ID: 1126431880

View in Genome Browser
Species Human (GRCh38)
Location 15:48594474-48594496
Sequence CTGCTCCCCTTCAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126431880_1126431883 -1 Left 1126431880 15:48594474-48594496 CCCTTTTTCCTGAAGGGGAGCAG 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1126431883 15:48594496-48594518 GTTGAAGACACCCCCAAACTTGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126431880 Original CRISPR CTGCTCCCCTTCAGGAAAAA GGG (reversed) Intronic
900121961 1:1052062-1052084 CTGCTCCCCACCAGGAAGGATGG - Intronic
900777657 1:4596643-4596665 CTGATACCCTTCAAGAAGAAGGG - Intergenic
901380935 1:8873697-8873719 CCCCTCCCCCTCAGGAAGAAAGG - Intronic
903873831 1:26458250-26458272 TCCCTCCCCTTCAGGATAAAGGG + Intronic
906060792 1:42947255-42947277 TTGCTCCCCACCAGTAAAAAAGG - Intronic
907706561 1:56837589-56837611 CTGTTCCCCTTCAGCCAAAGGGG + Intergenic
912249893 1:108000299-108000321 CTGCTCCCTTTAAGGAAACCTGG - Intergenic
912542418 1:110427126-110427148 CTGATTCCCTTCAGGAAGCAGGG - Intergenic
914247705 1:145898051-145898073 CTGCCCTCCTTCAAGAGAAAAGG - Intronic
916196851 1:162232365-162232387 CTGATCCCCAAGAGGAAAAAAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918102004 1:181384473-181384495 CTGCTACCCTACATGGAAAAAGG - Intergenic
920187094 1:204166486-204166508 CTGCTCCCCATCCGGAAACCTGG - Intergenic
920659349 1:207902240-207902262 CTGCTTCCCTTCATGAACTATGG - Intronic
921248431 1:213272373-213272395 TAGCTCCCTTTCAAGAAAAATGG + Intronic
921273704 1:213495629-213495651 CTGCTCCCCATCTGTAAAATGGG - Intergenic
922089105 1:222378625-222378647 CTCATCTCCTTCAGGAACAAAGG + Intergenic
922148016 1:222968263-222968285 CAACTCCCCTTCAGGAAATGAGG + Intronic
922375502 1:224960201-224960223 CAGCTTCCCTTAAGGAGAAAGGG + Exonic
923968841 1:239176945-239176967 CTTATCCCCTTCATGACAAATGG - Intergenic
1064439406 10:15340178-15340200 CTGCTCCCCATCAGTAAATGGGG + Intronic
1064986378 10:21214943-21214965 CTCCTCCCCGGCAGGGAAAAGGG - Intergenic
1065176654 10:23082636-23082658 GTGGTTCCCTTGAGGAAAAAAGG + Intergenic
1068785508 10:60968160-60968182 CTGCACCTCTACAGGAAAACTGG + Intronic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1069399246 10:68025001-68025023 CTTCACCCTTTAAGGAAAAAAGG + Intronic
1070408043 10:76113895-76113917 CTCGATCCCTTCAGGAAAAAAGG - Intronic
1070772825 10:79092263-79092285 CTCATCCCCTTCTGGAAAACTGG + Intronic
1070844230 10:79508697-79508719 CTGCTTCCCTTCTTGACAAACGG + Intergenic
1070929568 10:80251615-80251637 CTGCTTCCCTTCTTGACAAACGG - Intergenic
1071305162 10:84293316-84293338 CAGCTCCCCTTCAGGGAATGTGG - Intergenic
1071910511 10:90227119-90227141 CTACTCCCTTTCAGGAAAATAGG - Intergenic
1074596401 10:114871773-114871795 CTGCACCCCATCAGGAGATATGG + Intronic
1075081399 10:119386306-119386328 CTGCTCCCCATTTGGAAAAGAGG + Intronic
1075650738 10:124127186-124127208 CTGCTCCCCTGCACACAAAAAGG - Intergenic
1076247907 10:128961988-128962010 CTGCTCCCCCACCGGATAAAAGG - Intergenic
1076301397 10:129430111-129430133 GTGCTCCCCTTGAGAAAAAAAGG - Intergenic
1077378523 11:2216645-2216667 CTGGTGCCCTCCAGGAGAAAGGG - Intergenic
1079005743 11:16790069-16790091 CTGCCCCCCATCAGGGACAAAGG - Intronic
1080181783 11:29434211-29434233 CTGCTTCCATTCATGAAAGAAGG - Intergenic
1084071681 11:66740619-66740641 CTGCTCCATTTCAGGAAACCCGG + Intergenic
1084634449 11:70381533-70381555 CTGCTCCTCCCCAGGAGAAAAGG + Intronic
1084927390 11:72524473-72524495 CAGCACCCCTTCAGAAAATAAGG - Intergenic
1088500576 11:110478576-110478598 CTGATCCCCTTCAGGCTATAGGG + Intergenic
1089643536 11:119863463-119863485 CTCCTCTCCTCTAGGAAAAAGGG - Intergenic
1089884280 11:121804352-121804374 CTGTTCCCCTTTAAGAAAATAGG - Intergenic
1091017734 11:132067796-132067818 GTGCTACCCTTCATGAAAAAAGG - Intronic
1091834218 12:3573929-3573951 CTGCTCCACTTCTGATAAAAAGG + Intronic
1092210293 12:6641517-6641539 CTGCTCTGCTCCAGGTAAAAGGG + Intronic
1092882715 12:12900463-12900485 CTCCTCCCCTTTAGGGAGAAGGG - Intronic
1092967356 12:13657328-13657350 GAGCTCCCCTTCATGAAGAAGGG + Intronic
1096980318 12:55724874-55724896 TTACTCCCCTTCAGAAAATAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1100737762 12:97556401-97556423 CTGTTCTCCTTCAGGGAACACGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104928446 12:132325857-132325879 CTCCTGCCCCTCAGGAAGAAAGG - Intronic
1106742704 13:32663660-32663682 CTGCTTCTGTTCAGGCAAAAAGG + Intronic
1108576912 13:51798805-51798827 CAGAGCCTCTTCAGGAAAAATGG - Intronic
1109896530 13:68698801-68698823 CAGTTCCTCTTTAGGAAAAATGG + Intergenic
1110950772 13:81487602-81487624 CTTCTCCCCTTCATGGACAATGG + Intergenic
1112931527 13:104745268-104745290 CTCCACCTCTTTAGGAAAAATGG - Intergenic
1113576458 13:111398480-111398502 CTGAACCCAATCAGGAAAAATGG - Intergenic
1113891964 13:113740853-113740875 CTCCTCCCCTGGAGGAGAAACGG + Intergenic
1116014085 14:39385874-39385896 TAGCTCCCTTTCAAGAAAAAAGG + Intronic
1116457564 14:45136421-45136443 CTGGTTCCCTTCAGGAAAGGTGG + Exonic
1119596119 14:75935715-75935737 ATGCTCCCCTTCATATAAAAAGG + Intronic
1120282400 14:82455828-82455850 CAGCTCCCTTTCAGAAAAACAGG + Intergenic
1121638940 14:95472593-95472615 CTGCTGCCTTTCAGGAAGGAGGG - Intronic
1121715587 14:96071630-96071652 CTGAACCCCTTCAGGAGAGAGGG - Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125297912 15:38222665-38222687 TTGCTCACCTTCAGGGTAAATGG + Intergenic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1126667511 15:51088803-51088825 GGACTCCCCTTCAGGAACAAAGG + Intronic
1127294548 15:57597934-57597956 CAGCTCCCCTTAATGATAAAAGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1127731419 15:61805769-61805791 TTATTCCCCTTCAGGAGAAAAGG + Intergenic
1128084858 15:64878779-64878801 CTCTTCCCATTCAGGAAAGAAGG + Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1129670591 15:77605754-77605776 CAGCTGCCCTGCAGGAGAAAGGG + Intergenic
1130019169 15:80212861-80212883 GTGCTACCCTTCAGGAAAAAAGG + Intergenic
1130671230 15:85914671-85914693 CTGTTCCCCTTCTCTAAAAAAGG - Intergenic
1130841634 15:87706299-87706321 CTGGTTGCCTTCAGGAATAAGGG - Intergenic
1131339896 15:91589049-91589071 CTACTGCCCATTAGGAAAAATGG + Intergenic
1132879846 16:2157268-2157290 CTGCTCCCCCTCAGGACACGGGG - Intronic
1133453881 16:5925780-5925802 AAGCTCCTCTTCAGGAAAGAGGG - Intergenic
1133462205 16:5996742-5996764 CAGCTCCCCTGCAGGAAATCTGG + Intergenic
1133512710 16:6475397-6475419 CTGCTACGCTTCAGGAATGAGGG + Intronic
1140305584 16:73799623-73799645 CTGCTTCCTCTCAGGAAGAAAGG + Intergenic
1141218482 16:82046955-82046977 GTGCTCCCCTTGAGGGAAAGGGG + Intronic
1141991937 16:87615547-87615569 CTGCTTCCCATCTGGAAAATGGG - Intronic
1143416632 17:6755659-6755681 GTCCTCCCCTGCAGGAAAGAGGG - Intronic
1143902538 17:10184865-10184887 CTGCTGACCTCCAGGAAAAGGGG + Intronic
1146228016 17:31084142-31084164 CTGGTTCCCATCAGGGAAAATGG + Intergenic
1147234563 17:39047715-39047737 CTGCTGCCCTCCAGAAGAAAGGG + Intergenic
1149576331 17:57716027-57716049 CTGCTCCCCTTTAAGAAGAGAGG - Intergenic
1150786273 17:68165484-68165506 CTTTTCCCGTTTAGGAAAAAAGG - Intergenic
1151085925 17:71380493-71380515 CTGCCCCCTTTAAGAAAAAAAGG - Intergenic
1153068558 18:1077835-1077857 CTGCTCCCCTTCAAGAAGTCAGG - Intergenic
1155170469 18:23263346-23263368 CTTCTCCTCTGCAGGGAAAAGGG - Intronic
1157358133 18:46953938-46953960 ATGCTCTCCTTCAGGGAATAAGG + Intronic
1157752636 18:50193431-50193453 CTGCTCCCCTCCAGGAGGAATGG + Intronic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1160756489 19:759895-759917 CTGCTCCCCTACAGGCATCACGG + Exonic
1162810776 19:13163301-13163323 CGGCTCCCAATCAGGGAAAAAGG + Intergenic
1163598068 19:18231954-18231976 CTGCTCCCCTGTAGGAGGAAGGG - Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165757005 19:38299468-38299490 CTTCTCCCCTGTAGGAAAAAGGG - Intronic
1166729606 19:45051610-45051632 CTGCTAACCTTCAGAAATAAGGG - Intronic
1166792083 19:45404521-45404543 CTGCTCCACTTCAGGAACCCAGG + Intronic
1166995678 19:46718651-46718673 CATCTGCCCTTCAGGAAAAAGGG - Intergenic
925084979 2:1100875-1100897 TTTCTCCCCTACAGGTAAAATGG - Intronic
926056061 2:9774736-9774758 GTTTTCTCCTTCAGGAAAAATGG + Intergenic
927068547 2:19499461-19499483 CTGTTCCCCCTCAGCAAAACTGG - Intergenic
929867398 2:45729827-45729849 CTGCTCCCCTTGAGGCAAGGTGG - Intronic
938233419 2:129681102-129681124 CTTCTCCCCTTCTGGAGACATGG + Intergenic
939632389 2:144540663-144540685 CTGCTCAGCTCCAGGAAAACAGG + Intergenic
940181201 2:150935205-150935227 TTTCTCCCCTTCAGAATAAAAGG + Intergenic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
943358999 2:186895631-186895653 TTGCTCACCTTCAGCAAACAAGG - Intergenic
944430149 2:199624571-199624593 CATCTCCCCTCCATGAAAAAAGG + Intergenic
945328284 2:208509174-208509196 TTGCTCCACTACAGGTAAAATGG + Intronic
947166667 2:227268873-227268895 CTGCTCCCCTTGAGCCAAAGAGG - Intronic
948857863 2:240738620-240738642 ATGCTCCCCTTCAGGCTAAGGGG - Intronic
1168904976 20:1395837-1395859 CTGCTAGGCTTCAGGGAAAACGG - Intergenic
1169629228 20:7607770-7607792 CTTCTCCTCTTCAGGAAGCAAGG - Intergenic
1169725541 20:8725132-8725154 CTGCTTCCCTTCTGGGAAACAGG - Intronic
1170117139 20:12872633-12872655 CTGTTCTCATTCATGAAAAAAGG + Intergenic
1170524978 20:17227993-17228015 CTGCTCCTCTCCGGGAACAACGG + Intronic
1172447002 20:34998496-34998518 CAGCTCCCCTGCAGGCAAAGAGG - Exonic
1173011590 20:39188028-39188050 TTTCTTCCCTTAAGGAAAAATGG - Intergenic
1173018322 20:39246683-39246705 CTGCTCCCATTCAGGAAGGAAGG - Intergenic
1174862274 20:54102226-54102248 CTAATCCCCTGCAGGAAAGAAGG + Intergenic
1175194005 20:57229966-57229988 CTGTTCCCTCTCAGGAAGAAGGG + Intronic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1179731550 21:43370746-43370768 CTGCTCACCTTCATGTAAACTGG - Intergenic
1181407626 22:22696008-22696030 CTGCACCTCTTCAGGTAACAGGG + Intergenic
1181412269 22:22732554-22732576 CTGCACCCCTTCAGGTTACAGGG + Intergenic
1182946597 22:34329763-34329785 CTGCCCCCTCTCAGTAAAAATGG + Intergenic
1184583888 22:45434826-45434848 CAGCTCCAGTTCAGGAAACAAGG - Intergenic
949617418 3:5769227-5769249 CTGGTACCCTTCAGGATAAAGGG + Intergenic
950730020 3:14948355-14948377 ACCCTCCCCTTCAGAAAAAACGG - Intronic
950841182 3:15969832-15969854 CAGATCCCCTTCAGGAAGGAAGG - Intergenic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
954720602 3:52559136-52559158 CTGCTCAGCTTCAGGAAACCTGG - Intronic
954812722 3:53257819-53257841 CTGCTCACTGTCTGGAAAAAGGG + Intergenic
957595002 3:82252339-82252361 CTTCTCCCCTGCAGGAGAAATGG + Intergenic
958916631 3:100057566-100057588 CTGCTCCCCTCCTGCAAACAGGG + Intronic
962112572 3:132469570-132469592 CTCCTCCCCGCCAGGACAAAAGG - Intronic
962404339 3:135087531-135087553 CTGCTGCCCATCAGCATAAAGGG - Intronic
964046483 3:152333963-152333985 CTGCTCCCATTTTGGAAACAAGG - Intronic
964129652 3:153272602-153272624 CTGCTCCACATCATGAATAAAGG + Intergenic
964195991 3:154065560-154065582 CTGCTCCCCATGAGGTAAACAGG + Intergenic
964332259 3:155616659-155616681 CTGCTTGCCTACAGGAAAAGGGG + Intronic
968428267 4:537298-537320 CTGCTCCCCTGCAGCGCAAATGG + Intronic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
981574476 4:146190352-146190374 CTGCTCCCTTTCAGGAGCATTGG + Intronic
982538138 4:156632323-156632345 CTGCTCCTTTGCAGGCAAAAAGG - Intergenic
982723749 4:158884008-158884030 CTGCCCCCCTTCAGGAGAAATGG + Intronic
982871954 4:160591162-160591184 AGGCACCCCTTCAGGAAACAAGG - Intergenic
984731185 4:183069508-183069530 CTGCTCCACTGCAGGAGACAGGG + Intergenic
984820461 4:183877003-183877025 CCACTCGGCTTCAGGAAAAAAGG + Intronic
990631109 5:57670141-57670163 CTAGTCCCCTTCAGGACATAAGG + Intergenic
991486514 5:67142798-67142820 CTGATCCCCTTCAGGAACCCCGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993145726 5:84091060-84091082 CTGCTCCCCCTCAAAATAAAAGG + Intronic
994169276 5:96640906-96640928 CGGATCCCCCTCAGGAATAACGG - Intronic
996491703 5:124105640-124105662 CTGCTCCCATTCACAAAAATAGG + Intergenic
996642141 5:125769103-125769125 AAGCTACCCTTCAGAAAAAAAGG - Intergenic
996744177 5:126831855-126831877 TTCCTCCCCTGCAGGAAATATGG + Intronic
997146708 5:131442372-131442394 TTGCACCCCATCAGGAAGAAGGG - Exonic
999073619 5:148774026-148774048 CAACTACCCATCAGGAAAAATGG + Intergenic
999758211 5:154680927-154680949 CTGCTCCCCCTCTGTAAAACTGG + Intergenic
1000824711 5:166030740-166030762 GTGCTCCCTTCCAGAAAAAAGGG - Intergenic
1001604831 5:172952052-172952074 CTCCTCCCTTTCAGGACAAAAGG - Exonic
1002929854 6:1625483-1625505 CTGCTCCACTCGAGGAAACAAGG + Intronic
1003050924 6:2780747-2780769 CTGCTGCACTTCAGAAACAATGG - Intronic
1003716688 6:8654562-8654584 CTTCTCCTCTACAGTAAAAATGG - Intergenic
1004802951 6:19171233-19171255 CTGCTCCTTTGCAGGAGAAAAGG + Intergenic
1006514391 6:34538033-34538055 CTGCTCCCCTGGAGGACAGAGGG - Exonic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1015310221 6:131758662-131758684 CAGCTCCCCTGCAGAAAATATGG - Intergenic
1015429436 6:133113227-133113249 CTGCTACTCTTCAGGAAATCGGG + Intergenic
1015942251 6:138464143-138464165 CTGCTTCCCATCAGAAACAACGG - Intronic
1016654220 6:146499348-146499370 GTGCTCCCTTTCCAGAAAAATGG - Intergenic
1021189502 7:17603290-17603312 CTGCTCAGCTGCAGGAGAAAGGG - Intergenic
1021331829 7:19347465-19347487 CTGCTCCACTACAAGTAAAAAGG - Intergenic
1022049976 7:26657293-26657315 CTGCTCCCCTGCAGGAGGACTGG + Intergenic
1022608799 7:31846772-31846794 TTGCACCACTTCAGGAAAAAAGG - Intronic
1024174636 7:46826448-46826470 CTGTTTCCCATCAGGGAAAAGGG + Intergenic
1024228807 7:47348287-47348309 CTGGTCCCCTTCCTGGAAAAAGG + Intronic
1026413574 7:70154498-70154520 CTGCTCCCTTTAAGGAGACAGGG + Intronic
1028550623 7:92058818-92058840 CTGTTCCAGTCCAGGAAAAAAGG + Intronic
1028677353 7:93480908-93480930 ATGCTCCCCTTCAGGCAAGATGG - Intronic
1029064867 7:97839304-97839326 CTGCTCCCCCTGAGGTTAAAAGG - Intergenic
1032301350 7:130690251-130690273 CATCTACCCTTCATGAAAAAAGG + Intergenic
1032370613 7:131346976-131346998 CTTCTCACCTTCAGGACACATGG + Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035856521 8:2981922-2981944 CTGGTCCTCTCCAGGAAAAAGGG - Intronic
1038053904 8:23839528-23839550 CTGCTCCCCCTCAGGACTAAGGG - Intergenic
1038938099 8:32274947-32274969 CTGCTCCCCTTCTGGTACATGGG - Intronic
1039796148 8:40917268-40917290 CTGTTCCCATTCAGTAAAATAGG + Intergenic
1039987525 8:42460142-42460164 CTGCTCCACTTCTGCAGAAATGG + Intronic
1042963934 8:74330817-74330839 GAGCTTCCCTTCAGGAAGAAAGG + Intronic
1044484349 8:92733240-92733262 CAGATCCCCTTAAGGAAACATGG - Intergenic
1045546655 8:103135277-103135299 TTACTTCCCTTCAGAAAAAAAGG - Intronic
1045837104 8:106535380-106535402 CTACTCCCCCTCTGGAAAGAAGG + Intronic
1048031141 8:130633561-130633583 CTGCTGCCCATCAGGAAAAGAGG - Intergenic
1048358015 8:133669418-133669440 CTGCTCCTCTTAAAAAAAAATGG + Intergenic
1048696209 8:137031207-137031229 CTTTTCCCCTTTAGGAAACAAGG + Intergenic
1048710024 8:137199438-137199460 CTGCTCATCATCAGGAAAACAGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1053007895 9:34616106-34616128 CTGCTCCTCTAAAGCAAAAATGG + Exonic
1054883337 9:70168782-70168804 CTGCTCATCTTCAGGTAAGACGG + Exonic
1055129230 9:72755002-72755024 CTGCTCCCTTTAAGAAAGAAAGG + Intronic
1056579461 9:87880463-87880485 CTGCTTCCCTGCAGGAAACGTGG + Intergenic
1057018732 9:91679128-91679150 CTGCTCCTTTTCAGGAAACGTGG + Intronic
1057462606 9:95277295-95277317 CTTTTCCCATTTAGGAAAAAAGG - Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1062727531 9:138084022-138084044 CTGGTCCAATTCAGGAAGAAGGG - Intronic
1191944430 X:66516181-66516203 CTGCTCCCATTCATGGCAAAAGG - Intergenic
1195424579 X:104713926-104713948 CTCCTCTCCTTCTGGAAACATGG - Intronic
1199103044 X:143828280-143828302 TTTCTCCCCATCAGCAAAAAAGG - Intergenic
1199766676 X:150946543-150946565 CAGTTCCCTTCCAGGAAAAAGGG - Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic