ID: 1126431314

View in Genome Browser
Species Human (GRCh38)
Location 15:48588004-48588026
Sequence CTGGAGAAGCAGCAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 0, 2: 15, 3: 92, 4: 820}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126431311_1126431314 15 Left 1126431311 15:48587966-48587988 CCTCTCTTTGATTTTCTAAGATG 0: 1
1: 0
2: 3
3: 33
4: 387
Right 1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG 0: 1
1: 0
2: 15
3: 92
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126431314 Original CRISPR CTGGAGAAGCAGCAGAAGGA AGG Intronic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
900719561 1:4166569-4166591 CTGGAGAAGGAGCAGAGTGGAGG - Intergenic
900831233 1:4967161-4967183 CTGGAGGAGCAGCAGAGGCCGGG - Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
900936893 1:5771711-5771733 CTGGTAAAGCAGCAGAAGCTTGG - Intergenic
900967259 1:5967312-5967334 CTGGAGAAGCGGGTGCAGGAGGG + Exonic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901420898 1:9150421-9150443 CGGGAGAAGCAGCAGAGGCTGGG + Intergenic
901463263 1:9404344-9404366 CAGGAGAACCGGGAGAAGGAAGG + Intergenic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902280709 1:15372185-15372207 CTGGAGCAGAGCCAGAAGGAAGG + Intronic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902726686 1:18340884-18340906 AAGGAGAAGAAGCAGAAGCAGGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903604189 1:24562921-24562943 CTGGAGAAAGGGCATAAGGAGGG - Intronic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905264837 1:36744467-36744489 CGGCAGAAGCAGCAGAAAGTTGG + Intergenic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906192188 1:43905538-43905560 CAGGAATAGGAGCAGAAGGAGGG - Intronic
906223790 1:44104376-44104398 CTGCAGCAGCAGCAGACGGCTGG - Intergenic
906234906 1:44200369-44200391 CTGGAGATGAAGGAGAAAGAAGG - Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906669691 1:47645469-47645491 CTGGAGAGGCAAGAGAAGGATGG + Intergenic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
907327976 1:53653235-53653257 CTGGTAAAGAAGCAGATGGATGG + Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908267634 1:62394883-62394905 CTGCAGAACCACCAGAGGGAAGG - Intergenic
908554558 1:65244884-65244906 ATATAGAAGGAGCAGAAGGAGGG + Intergenic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909111879 1:71489369-71489391 CTGGTGAAGCAGCCTAAGAATGG - Intronic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912933677 1:113985019-113985041 CTGGAGGAGGAGGAAAAGGAGGG - Intergenic
913210389 1:116577447-116577469 CTTGAAACGCACCAGAAGGATGG + Exonic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915838357 1:159196218-159196240 CATGAGAAGTAGGAGAAGGAAGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916143781 1:161722639-161722661 CTGCAGCAGCTGCAGAAGGATGG - Exonic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916686571 1:167152563-167152585 CTGGTGAAGCAGCAAAGGGATGG - Intergenic
917880648 1:179332544-179332566 AGGGAGAAGCGGCAGAAGGGAGG - Intronic
917906236 1:179589138-179589160 CCAGAAAAGCAGCAGCAGGAGGG + Intergenic
918056394 1:181025320-181025342 CTGGAGTAGAAGGAAAAGGATGG + Intergenic
918140562 1:181716193-181716215 TTTGAGAAGCACCACAAGGAGGG + Intronic
918725575 1:187917612-187917634 TAGGAGGAGGAGCAGAAGGATGG - Intergenic
918860984 1:189826064-189826086 TTGGTGAAGCAGCAGCACGATGG - Intergenic
919773410 1:201177411-201177433 CTGGAATGGCAGCAGATGGAGGG + Intergenic
920202865 1:204270820-204270842 CTGGTGAAGGGGCAGAAGGTGGG - Intronic
920295658 1:204954641-204954663 CTTGAGAGGCAGGAGAAGGGAGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921336971 1:214097910-214097932 CTGGAGAAGTTGCAGAAAAAAGG + Intergenic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922251841 1:223856492-223856514 CTGGAGTGGGAGCAGAAGGGAGG + Intergenic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923852511 1:237812844-237812866 CGAGAAAAGCAGCAAAAGGAAGG - Intronic
924237026 1:242007686-242007708 CTGGAGAAGGGGCATAAGTATGG - Intergenic
924432664 1:244010007-244010029 CTGGAGAAACTTCAAAAGGAAGG - Intergenic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063218115 10:3942371-3942393 GTGGAGAGGCAGCAGCAGGCTGG - Intergenic
1063330683 10:5155932-5155954 ATGGAGAAGAGGCAGAATGAAGG - Intergenic
1063818351 10:9804545-9804567 GTGGAAAACCATCAGAAGGAAGG + Intergenic
1064595512 10:16940897-16940919 CTGGAGAGGCAGCAAAATTATGG + Intronic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065841276 10:29703512-29703534 CTGGAGAACCAGCTGACAGAAGG - Intronic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066473068 10:35718178-35718200 CTGGAGAGGCCGCAGAACCATGG + Intergenic
1066476421 10:35751401-35751423 CAGGAGATACAGCAGAATGAGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067538506 10:47135035-47135057 ATGGGGAAGCAGCAGAAGTGGGG + Intergenic
1069301479 10:66913687-66913709 CATGAGAAGCACCAGAAGTAGGG + Intronic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070170140 10:73926718-73926740 CTGGAGAACCACCAAAAAGAGGG - Intergenic
1070175427 10:73965710-73965732 AAGGAGAAGAAGCACAAGGACGG + Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070706324 10:78641751-78641773 CTTGTGAAGCAGGAGAAAGATGG - Intergenic
1070837024 10:79454482-79454504 CTGCTGAAGCAACTGAAGGAGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1072395129 10:95031780-95031802 CTGGAAAAGCATCACAAGCAAGG + Intergenic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075315890 10:121453284-121453306 GTCGAAAAGCAGCAGAAAGATGG - Intergenic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1076016029 10:127028182-127028204 CGGGAGAAGCAGGGGCAGGAAGG + Intronic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076516297 10:131046641-131046663 CTGGGGAAGAAGGAGAAGGTAGG + Intergenic
1076662356 10:132064299-132064321 CTGGGGAAACAACACAAGGATGG - Intergenic
1076838723 10:133034065-133034087 CTGAAGAAGCCGCAAAAGAATGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076946827 10:133657297-133657319 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077847301 11:6039527-6039549 CTACAGAACCAGGAGAAGGAAGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078086324 11:8234813-8234835 CTGGAGTAGTAGCAGAGTGAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1080051125 11:27860117-27860139 CGGGAGAAGCAGTTGAAGGGGGG + Intergenic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1081348000 11:42014030-42014052 TTGGAGAAGCAGCAGAAATGAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082168985 11:48978996-48979018 TTGGAGAGGCTGCAAAAGGAGGG - Intergenic
1082768723 11:57188931-57188953 CTGGATAAGCCCTAGAAGGAAGG + Exonic
1082771053 11:57207596-57207618 GTAGAGAAGTAGCAGGAGGAAGG - Intergenic
1082820648 11:57542637-57542659 CCAGAGATGGAGCAGAAGGAAGG + Exonic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083622528 11:64056218-64056240 CTGGAGGAGCTGCAGCAGGTGGG + Intronic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083814974 11:65127715-65127737 CTTGAGAAGCTGCAGAGGAAAGG + Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1088455777 11:110031332-110031354 CTGGTGAATCACCTGAAGGAGGG - Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1088919662 11:114251750-114251772 GAGGAGGAGGAGCAGAAGGAGGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091929183 12:4381106-4381128 TTGGAGAAGCAGCCTAGGGAAGG - Intergenic
1091933692 12:4417667-4417689 CGGGAGGAGGAGCAGCAGGAGGG - Intergenic
1092111454 12:5967708-5967730 CAGGAGGAGCAGCAGAGCGATGG - Intronic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092503795 12:9074272-9074294 GTGGAGCACCAGCAGAATGAAGG - Intronic
1092993541 12:13926499-13926521 CTGGAGAAACTGGGGAAGGAGGG - Intronic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1093945701 12:25106966-25106988 CTGGAGAAGAAACAGTAGAAAGG + Exonic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095726730 12:45461939-45461961 TTAGAAAAGCAGCAAAAGGAAGG - Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1097173806 12:57131333-57131355 CTGGAGAGGTTGCAGAAAGATGG + Intronic
1097229193 12:57498813-57498835 CTGAAGGAGCAGCTGAGGGAGGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097775780 12:63643636-63643658 TTGGTTCAGCAGCAGAAGGATGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099265724 12:80445005-80445027 CTGAAGAAACAGCAGAATGCAGG - Intronic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100090359 12:90961051-90961073 CTGGAAAATCAGCAAAAAGATGG - Intergenic
1100796354 12:98185839-98185861 TTGGGTAGGCAGCAGAAGGAAGG - Intergenic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1101242622 12:102853309-102853331 CTCTAGAAGCAGGAGAAGTAGGG - Intronic
1101358890 12:104007959-104007981 CTGGAGAAGCCTCAGAATCATGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102547644 12:113668123-113668145 CTGGAGGAGGAGGTGAAGGAGGG - Intergenic
1102640312 12:114361238-114361260 CTGGAGAATCAGCAAAGGAATGG + Intronic
1102735689 12:115157322-115157344 CTGGAGATGTAGCAAAAGAAAGG + Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1103267780 12:119645529-119645551 CTGGAGAAGCCACAGAAAGAAGG + Intergenic
1103410158 12:120705742-120705764 CTGGGGAGGCAGCAGAAAGCAGG + Intergenic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1104363756 12:128157709-128157731 CTGGAGTAGAAGCAAAGGGAAGG - Intergenic
1104884070 12:132094627-132094649 CAGGACAAGCAGCAGAGGCATGG - Intronic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1105868758 13:24485284-24485306 CTGGAAAAGAAGCACAATGAGGG - Intronic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106559730 13:30837912-30837934 TTGGAGATGGAGCAGTAGGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106978630 13:35251898-35251920 CTGGGGTGGGAGCAGAAGGAAGG - Intronic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108095232 13:46894173-46894195 CTGGAGGAGCAGCCTAGGGAGGG + Intronic
1108156021 13:47585253-47585275 CTGGAGAAGCCTCAGAATCATGG + Intergenic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1110031374 13:70618757-70618779 CTGGAGAAGCTGCAGAGAAAAGG + Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1112029913 13:95447621-95447643 CTGGTGAAGGAGCTGAAGCAGGG - Intronic
1112685328 13:101818424-101818446 CTGGAGAATTAGCAGAAGCTAGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112968133 13:105224778-105224800 CTGGAGAGGCCTCAGAATGATGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113487838 13:110668036-110668058 CTGGACCAGCTGCAGAAGCATGG + Intronic
1114402954 14:22426635-22426657 TTTGACAAGCATCAGAAGGAGGG - Intergenic
1114567185 14:23641357-23641379 CTGGAGTCGCTGGAGAAGGATGG - Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116330929 14:43596910-43596932 CTGGAAAGGCAGCAGAGGGCTGG + Intergenic
1117946723 14:61033996-61034018 CTGTAAAATCAGCAAAAGGAAGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119784108 14:77299760-77299782 CTGGAGAGGTAGCAGAGGGCTGG - Intronic
1120049770 14:79851769-79851791 CTGTAGAAGAAACAGAGGGAAGG - Intronic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121517121 14:94560159-94560181 GTGGAGAAGCAGCAGATGCTGGG + Intergenic
1121845506 14:97169032-97169054 GAGGACAGGCAGCAGAAGGAGGG - Intergenic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122273441 14:100578666-100578688 CTAGAGAAGAAGCAGGAGGTTGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122919989 14:104876048-104876070 CTGGGGCAGCAGCAGAGGGTGGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122971369 14:105153568-105153590 CTGGAGAGGCGGCGGCAGGAAGG + Intronic
1123133990 14:106010855-106010877 CTTGGGGAGCAGCAGAAGGTGGG + Intergenic
1202920904 14_KI270723v1_random:29852-29874 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1202924011 14_KI270724v1_random:7729-7751 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1124012420 15:25849488-25849510 TTGGAGAAGGCGTAGAAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125180578 15:36878261-36878283 CTGGAGAAGCAGCGTAGGGCGGG - Intergenic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125772229 15:42176453-42176475 CTGGAGGAGAGGCAGAGGGATGG + Intronic
1125929300 15:43589127-43589149 CTGGAGAAGGGGTAGAAGGGAGG + Intronic
1125942467 15:43688959-43688981 CTGGAGAAGGGGTAGAAGGGAGG + Intergenic
1126098265 15:45104371-45104393 CTCGGGCAGCAGCAGAGGGAGGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126848309 15:52782674-52782696 CTAGGGTAGCAACAGAAGGAAGG - Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127743089 15:61933213-61933235 CTGCAGAACCAGCAGAATGATGG + Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128121454 15:65150853-65150875 CTGGAGTTGAAGAAGAAGGATGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128781785 15:70363095-70363117 CTGGAGAAGGAGGAGAGGAAGGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129688523 15:77700080-77700102 CTGGGGAACCAGCAGAGGGGAGG + Intronic
1129819630 15:78589575-78589597 CTGGAGTAGATGCAGAAGAAGGG + Intronic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131269083 15:90935553-90935575 GTGGAGCAGCTGCGGAAGGAGGG + Exonic
1131427873 15:92361755-92361777 TTGGGGAATCATCAGAAGGAGGG - Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132109821 15:99094492-99094514 CTAGGGCAGAAGCAGAAGGAGGG + Intergenic
1132122212 15:99185828-99185850 CTGGAGAGCCAACACAAGGAAGG - Intronic
1132267180 15:100484454-100484476 CTGCCGGAGCAGCAGAGGGAGGG - Intronic
1132289009 15:100686315-100686337 CTGGAGAAGGAGCAGATCCAGGG - Intergenic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132803762 16:1766423-1766445 CTGGGGCAGGAGCAGAGGGAAGG + Intronic
1133077224 16:3289223-3289245 CTGGAGAAGCATCAGGATAAAGG - Intronic
1133306640 16:4813707-4813729 CTGGAGAGCCAGCCCAAGGAAGG + Intronic
1134029055 16:10977382-10977404 CTGGAGAACCAGGACAAGGTGGG + Exonic
1134034639 16:11020444-11020466 CTGGAGAAGCAGGGAAAGAAAGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135199837 16:20427831-20427853 CTGCACAAGCAGCCGAAAGATGG - Exonic
1135218867 16:20595779-20595801 CTGCACAAGCAGCCGAAAGATGG + Intergenic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135985553 16:27181212-27181234 CTGGAGAGGCAGCAGAGAGCAGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136477807 16:30524416-30524438 GTGGAGAAGCCGCAGGAGAATGG - Exonic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1137353974 16:47740294-47740316 TGGGAGAAATAGCAGAAGGAAGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139656450 16:68389935-68389957 TTAGAGAAGAAACAGAAGGATGG + Intronic
1139659860 16:68413276-68413298 CTGGAGCAGAGGCAGAAGAAGGG - Intronic
1140016626 16:71192996-71193018 CTCAAGAATCTGCAGAAGGAAGG + Intronic
1140484004 16:75279701-75279723 TTGGAGAAGCAGCTGAAGTCAGG - Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141278933 16:82613269-82613291 CAGGAGAAGCAGCAGAAATGAGG - Intergenic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1141602609 16:85135582-85135604 CTGGAGAAACTTCAGAAGGAAGG - Intergenic
1141898404 16:86973660-86973682 ACAGAGAAGCAGCAGAAGGGTGG + Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142173463 16:88634550-88634572 CTGGAAAAGCGGCGGCAGGAAGG - Intergenic
1142243291 16:88956810-88956832 CTGGAGAAGGCACAGAGGGAGGG - Intronic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1142642480 17:1292447-1292469 CTCGAGCAGCACCAGAAGGAGGG - Intronic
1142694369 17:1625258-1625280 CTGGTGAGGTGGCAGAAGGAAGG - Intronic
1142911697 17:3098605-3098627 CTGGAGAAGCAGCAGCACGCTGG - Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143046700 17:4086604-4086626 CTGGAGTAGCTGCAGAAGCAGGG + Exonic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143587257 17:7856448-7856470 CTGGAGCAGCAGCCGTGGGAGGG + Intergenic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1144058042 17:11558981-11559003 ATGGGGAGGCAGCTGAAGGAAGG - Exonic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145881849 17:28357782-28357804 CTGGGGAAGAAGCACAAGGGCGG + Exonic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146613529 17:34331920-34331942 CTGGATAAACTGCTGAAGGATGG - Intergenic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146830507 17:36065073-36065095 TAGGAGAAGCAGCAGATGCATGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147119416 17:38327140-38327162 GTGGAGGAGCAGCAGAGGAAGGG - Exonic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147596904 17:41723465-41723487 TTGGCCAGGCAGCAGAAGGAGGG + Exonic
1148015639 17:44520088-44520110 CTGGAGAATCTTCAGAGGGAAGG - Intergenic
1148047677 17:44753934-44753956 CTAGAAGAGCAGCAGAAGGAAGG + Intergenic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1148670258 17:49404905-49404927 CTGGGGTGGGAGCAGAAGGAAGG + Exonic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150490201 17:65569052-65569074 CTGAAGAAGTGGCAGAGGGAGGG - Intronic
1150511592 17:65758148-65758170 TTGCAGAAGTAGCAGAAGAAAGG - Intronic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150810282 17:68350838-68350860 CTGGAGAAGAGATAGAAGGAAGG + Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151937513 17:77271802-77271824 CTGGGGAAGCGGCAGAGGAAAGG + Intergenic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152232856 17:79123509-79123531 CCGGAGATTCAGCAGCAGGAGGG - Intronic
1152240409 17:79157857-79157879 CTGGAGACGCAGCACAGGGGAGG + Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152286014 17:79413777-79413799 CTGGCCAGGCCGCAGAAGGATGG - Intronic
1152334175 17:79690870-79690892 GGAGAGAAGGAGCAGAAGGAGGG + Intergenic
1152375221 17:79915416-79915438 GGGGAGAGGCAGCACAAGGAGGG + Intergenic
1152585184 17:81186121-81186143 CTGGAGCAGAAGCAGCGGGAAGG + Intergenic
1203170756 17_GL000205v2_random:146290-146312 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1153583517 18:6598825-6598847 CTGGAGAGACAGCGGAAGGCAGG - Intergenic
1153749753 18:8216900-8216922 CTGGAGAATCTGTTGAAGGAGGG + Intronic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1154507915 18:15060855-15060877 CTTGAACAGCAGTAGAAGGATGG + Intergenic
1155425222 18:25700022-25700044 CTGGAGAAGCTGGAGAAGCCAGG - Intergenic
1155561248 18:27079781-27079803 CTCTAGAAGCTGCAGAAGGCCGG - Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157741534 18:50097593-50097615 CTGCAGCAGCAGCAGAATGTAGG + Intronic
1157881081 18:51321637-51321659 CTGTGGAGGCAGCAGAAGGTGGG + Intergenic
1157949586 18:52019720-52019742 CTGGAGAAGGAACTGAAGGTTGG - Intergenic
1158172732 18:54617650-54617672 CTGGAAAGTCAGCAGAGGGAGGG - Intergenic
1158423121 18:57313477-57313499 GGGGAGAAGGAGGAGAAGGAAGG + Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161132884 19:2602039-2602061 CTGGAGAAGCACTAGAAGCCGGG + Intronic
1161810089 19:6466559-6466581 CGGGAGAAGCGGCAGACGGAGGG + Exonic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162917268 19:13881232-13881254 CTTGGGCAGGAGCAGAAGGATGG + Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163373231 19:16914303-16914325 CTCGATAATGAGCAGAAGGAGGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163658089 19:18559566-18559588 CTGGAGAAACATCAGAAGTCAGG + Exonic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1164037577 19:21467884-21467906 CTGGGGAAGCAGCATAGGGCAGG - Intronic
1164744938 19:30604894-30604916 CTGGAGAAGGGACAGCAGGAAGG + Intronic
1165004767 19:32795838-32795860 CTGGAGCAGGAGCAGGAGCAGGG + Intronic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165396940 19:35569607-35569629 CTGGAGAGGCGGGAGAAGCAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166783292 19:45353237-45353259 CTGGAGAAGTACCAGGAGGTGGG - Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167793352 19:51693772-51693794 CTGGGGAAGGTGCAGAGGGAGGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168241583 19:55091645-55091667 CTGGAGGAGGAGCTGAAGGTGGG - Exonic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925541425 2:4971889-4971911 CTCGTGAACCAGGAGAAGGAAGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926591866 2:14749124-14749146 TTGGACAAGCAGGAGAAGGTTGG + Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927177700 2:20422055-20422077 CGGGAGCAGCACTAGAAGGAAGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927715907 2:25352723-25352745 CTGGAGAAGCAGCAGAAATGGGG - Intergenic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928278349 2:29921820-29921842 CTGGAGAGGGAACAGAGGGAGGG - Intergenic
928498925 2:31866206-31866228 CTGGTGAAGGGGCAGAATGATGG + Exonic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930329399 2:49963410-49963432 CAAGAGAATGAGCAGAAGGAAGG + Intronic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930468473 2:51783167-51783189 CTGGAGCAGCTGGAGAGGGAGGG - Intergenic
930811224 2:55543680-55543702 CTGTACAAACAGCAGAAGCATGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931771365 2:65500829-65500851 ACGGAGAAGCAGCAGATGAAAGG - Intergenic
932666351 2:73701789-73701811 CTGGAGAAGCACCAAAGGGTTGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
934166666 2:89300163-89300185 ATGGGGAATCAGCAGAAGTACGG - Intergenic
934200615 2:89882294-89882316 ATGGGGAATCAGCAGAAGTACGG + Intergenic
934993833 2:98939382-98939404 CTGGAGAAGGATCAGAGGGATGG - Intergenic
935091803 2:99901739-99901761 CTGGAGAAAGAGCAGATGCAGGG - Intronic
935092014 2:99904693-99904715 CTGGGGAAGCGGCAAAGGGAAGG - Intronic
935122397 2:100194221-100194243 CTGGAGCTGAAGCAGAAGTATGG + Intergenic
935588854 2:104826538-104826560 CAGTAGATGCAGCAGAAGCAAGG - Intergenic
936025948 2:109031346-109031368 CTGCAGAAGGAGCGGAAGGGAGG + Intergenic
936160053 2:110078058-110078080 CTGGAGAAGCAGCAGGATTTGGG - Intergenic
936184611 2:110293295-110293317 CTGGAGAAGCAGCAGGATTTGGG + Intergenic
936243175 2:110805706-110805728 CTGGAGAAGCAGCTAAGGGTTGG + Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936942849 2:117903471-117903493 CTGTAGAAGCAGCAGAGCCAAGG + Intergenic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937449674 2:121991978-121992000 GTGGGGGAGCAGCAGATGGAGGG - Intergenic
937553281 2:123121802-123121824 CTGGTGAAGCAGCAGAGAAAAGG + Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
939158384 2:138554425-138554447 CTGGAGATTCTGTAGAAGGAAGG - Intronic
939739190 2:145885255-145885277 CTGAGGAAGCAGCAGATAGATGG - Intergenic
940124773 2:150311160-150311182 ATGGAGAACTAGCAGAAGCAGGG + Intergenic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
940815211 2:158290150-158290172 CAGGAGAGGGAGCTGAAGGATGG + Intronic
941463288 2:165795159-165795181 TTGTTGCAGCAGCAGAAGGAAGG - Intergenic
941703063 2:168626357-168626379 CTACAGAGGCAGCAGAAGCAGGG - Intronic
941708215 2:168682585-168682607 CTGGAGAAAGAGCAGAAATATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941990822 2:171555362-171555384 CTGGGGAGGGAGCAGAAGGCAGG - Exonic
942043625 2:172086631-172086653 CTGGAGGGACAGCAGAAGTAGGG - Intronic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
943536874 2:189163142-189163164 GTGGAGAAGGAGCAGAATAATGG - Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
944915590 2:204357413-204357435 GTGCAGAAGCAACAGACGGATGG + Intergenic
945897363 2:215498723-215498745 ATCGACAAGCAGCAGAAGGCAGG - Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946016143 2:216605671-216605693 CTGGAGGGCCACCAGAAGGAGGG + Intergenic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946372833 2:219290919-219290941 CTTGAGATGCAGCAGAAAGGGGG + Intronic
946374081 2:219297735-219297757 CTGGAGAAGCCCCAGTGGGAGGG - Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947395927 2:229686623-229686645 ATGGAGGAGCAGCAGAAGACAGG - Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948356841 2:237384847-237384869 CTGGAGAAGCAGCTGCTGTAGGG - Intronic
949047705 2:241879659-241879681 CAGGAGAGGCAGCAGAGGGCTGG + Intergenic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169278994 20:4251230-4251252 GTGGAGAGCCAGCAGAAGGCTGG + Intergenic
1169291440 20:4356627-4356649 CTGGAGGTGAAGCAGAAGGAAGG - Intergenic
1170615399 20:17945009-17945031 CTTGAGCACCAGCAGAAGGTTGG - Intronic
1170876055 20:20251270-20251292 CTGAAGTAGAAGCAGAAGAAAGG + Intronic
1170945763 20:20889737-20889759 GTGGAGGAGCAGCAGAGGGCAGG - Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171353154 20:24520984-24521006 CTGCAGAGGCTGCAGAAGGGAGG - Intronic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1172065795 20:32219390-32219412 ATGGTGAAGGAGCAGAAAGAAGG + Intronic
1172413085 20:34740999-34741021 CTGGAGAAGACGTACAAGGAGGG + Exonic
1172876779 20:38169291-38169313 CTGGAGAAAGAATAGAAGGAAGG + Intergenic
1173053942 20:39593034-39593056 ATGGAGTAGCTGCAGAATGAAGG + Intergenic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173667748 20:44774842-44774864 ATGGAGAGGCAGCAGACGCAAGG - Intronic
1175682827 20:61003593-61003615 ATTGAGAAGTGGCAGAAGGAGGG - Intergenic
1175809996 20:61852731-61852753 CTGGAAAAGCAGCAGAGACAGGG - Intronic
1176034140 20:63028206-63028228 CTGATGAAGCTGCAGAAAGAAGG - Intergenic
1176326743 21:5508121-5508143 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1176330967 21:5548090-5548112 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1176396790 21:6272861-6272883 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1176401014 21:6312830-6312852 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1176436143 21:6676274-6676296 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1176440367 21:6716243-6716265 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1176460405 21:7003344-7003366 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1176464629 21:7043312-7043334 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1176483966 21:7385122-7385144 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1176488190 21:7425091-7425113 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177989344 21:28019153-28019175 CTTGAACAGCAGGAGAAGGATGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1178936064 21:36862814-36862836 CTGGAGACTCACCAAAAGGAAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181570216 22:23764301-23764323 CTGGAGGAGGACCTGAAGGAAGG + Exonic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181786029 22:25227931-25227953 ATGGACCAGCAGCCGAAGGACGG + Exonic
1182016633 22:27045879-27045901 ATGGAGAGGCCGCAGAATGAGGG - Intergenic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182558466 22:31141503-31141525 CTGGAGAAGCAGCAGGCTAATGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185118593 22:48952270-48952292 CTGGGCAGGCAGCAGAAGGCTGG - Intergenic
949397203 3:3627321-3627343 CTGCAGCAACAGCAGAGGGAGGG - Intergenic
949850859 3:8418923-8418945 CTGGAGAAGGAGCAAAAGAGTGG - Intergenic
950020943 3:9787270-9787292 CTGCTGGAGGAGCAGAAGGATGG - Exonic
950104690 3:10380622-10380644 CTGGAGAAGCAATGGCAGGACGG - Intronic
951704344 3:25528527-25528549 CTGGAGGAGGAGTAGAAGGAAGG + Intronic
952156508 3:30649156-30649178 CTAGAGAGGGAGCGGAAGGAAGG - Intronic
952715217 3:36473049-36473071 CTGGAGAAGCCTCAGAATCATGG + Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
954621232 3:51996804-51996826 GTGGAGAAGGAGCAGAGGGGAGG + Intergenic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
954867832 3:53744717-53744739 CTAGGGAAGGAGCAGAAAGACGG - Intronic
955067439 3:55545333-55545355 CTGGGGAGGGATCAGAAGGATGG + Intronic
955103518 3:55874706-55874728 ATGGAGAAGCTACAGAAGTAGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956757214 3:72400732-72400754 CTAGGCAAGCAGCAGAAGGGAGG - Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957080626 3:75633119-75633141 CTGGAGAAACAGCACAGGGCAGG - Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959388748 3:105746481-105746503 CTGGAGAAGATGCAGAAAGTGGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960476424 3:118135071-118135093 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
960636821 3:119792618-119792640 CTGGAGTGGAGGCAGAAGGAAGG - Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960781464 3:121322829-121322851 CTGGTGAAGCTGCAGAGGAAAGG - Intronic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
963105887 3:141646839-141646861 CTGTTGAGGCAGCAGAAGTAGGG - Intergenic
964126801 3:153241819-153241841 GTGGAGAAGCTGCAGAAAAAAGG + Intergenic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
964870433 3:161307969-161307991 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965507759 3:169535053-169535075 CTGGAGAAGCCACAGACAGAGGG + Intronic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
966166584 3:177025887-177025909 CTGTAGAAGCACCAGAAGGTGGG - Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
968165775 3:196464070-196464092 GTGGAGAAGAGCCAGAAGGAAGG + Intergenic
968460684 4:723404-723426 CTTGGGAAGCAGAAGAAGGTGGG + Intronic
968565324 4:1309571-1309593 CTGGAGGAGGAGCAGAGGCAGGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970688515 4:18595397-18595419 GTGGAGAAGCAGCACAGGAAAGG + Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971491338 4:27215336-27215358 CAGGAAAAGCAGCAAAAAGAAGG + Intergenic
972231369 4:37076078-37076100 TTGAAGAAGGAGCTGAAGGATGG - Intergenic
972444992 4:39135472-39135494 CTGGAGACATTGCAGAAGGAAGG - Intergenic
972917391 4:43897469-43897491 ATGGAGAATGAGCAGAAGCAGGG - Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975722507 4:77261899-77261921 GTGGAGATGGAGCAGAAGCATGG + Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
978217327 4:106220353-106220375 CTGGGGAAGCCCCAGAATGATGG - Intronic
978867569 4:113532609-113532631 CTAGAGAAGTTGGAGAAGGATGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979375467 4:119941556-119941578 TAGGAGTAGCAGCAGAAGAAGGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
981938524 4:150257987-150258009 CTTATGAAGCAGCAGCAGGAAGG + Intergenic
982219724 4:153114207-153114229 TAGGTGAAGAAGCAGAAGGAAGG - Intergenic
982287359 4:153748986-153749008 CTGGAGAAGGAGCAGCTGGGAGG + Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
982983783 4:162177790-162177812 CTGGAAAATCATCAGAAGCATGG + Intergenic
983124642 4:163935535-163935557 CTGAGGAAGCTGCAGAAGAAAGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984510612 4:180674103-180674125 CAGGAGAAGCAGGTGAAAGATGG + Intergenic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985450282 4:190058096-190058118 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986545481 5:8892217-8892239 CAGGAGATGAAGCTGAAGGAAGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987567248 5:19606562-19606584 CTGAACAAACAGCAGAAGAAAGG + Intronic
987671960 5:21022160-21022182 CTGGAGAAACTGCAGACTGAGGG - Intergenic
988219779 5:28328825-28328847 CTGGTGAAGCTGCAGAGAGAAGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
988778234 5:34496359-34496381 CTGAAGAAGCTGCATAGGGAGGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989220372 5:38953694-38953716 CTTGAGAAGCAGCATAGGGCAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990442501 5:55860924-55860946 GTGAAGAGGCAGCAAAAGGAAGG - Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994269091 5:97755236-97755258 CTGGAGAAACTGCACAAGTAAGG - Intergenic
994613730 5:102077955-102077977 CTGGCAAAGCAGCATAAGGGAGG - Intergenic
994714665 5:103307098-103307120 GTGGAGAAGGAGAAGAAGAAGGG + Intergenic
994924838 5:106101208-106101230 TTGAAGATGGAGCAGAAGGAAGG + Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997877213 5:137560117-137560139 CTGGAGCAGAGGGAGAAGGAAGG - Intronic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998226763 5:140333148-140333170 ATGGAGTAGCACCAGAAGAATGG + Exonic
999100893 5:149025109-149025131 CTGGAGAAGATCCAGAAGGCAGG - Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999496534 5:152104432-152104454 CTGGGAAGGCACCAGAAGGAAGG - Intergenic
1000412667 5:160949873-160949895 CTGAAGAATCTGCAGAAGAATGG - Intergenic
1000795998 5:165665482-165665504 CTGGAGAAATAGCAGAGTGATGG - Intergenic
1001333286 5:170777439-170777461 CTGGAGGAGAAGCAGAGGGCTGG - Intronic
1002173091 5:177386115-177386137 CTGGAGGAGGAGCAGAAGCCAGG + Exonic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1002855252 6:1030895-1030917 ATGCAGAAGTAGCAGAATGAAGG + Intergenic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003346833 6:5277109-5277131 CTGAAGAAGAAGCTGAATGAAGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003660014 6:8051371-8051393 GTGAGGAAGCTGCAGAAGGAAGG + Intronic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1005797623 6:29383481-29383503 TTGGAGAAGGAGCAGAAGAGAGG + Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1009045963 6:58237767-58237789 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009221780 6:60992080-60992102 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013355101 6:109339567-109339589 CTGGTGCTGCAGGAGAAGGATGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015232610 6:130933696-130933718 CTGCAGATGCAGCCCAAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015487923 6:133792479-133792501 CTGGCAAAGCAGCAGAAGTGAGG - Intergenic
1015678823 6:135781380-135781402 CTGGGGAAGCTGCAGTGGGAAGG - Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1017008201 6:150043424-150043446 CTGGGGAGGGGGCAGAAGGAAGG - Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018470087 6:164087204-164087226 CTGGAGAAGATGCACAAAGAAGG + Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019389994 7:781205-781227 ATGGAGATAGAGCAGAAGGATGG - Intronic
1019471868 7:1225343-1225365 CTGGAGTGGCGGCAGAAGGAGGG + Intergenic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1020210016 7:6152129-6152151 CTCGCAAAGCAGCAGCAGGACGG + Intronic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1022131282 7:27406858-27406880 GTGGAGGAGAAGCAGAGGGAAGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022363942 7:29690997-29691019 TTGGTTCAGCAGCAGAAGGATGG - Intergenic
1022697425 7:32722732-32722754 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1022934681 7:35161234-35161256 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1023048513 7:36231700-36231722 TTGCAGAATCAGCAGAAGAAAGG + Intronic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023779596 7:43643509-43643531 CTGGAGGAGGAGCACAGGGAAGG - Intronic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026380427 7:69793929-69793951 CTGCAGAGGCAGCAGAGTGATGG + Intronic
1026899204 7:74027789-74027811 CGGGAGAGGAAGCAGAAGGGAGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1029598123 7:101548494-101548516 CTGGAGAAGCAGTGGAAAGCTGG + Intronic
1029830622 7:103254014-103254036 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030861714 7:114639719-114639741 TTTGAGAAGCAACAGAAGGCTGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031620335 7:123927401-123927423 CTGAAGTAGCATCGGAAGGAGGG + Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032166909 7:129552804-129552826 CTGGAGAAGCAGCACCAGGCTGG - Intergenic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033432340 7:141300569-141300591 AAGGAGAAGAAGCAGAAGAAGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033586702 7:142779674-142779696 GAGGAGAGGAAGCAGAAGGAGGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034068556 7:148160304-148160326 CTGGAGCTGAGGCAGAAGGATGG + Intronic
1034562507 7:151890311-151890333 CAGGAGAAGGAGCAGAGGAAGGG - Intergenic
1035084868 7:156249425-156249447 CTGGAGCACCACGAGAAGGAAGG + Intergenic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1035784643 8:2250992-2251014 CTGGGGAACCTGCAGAAGGTTGG + Intergenic
1035808164 8:2470721-2470743 CTGGGGAACCTGCAGAAGGTTGG - Intergenic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037287667 8:17318481-17318503 CTGGAACTGCAGCAGGAGGATGG + Intronic
1037444135 8:18947507-18947529 CTGGAGGAGCAGCAGAACCCCGG - Intronic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1039729102 8:40255504-40255526 CTGGAGCAGAAACAAAAGGAAGG + Intergenic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041327933 8:56689060-56689082 CTGCTGATGCAGCAGAAAGAAGG + Intergenic
1041343704 8:56873149-56873171 CTGGAGAAGCTGCAGAGAAAAGG + Intergenic
1041428677 8:57752847-57752869 CTGGAAAAGCCGCAGAAGTGAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041559986 8:59206261-59206283 CTGGGGAAGCAGCTCAGGGATGG - Intergenic
1041803125 8:61821590-61821612 CTGGAGAAGTAACTGCAGGATGG + Intergenic
1042358477 8:67855316-67855338 TGGGAGATGCAGTAGAAGGATGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042937346 8:74073226-74073248 CAGGAGAAGAAGCTGAAGGAGGG + Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1044663714 8:94615306-94615328 CTCGAGAAGTAGCAGAAAGATGG + Intergenic
1045709386 8:104965189-104965211 CTGCAGAAGAAGGAGAAGGTGGG + Intronic
1045825531 8:106393019-106393041 GTGGAGAAGTTGGAGAAGGATGG - Intronic
1046096689 8:109570953-109570975 CTAAAGAAGCAGGAGAGGGAGGG + Intergenic
1046573272 8:115993322-115993344 CTGGAGAAGTCACAGAAGGCGGG + Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1047312685 8:123705874-123705896 CTGGTGCTGGAGCAGAAGGAGGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049236463 8:141514741-141514763 CTGGAGTGGCTACAGAAGGAGGG - Exonic
1049422348 8:142522618-142522640 CTGGAGAAGGAGCAGAGAGAGGG - Intronic
1049443499 8:142619672-142619694 CTGCAGAGGCTGCAGAGGGAGGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049684548 8:143934092-143934114 CTGCAGCAGCAGCACAGGGAAGG + Intronic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1049872453 8:144991096-144991118 ATGGAGAGGGAGCAGAAGCAGGG - Intergenic
1050523409 9:6525008-6525030 CGGGAGAAGAGGCTGAAGGAAGG - Intergenic
1050560175 9:6827111-6827133 CTCAAGAAGCTGCAGAAGAATGG - Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052750151 9:32482053-32482075 TGGGGGAAGGAGCAGAAGGATGG - Intronic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052998374 9:34563963-34563985 GTGGAGAGGGAGCTGAAGGAAGG - Intronic
1053279042 9:36805613-36805635 TTGGTGAAGCTGTAGAAGGATGG + Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1056012660 9:82348244-82348266 CTGGTGAAGCTGCAGAAAAAAGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057488761 9:95506600-95506622 CTGGGGACGAAGCAGAAGGGAGG + Intronic
1057745199 9:97745664-97745686 CTGGAGGAGAAGGAGAAGGGGGG + Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1059924586 9:119195649-119195671 CTGCAGAAGTAACAGCAGGAAGG - Intronic
1060723282 9:125992160-125992182 CAGGAGGAGCAGCAGAAGCCCGG + Intergenic
1061735312 9:132652293-132652315 CTTGACAAGAACCAGAAGGATGG + Intronic
1061768340 9:132897183-132897205 CAGCTGAAGCAGCAGAAGAAAGG - Exonic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1203431133 Un_GL000195v1:92236-92258 CTGGAGAAGCAGCACAGGGCAGG + Intergenic
1203435375 Un_GL000195v1:132387-132409 CTGGAGAAGCAGCACAGGGCAGG - Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186327330 X:8494034-8494056 CTGACAAAGCATCAGAAGGAGGG - Intergenic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1187581306 X:20610267-20610289 CTTCCCAAGCAGCAGAAGGAAGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189025009 X:37385329-37385351 CTGGACAGGAAGCAGAAGGAGGG + Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189557115 X:42156231-42156253 TAGGAGTAGGAGCAGAAGGAAGG + Intergenic
1189897287 X:45668706-45668728 CTAGAGGAGTAGCAGAAGGTAGG - Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193278981 X:79625641-79625663 CTGGAGAGGCTGCAGAATCATGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1194297542 X:92144547-92144569 CTGGAGAAGCCTCAGAATCATGG - Intronic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195615067 X:106905671-106905693 TCCGAGAATCAGCAGAAGGAAGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1196874110 X:120141742-120141764 CTGGTGAGGCTGCAGAAGAAAGG - Intergenic
1197119517 X:122873772-122873794 CAGTAGTAGCAGCAGAGGGAAGG - Intergenic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1197917202 X:131548916-131548938 GTGAAGAAGTGGCAGAAGGAAGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199188535 X:144942835-144942857 CTGGAGAAGCAGGAGAGGTGAGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200615115 Y:5369448-5369470 CTGGAGAAGCCTCAGAATCATGG - Intronic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201434675 Y:13944044-13944066 CTGACAAAGCATCAGAAGGAAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic