8:34858682-34858704 ATGAAAGTGCACCACAAAGCGGG + Intergenic
1041057091 8:53997568-53997590 AAGCAGGTACACCTCAAATAAGG + Intronic
1041350627 8:56944741-56944763 ATGCAAGTAAACCCCTAAATTGG + Intergenic
1042098055 8:65240713-65240735 ATGAAAGGAGACCACAAAAGAGG + Intergenic
1043040979 8:75261501-75261523 ATGCAAATAGACACCAAAAATGG + Intergenic
1043874900 8:85474911-85474933 ATCCAAGTACAGCACGAAGAGGG + Intronic
1044011256 8:86996914-86996936 ATGTAAGGACACAACCAAAAAGG - Intronic
1046038480 8:108873572-108873594 ATGTAAATTCCCCACAAAAACGG - Intergenic
1047801316 8:128313579-128313601 ATTCAAGGTGACCACAAAAAGGG + Intergenic
1047831813 8:128640927-128640949 GTTCAAGTAACCCACAAAAAGGG - Intergenic
1048082252 8:131141189-131141211 ATGCAATGACAACAGAAAAAAGG + Intergenic
1048728019 8:137408745-137408767 CTCCAAGGATACCACAAAAATGG + Intergenic
1050211584 9:3264504-3264526 ATTAATGTAAACCACAAAAATGG - Intronic
1051673042 9:19531485-19531507 ATGTAAGTAAACCACAACATGGG - Intronic
1051842182 9:21411259-21411281 ATGCAAGTTAACAACAAATAAGG - Intronic
1052683868 9:31729884-31729906 AGACAAGAACACAACAAAAAAGG - Intergenic
1054890991 9:70251672-70251694 ATGCATGTAAAATACAAAAATGG + Intergenic
1057643171 9:96847852-96847874 AGGAAAGGACACAACAAAAAAGG + Intronic
1186314576 X:8355385-8355407 ATGCAAATAGACCACCAGAAGGG + Intergenic
1187229820 X:17410183-17410205 ATGCCAGAACACTAAAAAAATGG + Intronic
1188299687 X:28492901-28492923 ATGCATGTGCACCAAAAAACAGG - Intergenic
1191177929 X:57525660-57525682 AGGCAAGGACACAACCAAAAAGG - Intergenic
1191818849 X:65280083-65280105 AAGCAAGGACACAACAAAAAAGG + Intergenic
1192238280 X:69310014-69310036 ATGAAAGTCCACCCCAGAAAAGG - Intergenic
1192733279 X:73822678-73822700 ATGCAACAAAAACACAAAAATGG - Intergenic
1193024378 X:76829411-76829433 ATTCAAGAGGACCACAAAAATGG - Intergenic
1195558352 X:106253481-106253503 ATTGAAGGACACCAAAAAAATGG - Intergenic
1195595019 X:106678549-106678571 ATGAAAGTACACTTCACAAATGG - Exonic
1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG + Intronic
1200289407 X:154857514-154857536 ATGCAGGTACTACACAAAAGTGG + Intronic
1200361078 X:155607147-155607169 TGGCAAGGACACAACAAAAAAGG + Intronic
1200378003 X:155804481-155804503 ATACAAATATACCACAAATATGG + Intergenic
1202033264 Y:20601853-20601875 AGGCAAGGACACAACAACAAAGG - Intergenic
1202089829 Y:21177991-21178013 TTGCAAGGACACCTTAAAAAAGG - Intergenic
1202263571 Y:22994881-22994903 AAGCAAATACACCACAAAGATGG + Intronic
1202416561 Y:24628622-24628644 AAGCAAATACACCACAAAGATGG + Intronic
1202454226 Y:25041464-25041486 AAGCAAATACACCACAAAGATGG - Intronic