ID: 1126432019

View in Genome Browser
Species Human (GRCh38)
Location 15:48596411-48596433
Sequence CTTCATTAGCATTTATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126432019_1126432022 1 Left 1126432019 15:48596411-48596433 CCTGAAAATAAATGCTAATGAAG 0: 1
1: 0
2: 3
3: 46
4: 394
Right 1126432022 15:48596435-48596457 AACACTTGTGGTCCTCTGGAAGG 0: 1
1: 0
2: 2
3: 8
4: 118
1126432019_1126432021 -3 Left 1126432019 15:48596411-48596433 CCTGAAAATAAATGCTAATGAAG 0: 1
1: 0
2: 3
3: 46
4: 394
Right 1126432021 15:48596431-48596453 AAGTAACACTTGTGGTCCTCTGG 0: 1
1: 0
2: 1
3: 0
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126432019 Original CRISPR CTTCATTAGCATTTATTTTC AGG (reversed) Intronic
902138194 1:14329152-14329174 CTTCATTGGCATCAATTTTAGGG + Intergenic
906263563 1:44411316-44411338 CAGCATTAACATTTATTTTGAGG - Intronic
906637998 1:47422775-47422797 CTTTATTTCCATTTATTATCAGG - Intergenic
907643385 1:56215430-56215452 CTTCCTGAGCATTTTCTTTCTGG + Intergenic
908967607 1:69784788-69784810 CTCCATTATCATTTATTCTTTGG + Intronic
910130304 1:83896736-83896758 CTGTATTTGCATTTATTTTAGGG - Intronic
911335604 1:96576511-96576533 CTTCTTTTGCATTTGTTTCCTGG - Intergenic
912069408 1:105789984-105790006 CATTATTATAATTTATTTTCAGG - Intergenic
912428906 1:109618654-109618676 CTGCATTAGCGTTTATTTTTTGG + Intronic
914394780 1:147255013-147255035 CTTGATTAAGATTTTTTTTCTGG + Intronic
915123041 1:153644087-153644109 CTTCAATAGTGTTTTTTTTCTGG - Intronic
915702719 1:157811451-157811473 CTTCTTTACCTTTTGTTTTCAGG - Intronic
917200735 1:172511823-172511845 CTTCATTAGCACTTGGGTTCTGG + Intergenic
917701900 1:177590137-177590159 CATCATTATCATTCCTTTTCTGG + Intergenic
918367348 1:183822375-183822397 CTTAGATAGCATTCATTTTCAGG + Intronic
918607155 1:186441773-186441795 CTTAATTACCATTTATATTAAGG - Intergenic
920264167 1:204709438-204709460 CTTCCTTAGCCTTCATCTTCGGG + Intergenic
921574120 1:216814264-216814286 CTTATTTAGTATTTATTTTTGGG + Intronic
921600263 1:217099210-217099232 CTTCATTTGCATTTCTTTCTTGG - Intronic
921677154 1:217989450-217989472 CTTCATTTGCAGTGATTTTATGG + Intergenic
921766557 1:218979722-218979744 CTACATTTGCATTTATATTTAGG - Intergenic
922419058 1:225447282-225447304 CTTCTGTAGCATTTTCTTTCTGG - Intergenic
924073123 1:240304014-240304036 CTTCTTTTTGATTTATTTTCAGG + Intronic
1063221535 10:3973177-3973199 CTGTATTAGGATTTGTTTTCAGG - Intergenic
1063993227 10:11589757-11589779 ATTCATTAACATTTATATTGTGG - Intronic
1064690018 10:17907262-17907284 TTTCCTTAGCATTTTTTTCCTGG - Intronic
1064993301 10:21275222-21275244 ATTCATTAGCTTATAGTTTCTGG - Intergenic
1065044257 10:21731937-21731959 ATTAATTAGCATTTTTTGTCAGG - Intronic
1065247378 10:23772390-23772412 TTTCAATGGCATTGATTTTCAGG - Intronic
1065401832 10:25312584-25312606 CTGAATTAGCATTTATTTCATGG - Intronic
1065747942 10:28858889-28858911 TTTAAATAGCATTTATTTGCTGG + Intronic
1067692887 10:48514114-48514136 CTTCATTATTTTTTAGTTTCTGG - Intronic
1068064712 10:52114927-52114949 TTTCATTACCTTTTATGTTCTGG - Intronic
1068417108 10:56737764-56737786 TTTCATTGTCCTTTATTTTCTGG - Intergenic
1068419140 10:56766581-56766603 CTTCATTAGGTCTTATATTCTGG - Intergenic
1068543024 10:58316821-58316843 CTCCATCTGCATTTCTTTTCTGG - Intergenic
1068766950 10:60774835-60774857 CTTCTTTTGCATACATTTTCCGG + Intergenic
1068820328 10:61368860-61368882 TTTGATAAACATTTATTTTCTGG - Intergenic
1068917010 10:62443620-62443642 CTACAATCACATTTATTTTCTGG - Intronic
1069087043 10:64152818-64152840 CTACATTGGCAGTTACTTTCTGG + Intergenic
1070424990 10:76277889-76277911 CTTCATTAGGGTTTACTTTTGGG + Intronic
1071112899 10:82182787-82182809 CTCCATTAGCATTTTTTTGTAGG + Intronic
1071218610 10:83436461-83436483 CTTCATTAGCTTTTCTCTGCAGG + Intergenic
1071885378 10:89943989-89944011 CTTCATTAACATTTAATTGCAGG - Intergenic
1072818839 10:98536360-98536382 CTTCATTAGCAGTTTTGTTTGGG - Intronic
1073278848 10:102336771-102336793 CCTCATTATAAATTATTTTCAGG + Intronic
1074312100 10:112330869-112330891 CTGCATAAGCCATTATTTTCAGG + Intergenic
1074348665 10:112713364-112713386 CTTAATTGTCATTTATTTTAAGG + Intronic
1074461779 10:113644909-113644931 CCTCATTTGCATTTCTTATCTGG - Intronic
1074621198 10:115124727-115124749 CCTCATTGGCATAAATTTTCAGG + Intronic
1075141972 10:119846160-119846182 ATTTTTTAACATTTATTTTCTGG - Intronic
1075859149 10:125659839-125659861 CTTCATTATCATGGACTTTCAGG + Intronic
1078310809 11:10239468-10239490 CTTCCTTAGCATTCATATTTTGG + Intronic
1078969297 11:16388963-16388985 CATCATTCTCTTTTATTTTCTGG + Intronic
1079472578 11:20793006-20793028 TTACATTTGCATCTATTTTCAGG - Intronic
1079647865 11:22890292-22890314 CTTCTTTAGCATTTATCATCAGG + Intergenic
1079833599 11:25302490-25302512 TTTCTTAAGCATTTATTTTAGGG - Intergenic
1080168819 11:29273800-29273822 CTTCATTGGCATTAAGTTTGAGG - Intergenic
1081000612 11:37665613-37665635 CTTCATTAGGTTTTAGTATCAGG - Intergenic
1081062462 11:38497273-38497295 CTTGATTAACATATAATTTCTGG + Intergenic
1081689334 11:45066385-45066407 CTTCATTAGCAATTTTCTCCAGG + Intergenic
1081941852 11:46949971-46949993 CTTCAATAATAGTTATTTTCAGG - Intronic
1082054348 11:47800769-47800791 CTTCTGTGGCATTTACTTTCTGG + Intronic
1082640851 11:55658572-55658594 CTTCTTTGGCATTTATTTTTAGG - Intergenic
1082747671 11:56983863-56983885 CTTCATTAGTTTATATTATCTGG + Intergenic
1084339844 11:68489660-68489682 CTTCATTAGCATTTTTTTATTGG + Intronic
1084622704 11:70284178-70284200 AGTCATTAGTATTTATTCTCAGG - Intronic
1085092011 11:73724962-73724984 CTTCATTATTCTTTATTTCCTGG - Intronic
1086043899 11:82510480-82510502 CTTCATTAGGGTTTAATTTCTGG - Intergenic
1086397360 11:86430914-86430936 CTTCCTTAGCACTTATTTTAGGG - Intergenic
1086556620 11:88118562-88118584 TTTCATTTGCATTTATTATAGGG + Intronic
1086653457 11:89320163-89320185 TTTCATTAAAATTTATTTTAAGG - Intergenic
1086941514 11:92803106-92803128 ATTCATTTGCATTTATTTTCAGG + Intronic
1087745384 11:101938962-101938984 ATTCATTAACATTTCTTTTATGG + Intronic
1089112518 11:116068080-116068102 CTTCACAAAAATTTATTTTCTGG + Intergenic
1092576207 12:9785476-9785498 CTTTATTAGCCTTTATTGTTTGG + Intergenic
1092943421 12:13431353-13431375 CTTACCTAGCATTTGTTTTCTGG + Intergenic
1093257192 12:16883911-16883933 CTTCCTTAGCAGTTCTTTTATGG + Intergenic
1093427864 12:19049371-19049393 TTTAATTAGCAAGTATTTTCTGG - Intergenic
1093891853 12:24531132-24531154 CTTCATTTGAGTTTATTTTTTGG - Intergenic
1094140316 12:27174113-27174135 TTTCATTAGAATTAATTTTTAGG + Intergenic
1094269786 12:28600420-28600442 TTTTATTATCAGTTATTTTCAGG + Intergenic
1094726505 12:33123622-33123644 TTTTGTTACCATTTATTTTCTGG - Intergenic
1095660556 12:44728918-44728940 CTTCATCAGCTTTTGTTATCTGG - Intronic
1098520084 12:71425486-71425508 CTGCCTTAGCATATCTTTTCAGG + Intronic
1098833326 12:75390443-75390465 CTTCACTCCCATTTATTTTGTGG + Intronic
1098958321 12:76711002-76711024 CTTCACTAGTATTCACTTTCTGG - Intergenic
1099229502 12:80005380-80005402 TTTCATTTGCATTTATTAGCTGG + Intergenic
1100468243 12:94867767-94867789 CTGCACTAGAATTTTTTTTCTGG - Intergenic
1100965101 12:100004588-100004610 GCTTATTAGCATTTAGTTTCTGG - Intergenic
1101360096 12:104018320-104018342 CTTCATATGCATCTATTTTTTGG + Intronic
1101480693 12:105093979-105094001 CTTTATTGGGATTTATTTTATGG + Intergenic
1101817256 12:108154701-108154723 CTCCATTAACATTTCTTTTTCGG + Intronic
1102169156 12:110829013-110829035 TTTGATCAGCTTTTATTTTCTGG + Intergenic
1102335088 12:112071755-112071777 ATTCATTAGCAAATATTTTCAGG + Intronic
1102356811 12:112243902-112243924 CTTCATTACCAATCATTTCCAGG + Exonic
1102743604 12:115230431-115230453 CTTCATTAACCTTTCTTCTCTGG - Intergenic
1102826920 12:115955151-115955173 CTTCATGTGCATTTTTTTTTAGG - Exonic
1102838363 12:116089391-116089413 TTTCATTTCCATTTAGTTTCTGG - Intronic
1102851002 12:116245051-116245073 ATACATTTGCATTTATTTGCTGG - Intronic
1103272194 12:119682515-119682537 CTTCATTAGCATTTCCTTTATGG + Intergenic
1105230183 13:18487260-18487282 CTTCTCTAGCATTTCTTCTCAGG + Intergenic
1105904049 13:24786557-24786579 TTTCATTAGCATTTCTTATAGGG + Intronic
1105906989 13:24821804-24821826 TTTGATTTGCATTTTTTTTCTGG + Intronic
1106278879 13:28244756-28244778 CTTCAGTAGTAGTTTTTTTCTGG + Intronic
1106312631 13:28567182-28567204 CATCATAAGCATTCAATTTCAGG - Intergenic
1106425108 13:29621071-29621093 CTTCACCAACACTTATTTTCTGG - Intergenic
1106492027 13:30234897-30234919 CCTCATTAGCATAAAATTTCAGG - Intronic
1107260056 13:38479663-38479685 TTTCTTTGGGATTTATTTTCTGG - Intergenic
1107367730 13:39702810-39702832 CTTCACTAGAATTCATTTTCTGG - Intronic
1108421185 13:50251366-50251388 CTTCATTATCCTTTAATTTCAGG - Intronic
1108690694 13:52856896-52856918 CTTTAGAAGCATTTATTTTCAGG + Intergenic
1109505456 13:63295400-63295422 ATTCATTTGCATTTCTTTTTTGG - Intergenic
1109664795 13:65519753-65519775 CTTCATTCTACTTTATTTTCAGG - Intergenic
1109755486 13:66753551-66753573 CCTCATTAGTATTTATTTTATGG - Intronic
1110781975 13:79477254-79477276 ATTCACTAGCAATCATTTTCTGG - Intergenic
1110984213 13:81942797-81942819 CTTTATTATCATTAATTTTAGGG + Intergenic
1111130362 13:83966955-83966977 CTTAATTAGGATTATTTTTCTGG + Intergenic
1111295470 13:86272027-86272049 ATTATTTATCATTTATTTTCGGG + Intergenic
1111740960 13:92205423-92205445 CCTCATTAGCATAAATTATCAGG + Intronic
1111882433 13:93974250-93974272 TTTCATTAACATTTATTCTAAGG + Intronic
1113423730 13:110190268-110190290 AATCCTCAGCATTTATTTTCAGG - Intronic
1115100890 14:29697893-29697915 TTTGAATAGCATTTATTCTCAGG - Intronic
1116138860 14:40962214-40962236 TTTCTTTAACATTTATTTTGAGG - Intergenic
1116177226 14:41487642-41487664 TGTCATTTGCATTTATTGTCTGG + Intergenic
1116839155 14:49801821-49801843 GTGCATTAGCATTTAGTTTTGGG - Intronic
1116900660 14:50359382-50359404 CTTCATTCTTTTTTATTTTCTGG - Intronic
1117219682 14:53590524-53590546 CTTCAGCACCATCTATTTTCAGG - Intergenic
1117798586 14:59419941-59419963 CTTCCTTAGCATCTGTTTTGAGG + Intergenic
1120258955 14:82158062-82158084 CTTCTTTATTATGTATTTTCTGG - Intergenic
1120282877 14:82461714-82461736 ATTCCTTTGCATTTATTTTTAGG - Intergenic
1120714431 14:87825021-87825043 CTTTATTAAGATTTTTTTTCTGG + Intergenic
1120928426 14:89821633-89821655 CTTCATTTGTTTTTCTTTTCAGG - Intronic
1121148751 14:91610648-91610670 CTTCACTGGCATTTATTATGTGG - Exonic
1123674854 15:22700465-22700487 GGGCATTAGCATATATTTTCGGG + Intergenic
1123885490 15:24723053-24723075 TTTCATTATACTTTATTTTCTGG - Intergenic
1124060180 15:26284694-26284716 CATCATTTACATTTATTTACTGG - Intergenic
1124326868 15:28773445-28773467 GGGCATTAGCATATATTTTCGGG + Intergenic
1124459334 15:29874616-29874638 TTTCATTAGCATGGATTTTGAGG - Intronic
1124842871 15:33260886-33260908 CTTAATTACCGTCTATTTTCTGG - Intergenic
1125189844 15:36978041-36978063 TTTGATAAGCAGTTATTTTCTGG + Intronic
1125620231 15:41054234-41054256 TTTCATTAGAATTCATTTTTAGG + Intronic
1126418554 15:48445626-48445648 CTTCATTGGCATTTCTTGTTTGG - Intronic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1127594807 15:60469479-60469501 CTTCACTAGCTCTTATTATCAGG - Intronic
1127888320 15:63223891-63223913 CTTCATTAGCAGACATTTTGTGG - Intronic
1129135200 15:73542892-73542914 TTTCATAAGGATTTATTTACAGG + Intronic
1129577219 15:76763118-76763140 CTCCATTAGCATTTCTTCTCAGG + Intronic
1131217110 15:90547217-90547239 CATCATTATCATTTCTTTTGTGG + Intronic
1133380213 16:5323615-5323637 CTTCATTAGCATGGATGTGCTGG + Intergenic
1137474408 16:48794607-48794629 CTTCATTGGGATTTTTTTTTTGG + Intergenic
1139265079 16:65630901-65630923 CTTCATGAGATTTTATGTTCTGG + Intergenic
1139332590 16:66205070-66205092 ACATATTAGCATTTATTTTCTGG + Intergenic
1140333964 16:74085908-74085930 CTTCACCAACATCTATTTTCTGG + Intergenic
1140980138 16:80100679-80100701 CTTCCTTAGAAACTATTTTCTGG + Intergenic
1140981554 16:80114540-80114562 CTTCATTATCATTGCTTTTGTGG - Intergenic
1148589535 17:48805437-48805459 CGGCAGTTGCATTTATTTTCAGG - Intronic
1149594775 17:57858316-57858338 CTCCATTAGCATTCTTTATCTGG - Intergenic
1151737773 17:75955575-75955597 CTTCATCAGCATGTTTTCTCTGG + Exonic
1152710252 17:81867723-81867745 CTTCAGGGGCATTTATTTCCCGG + Exonic
1153901906 18:9624809-9624831 TTTCATTAGGATTCATTTTGAGG - Intergenic
1155018318 18:21869649-21869671 CTTAATTAGAATTACTTTTCTGG - Exonic
1155361270 18:25005452-25005474 CCTCAAGAGCATTTACTTTCAGG + Intergenic
1155424637 18:25694180-25694202 CTTAAGTAGCATTTCTTTTCAGG + Intergenic
1155992199 18:32290168-32290190 CTATATTTGCATTTATTTTCAGG + Intronic
1156981616 18:43295630-43295652 TTTCATTTGCATTTCTTTTATGG + Intergenic
1157952935 18:52060726-52060748 GTTCATTAGCAATTATTTCCAGG - Intergenic
1158035391 18:53022762-53022784 CTTGATAAGCCTTTCTTTTCTGG + Intronic
1158254800 18:55533743-55533765 CTTCAGTACCAATCATTTTCTGG + Intronic
1158771785 18:60526940-60526962 CTTCTGTAGCATTTTATTTCAGG - Intergenic
1159000086 18:62965799-62965821 CATTCTTAGCATTTCTTTTCTGG - Intronic
1160330304 18:77985400-77985422 CTTCATTACCATATATCATCCGG + Intergenic
1161121243 19:2527956-2527978 ATTCAGTACCATTTATTTTTGGG - Intronic
1161826557 19:6570534-6570556 TTTCATTATCATTTGTTTTGAGG + Intergenic
1162792761 19:13071631-13071653 CTACAATAGTATTTATTTTTTGG + Intronic
1166594343 19:44032074-44032096 CTTCCTCAGCAGTTATATTCAGG + Exonic
1167194073 19:48014787-48014809 CATTATTAGCATTCATTGTCAGG - Intronic
1168449396 19:56452382-56452404 TTTCATTATCATTTGTTTTGAGG - Intronic
925632943 2:5913990-5914012 CTTCATTATCACTTAGATTCAGG - Intergenic
928355555 2:30611116-30611138 ACTCATTAGCATTTTTCTTCTGG + Intronic
929372211 2:41239946-41239968 CTCCTTTAGCATTTATTGTAAGG + Intergenic
929438252 2:41945422-41945444 CTGCATTATCATTTATGTCCTGG - Intronic
930362357 2:50397669-50397691 CTTCATTCACAGTTGTTTTCTGG + Intronic
930959780 2:57247015-57247037 TTTCATTAGGTTTTATTATCAGG + Intergenic
930998096 2:57746649-57746671 ATTTATTAATATTTATTTTCTGG + Intergenic
931067106 2:58599407-58599429 CTTCATTAGCTGTTTGTTTCTGG + Intergenic
931495806 2:62805960-62805982 CTTCATTTGCTACTATTTTCTGG + Intronic
931517334 2:63057806-63057828 ATTAATTTGCATTTATTTTCGGG - Exonic
931770739 2:65495577-65495599 ATGCATTAGCATTTCTTTTGAGG - Intergenic
932946085 2:76233188-76233210 CTTCATTTGACTTTATTTTGAGG + Intergenic
934932733 2:98441500-98441522 CTACATGAGAATTTATCTTCAGG - Intergenic
934991931 2:98927806-98927828 CTTCGTTTGCATCCATTTTCAGG - Intronic
935031085 2:99323433-99323455 TTACATTAAAATTTATTTTCTGG + Intronic
935458539 2:103300141-103300163 CAACCATAGCATTTATTTTCTGG + Intergenic
938881272 2:135592199-135592221 CCTCATTAGCATACATTATCAGG + Intronic
939723987 2:145691502-145691524 CTTTACTGGCAATTATTTTCTGG + Intergenic
939800890 2:146706565-146706587 CCTCACTAGCATTTTTTTTATGG - Intergenic
940841598 2:158589221-158589243 CTTCAGTAGCATTTCATTTTTGG + Intronic
940877979 2:158917524-158917546 CTACATTATTATTTAATTTCAGG - Intergenic
941325834 2:164112803-164112825 CTGCTATATCATTTATTTTCTGG - Intergenic
941326727 2:164124558-164124580 CTTCTTTAGCATGTATGCTCAGG - Intergenic
941709263 2:168694622-168694644 CTGTATTAGAATTTTTTTTCAGG + Intronic
942354332 2:175092311-175092333 ATTCATTAACATCAATTTTCTGG + Intronic
942674711 2:178414544-178414566 TTTCCTTAGCATTTAATTTTGGG - Intergenic
943261454 2:185668789-185668811 CTTAATCACCTTTTATTTTCAGG + Intergenic
943272083 2:185818802-185818824 TTTCTTTAGCATTTCTTGTCAGG - Intronic
943444580 2:187968158-187968180 CTTCTTTCGCATTTGTTCTCCGG + Intergenic
943704936 2:191024456-191024478 CTGCATTAGCAGTTCTTGTCTGG - Intergenic
943870588 2:192991562-192991584 ATTCTTTAAAATTTATTTTCAGG - Intergenic
944101192 2:196029938-196029960 TTTCACTACCATTTTTTTTCAGG - Intronic
944722367 2:202436974-202436996 GTCAATTAGCATTTATTTTGGGG + Intronic
944972911 2:205014508-205014530 ATTCATTAACATTTATTTCTGGG + Intronic
945911104 2:215650714-215650736 CTTCATTAAAATTTTCTTTCTGG + Intergenic
946502313 2:220262587-220262609 CTCCATTAGGATTTTTTTTCTGG + Intergenic
946550669 2:220798615-220798637 CTTCATTTTCATTTATTTTGGGG + Intergenic
946945534 2:224818144-224818166 CTTCATTTGCAATTACTGTCAGG + Intronic
947391880 2:229647545-229647567 CATCTTTACCATATATTTTCAGG - Intronic
1169832850 20:9843028-9843050 CTTCAGTAGGATATATTTTAGGG - Intergenic
1171299579 20:24048535-24048557 ATGCAGTAGGATTTATTTTCAGG + Intergenic
1171725439 20:28615945-28615967 CTTCTTTAACATTTCTTTTAAGG + Intergenic
1173303705 20:41828010-41828032 CTGCCTTGGCATCTATTTTCAGG - Intergenic
1174510076 20:51044679-51044701 GTTCAGGAGCATTTATTTTCAGG - Intergenic
1174522985 20:51146713-51146735 CTTCTTTAGCATTAATCTTCTGG - Intergenic
1176774169 21:13115605-13115627 CTTCTCTAGCATTTCTTCTCAGG + Intergenic
1177700236 21:24629747-24629769 CTTTATGATCATCTATTTTCTGG - Intergenic
1182806699 22:33078061-33078083 CACCATTACCAGTTATTTTCTGG - Intergenic
951119724 3:18911346-18911368 CTTCATTACTATTTACTTGCAGG + Intergenic
951562884 3:23985867-23985889 CCTCACCAGCACTTATTTTCTGG - Intergenic
952397536 3:32934170-32934192 CTGAAGTAGCATTTATTTTGTGG + Intergenic
953614027 3:44473705-44473727 CTTCCTTAGTTTTTGTTTTCTGG - Intronic
957540432 3:81562383-81562405 CAACATTAGCATTCATTTTTGGG + Intronic
957573189 3:81975399-81975421 CTCCAGGAGCTTTTATTTTCTGG + Intergenic
958094788 3:88929745-88929767 CTTCAGTCGCATTTGCTTTCGGG - Intergenic
958488175 3:94738809-94738831 ATTCATTAGGATTCAGTTTCAGG - Intergenic
958925320 3:100150853-100150875 CTTCATAAGGGTTTATATTCTGG - Intronic
960079052 3:113521704-113521726 CTACATTAGTTTTCATTTTCTGG - Intergenic
960183256 3:114607824-114607846 CTTCATGAGAATGTATGTTCAGG - Intronic
960489750 3:118301214-118301236 CTTCTTTTGTATTTATTTTATGG + Intergenic
960722646 3:120639995-120640017 CTTCTTTAGCATTAATTGTGGGG + Intronic
962505429 3:136041878-136041900 CTTCTTTAGGAGTTATTTTTTGG + Intronic
963282844 3:143403511-143403533 CTTCCTTAGTAATTATTGTCAGG + Intronic
963432988 3:145233147-145233169 CTTCAGTGACATTTATGTTCTGG + Intergenic
964576077 3:158170024-158170046 CTTCTTTAGAATTGATTTTATGG + Intronic
964935039 3:162073690-162073712 CTCCATTAGCTTTTCTTTTCTGG + Intergenic
964949551 3:162272662-162272684 CTTCCATATCATTTATTTGCAGG + Intergenic
965274539 3:166663986-166664008 CCTCATTAGCATAAATTATCAGG + Intergenic
965279492 3:166730228-166730250 CTTCATTTGCATTTAGAATCTGG + Intergenic
965659248 3:171023339-171023361 TTTCTTTATCTTTTATTTTCAGG + Intronic
965768428 3:172155399-172155421 ATTCACTTGCATTTGTTTTCTGG + Intronic
966049082 3:175591172-175591194 CATAAATAGCATTTATATTCAGG - Intronic
966078381 3:175967491-175967513 CTTCTTTAGTATTTATTGTCAGG - Intergenic
966976153 3:185085141-185085163 CTTCATGAGCATCTTTTTGCAGG + Intronic
967099306 3:186202984-186203006 ATTCATATGCTTTTATTTTCCGG - Intronic
967480624 3:189969128-189969150 CTTTACTAGCATTTTCTTTCGGG + Intronic
968945993 4:3664547-3664569 ATGCATTTGCATTTTTTTTCTGG + Intergenic
969451391 4:7275921-7275943 CTTCATTTGCATTCTTTTTTCGG - Intronic
969852564 4:9971760-9971782 CTTCCTTAGCTTTATTTTTCAGG - Intronic
970071448 4:12164209-12164231 CTTCCTCAGCTTTTATTTTGTGG - Intergenic
970180581 4:13388127-13388149 CTTAATTAGCATTGCTTTTATGG - Intronic
970400774 4:15715574-15715596 CTTCTTTAGCTTTTATTTTTAGG - Intronic
970846304 4:20542367-20542389 CTACATAATCATTTATTTGCGGG - Intronic
971739279 4:30499959-30499981 CTTCATTAGGATTGATTTTGTGG - Intergenic
971891709 4:32532185-32532207 GTTCTTTAGCATTTATTGTTAGG - Intergenic
972142756 4:35982034-35982056 TTCCTTTAGCATTTATTTTAAGG - Intronic
974301210 4:60069183-60069205 ATTCCTTAGCTTTTATTGTCAGG - Intergenic
974492650 4:62587278-62587300 ATTCTTTAGCATTTTTTTTTTGG + Intergenic
977383984 4:96314717-96314739 CTTCATTAACCTTGAATTTCTGG + Intergenic
977533024 4:98222330-98222352 ATTCATCATCATTTCTTTTCTGG - Intergenic
977576462 4:98679775-98679797 CGTTATTAGAAATTATTTTCTGG - Intergenic
977772474 4:100875961-100875983 CCTCATTAGCATTAACTATCAGG + Intronic
978900992 4:113949379-113949401 CTTCCCTAGCACTTTTTTTCTGG + Intronic
979099972 4:116601107-116601129 CTTTATCAGTATTTATTTGCAGG - Intergenic
979275510 4:118810755-118810777 CTCCATTGGCATTTACTCTCTGG - Intronic
979687575 4:123527640-123527662 CTTCAGTAGCATTTAGATTTTGG - Intergenic
979770545 4:124519738-124519760 CTTCAGTAGCAACTATTTTTAGG - Intergenic
979846027 4:125513178-125513200 CTTCAGTAACATTTATGTTAGGG + Intergenic
979968372 4:127105006-127105028 CTTCATGAGGATTTATTTTTAGG + Intergenic
980774942 4:137425548-137425570 CTTCATTAGCTTTCATTTTGTGG + Intergenic
982474936 4:155838783-155838805 CTTAATTTACTTTTATTTTCAGG - Intronic
982905594 4:161065995-161066017 ATTGATTAGTATTTATTTTATGG + Intergenic
982936598 4:161485835-161485857 CCTCATTAGCATTTAATTAATGG - Intronic
983063224 4:163181404-163181426 CTGTATTAGCAGTTATCTTCAGG - Intergenic
983398236 4:167230989-167231011 CTTCTTTAGCATTTATATTGAGG + Intronic
983709904 4:170701300-170701322 CTTTATTAAGATTTATTTTTTGG + Intergenic
983818558 4:172164397-172164419 TTTCATTAGGATGTATTTTATGG + Intronic
983898534 4:173107353-173107375 CTTCTTCAGAATTCATTTTCAGG - Intergenic
983927554 4:173418088-173418110 CCTCATTATCTTTTATTTTTTGG - Intergenic
984386218 4:179061283-179061305 TTTCTTTAGCATTTCTTTTAAGG - Intergenic
986050701 5:4087581-4087603 GTGTATTGGCATTTATTTTCAGG + Intergenic
986982400 5:13464246-13464268 GTTCCTCAGCATTTATTTTAAGG - Intergenic
987580280 5:19781945-19781967 CTTTATAATCATTTATTTTCTGG + Intronic
987728573 5:21736626-21736648 CTTCATTATCATTTATGATGAGG - Intergenic
988000334 5:25339895-25339917 CATCTTTAGCATTTCTTCTCTGG - Intergenic
988309024 5:29533309-29533331 CTTCATTATGAATTCTTTTCAGG + Intergenic
988962501 5:36384075-36384097 CTGCATTTGCATTTTTATTCTGG - Intergenic
989064442 5:37445425-37445447 TTTCATCTGCATTTATTTCCTGG + Intronic
989300619 5:39887884-39887906 CTGCATGAGCATTTTTTTTCAGG + Intergenic
989576943 5:42997001-42997023 CTTCATTAGGTCTTATTTTTTGG + Intergenic
989744036 5:44806781-44806803 CTTCAGGAGCCTTTAGTTTCTGG + Intergenic
990123829 5:52489419-52489441 CTTCTTGTGCATTAATTTTCTGG - Intergenic
990442099 5:55856906-55856928 CTTCATTATCATTTAGTTGCGGG - Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
990893579 5:60673488-60673510 CTTGATTAACACTTCTTTTCCGG - Intronic
991334098 5:65527356-65527378 CTTCATTAGGATTTATACTATGG - Intronic
991351578 5:65724735-65724757 CATCATCAGCACTTATTTCCTGG + Intronic
991385736 5:66087088-66087110 GTTTTTTGGCATTTATTTTCTGG + Intergenic
991562252 5:67965942-67965964 CTTCCTTGGCTTTTGTTTTCTGG - Intergenic
991924635 5:71692796-71692818 CTTCATTTCCACTAATTTTCTGG - Intergenic
992270706 5:75059893-75059915 CATCATCAGCATTTCTTTTGGGG + Intergenic
992681151 5:79154541-79154563 CTTCATTAGTAATTAGTTTGTGG - Intronic
993160581 5:84285671-84285693 CTACATGTGAATTTATTTTCAGG - Intronic
993225185 5:85160697-85160719 CTTCATTTTCATTTTTTTCCAGG - Intergenic
993386661 5:87269031-87269053 CTTCATTTCCACTTCTTTTCTGG - Intronic
993604919 5:89977592-89977614 CTTCATTTTCAATTAATTTCTGG - Intergenic
993680822 5:90875327-90875349 CTTTATAAGCATTTCTTTTCTGG - Intronic
994665178 5:102696590-102696612 CTTCATTGGCATCTGGTTTCAGG + Intergenic
994832439 5:104802710-104802732 CTTCATTGAGATTTATTTTATGG - Intergenic
994838693 5:104892471-104892493 CTTCTAAACCATTTATTTTCTGG + Intergenic
995013734 5:107287201-107287223 CTTCATTCATACTTATTTTCTGG - Intergenic
995216816 5:109604783-109604805 ATTCACTTGCATTTATTTTGGGG + Intergenic
995222415 5:109665042-109665064 ATTGTTTAGCATTTATATTCTGG + Intergenic
995531661 5:113097058-113097080 CTTCATGGGAATTTCTTTTCAGG - Intronic
995646328 5:114316656-114316678 TTTCATATGCATTTATTTTGGGG - Intergenic
995775505 5:115720854-115720876 GATCATTAGAATTTACTTTCTGG - Intergenic
996172917 5:120317130-120317152 ATTTATTAGCAATTATTTTATGG - Intergenic
996929883 5:128873276-128873298 CTTCCTTAGCTTTTCCTTTCAGG + Intronic
996956253 5:129186795-129186817 CCTCATTAGCATTAATCTTAAGG - Intergenic
997103129 5:130990497-130990519 CTTCCTTAGACTTTATTTGCTGG + Intergenic
998062272 5:139128118-139128140 CTTCATTAGAACTTGTTATCAGG + Intronic
998184379 5:139967457-139967479 CTTCATCAGCTTTTGTTGTCTGG - Intronic
998965290 5:147533374-147533396 CTTCATTAGATTATATTTTTGGG - Intergenic
1001428704 5:171642788-171642810 CTTCAAAAGCATTTAATTGCTGG - Intergenic
1003605886 6:7560563-7560585 CTTCGATAACATTCATTTTCAGG - Intronic
1004788831 6:19000359-19000381 CTTCATTTGCATTAATCTTTAGG - Intergenic
1005099446 6:22154261-22154283 CATCAAGAGCATTTATTTTGGGG + Intergenic
1005438540 6:25840173-25840195 ATTCATTAGGATGTATTTCCAGG + Intronic
1006143800 6:31946351-31946373 CTTCATCAGCCTTTCTCTTCAGG + Exonic
1007902944 6:45428527-45428549 TTGCATTAGCATTTTTTTTCAGG + Intronic
1009036772 6:58126581-58126603 TTTAATTAGCATTTTTTTTCAGG + Intergenic
1009671624 6:66760498-66760520 CTTCATTAATATTAATTTTTTGG - Intergenic
1010605343 6:77883011-77883033 CGTTATAAGCAATTATTTTCTGG - Intronic
1012159055 6:95859940-95859962 CTTCATCATTATTTATTTCCAGG + Intergenic
1012365954 6:98440791-98440813 TTTAATTAGAATTTATTTTTAGG - Intergenic
1012865520 6:104613787-104613809 CTTCATTTGCATTTATTAGCTGG - Intergenic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1013794067 6:113865355-113865377 CTTTATAAGCATTTTGTTTCAGG + Intergenic
1013842157 6:114409526-114409548 CTTCTTTAAGATTTATATTCAGG - Intergenic
1014143836 6:117973426-117973448 CTTCAGTAACACTTATTTTTAGG - Intronic
1014426174 6:121309409-121309431 TTGCATTATGATTTATTTTCTGG - Intronic
1015139610 6:129914782-129914804 CTTAATGAGCATTTAATATCAGG + Intergenic
1015445157 6:133295475-133295497 TTTCATTATCATTTTATTTCTGG - Intronic
1016339810 6:143050272-143050294 ATTCATTTTCATTTATTTGCTGG - Intergenic
1016874061 6:148847458-148847480 CTGCCTCAGCATTCATTTTCAGG + Intronic
1017398465 6:154030950-154030972 CTTCATTTGCATCCATTTGCAGG - Intronic
1017433345 6:154392688-154392710 CTTCATTAGCATCGATGTTTGGG + Exonic
1017969282 6:159297460-159297482 CTTCATTTGCTTTCATTTTGTGG - Intergenic
1020992734 7:15220789-15220811 CATAAATAGCATATATTTTCAGG + Intronic
1021001395 7:15335609-15335631 CTTCGCTAGTATATATTTTCAGG - Intronic
1021028228 7:15696314-15696336 CATCATTATCATCAATTTTCAGG + Intergenic
1021232310 7:18100857-18100879 CTTCTTGAGTATTTTTTTTCTGG + Intronic
1021804943 7:24346142-24346164 CTTCATTGGAATTTAATTTGGGG + Intergenic
1022606485 7:31820356-31820378 TTTTTTTAACATTTATTTTCTGG - Intronic
1022623784 7:32012955-32012977 GTTGATTATCTTTTATTTTCAGG - Intronic
1023640365 7:42251048-42251070 CTTCATTAGCATAAGCTTTCTGG - Intergenic
1023745995 7:43322963-43322985 CTTCCTTAATATTTATCTTCTGG - Intronic
1024012525 7:45281843-45281865 CTTCATTACATTTTTTTTTCAGG + Intergenic
1026202863 7:68230848-68230870 TCTCATTAGCATAAATTTTCTGG - Intergenic
1026620803 7:71948426-71948448 CTCCATTAGAATTTGGTTTCAGG + Intronic
1027741395 7:82010890-82010912 CTGAATCAGCATTTATTTTCAGG + Intronic
1028290242 7:89056658-89056680 CTTCGATCCCATTTATTTTCTGG - Intronic
1028350429 7:89840154-89840176 CTTCATGAAAATTCATTTTCTGG - Intergenic
1028683181 7:93562536-93562558 CTGCATAAGCTTATATTTTCAGG + Intronic
1028756840 7:94445647-94445669 CTTCTTTAGCCTTTGTTTTTGGG + Intergenic
1030149538 7:106389424-106389446 CTTAAATAGCTTTTATTTTGAGG + Intergenic
1030561831 7:111096770-111096792 CTTCCTTAGCATCTCCTTTCTGG + Intronic
1032473619 7:132197353-132197375 ATGCATTAGCATTCTTTTTCTGG + Intronic
1032484100 7:132270154-132270176 ATTAATAAGCATTTATTTTATGG - Intronic
1032704035 7:134406696-134406718 ATTGATTTGCATTTATTGTCAGG + Intergenic
1032929097 7:136645101-136645123 CTTCTTTATCATTTATTTTCAGG - Intergenic
1033188726 7:139255784-139255806 CTTCAAAAGCATTTATTTTCAGG - Intronic
1033267684 7:139900066-139900088 AATCGTTAGCATTTATTTTGAGG - Intronic
1033708138 7:143908376-143908398 CTTTATAAGCTTTTTTTTTCTGG + Intergenic
1035116969 7:156533006-156533028 CTTCATTAGCATTTTGTTTTTGG + Intergenic
1036389826 8:8315742-8315764 CTTCTTTATCCTTTATTTTTTGG + Intergenic
1036961838 8:13252977-13252999 CTTCATTATAATGTATTTTAAGG - Intronic
1037381912 8:18294251-18294273 CTTCTTTAGACTTTACTTTCTGG - Intergenic
1038183198 8:25248147-25248169 TTTCATTAGTGTTTATTTTCTGG + Intronic
1038856978 8:31344557-31344579 CTTGATTAGCTTCTATTTTTTGG + Intergenic
1039479832 8:37864234-37864256 CTTTATCAGCATTTATGATCTGG + Intronic
1040627286 8:49163062-49163084 ATTCATTAGCATTTGTTGTGAGG + Intergenic
1041546476 8:59049287-59049309 CTTAATTATCATTGATTTTTGGG - Intronic
1042319523 8:67460421-67460443 CTTTATTTGCACATATTTTCAGG - Intronic
1042713944 8:71751205-71751227 CTGCATTATCATTTATATTCTGG - Intergenic
1043002311 8:74773958-74773980 CTACATTAGCTTTTCTTTCCTGG + Intronic
1043664827 8:82795926-82795948 ATGCATTAGCCTTTATATTCAGG - Intergenic
1043886077 8:85602358-85602380 CATAATTAGTATATATTTTCAGG + Intergenic
1044150263 8:88767690-88767712 CTTCCTTAGCATTTATGTTTAGG - Intergenic
1044189903 8:89303127-89303149 ATTCATTAGCATTGAACTTCTGG - Intergenic
1044459277 8:92426225-92426247 CTGTTTTTGCATTTATTTTCTGG - Intergenic
1044481923 8:92700532-92700554 CTTTTTCAGCATATATTTTCTGG + Intergenic
1046420721 8:113980154-113980176 CTCCATTTCCATTTAATTTCTGG - Intergenic
1047419171 8:124692459-124692481 CTTCACTAGCCTTTAACTTCTGG - Intronic
1047602168 8:126436640-126436662 CTTCCTTAACTTTTATTTTGTGG + Intergenic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1051198654 9:14592767-14592789 ATTTATTAGGATTTATTTTATGG - Intergenic
1051384622 9:16494449-16494471 CTTCCTTAAAAATTATTTTCTGG - Intronic
1051468657 9:17409350-17409372 CTTCCGTAGGACTTATTTTCTGG - Exonic
1051883019 9:21859329-21859351 CTTTATTAGCGTTTTCTTTCAGG - Exonic
1052409514 9:28105307-28105329 CTTCATAAGCAAATGTTTTCTGG + Intronic
1052505342 9:29346297-29346319 CTTCATCTGCTTTTATTTTAGGG + Intergenic
1053701213 9:40692582-40692604 CTTCTCTAGGATTTATTCTCAGG - Intergenic
1054312506 9:63491980-63492002 CTTCTCTAGGATTTATTCTCAGG - Intergenic
1054411277 9:64816038-64816060 CTTCTCTAGGATTTATTCTCAGG - Intergenic
1055539599 9:77289432-77289454 ATTAATTATCATTTATTTTATGG + Intronic
1056056766 9:82832757-82832779 CTTATTAAGCATTTATTTTGGGG + Intergenic
1056147478 9:83747026-83747048 TTTCATTAGCATTTATTAACAGG + Intronic
1056227107 9:84506401-84506423 CTTCTGGAGCATTTATTTTCAGG - Intergenic
1056618810 9:88193109-88193131 CTTTATTAGTATTGAATTTCTGG + Intergenic
1056868329 9:90251680-90251702 CTTTATAAGAATATATTTTCTGG + Intergenic
1057048399 9:91903408-91903430 CCTCATTTCCATTTATTTTGGGG - Intronic
1057545269 9:96015482-96015504 CTTTAATAGCATTTATTGGCTGG - Intergenic
1058147912 9:101431775-101431797 CTTCATTACCATTTTTTCTTTGG - Intronic
1058446049 9:105056275-105056297 CTTCATCAGGATTGACTTTCGGG + Intergenic
1059152507 9:111962222-111962244 TTTCATTTGAAATTATTTTCAGG + Intergenic
1059903717 9:118957929-118957951 TTTCATTTGCAGTTTTTTTCTGG - Intergenic
1060319645 9:122545214-122545236 ATTTATTAACATTTATTTTATGG + Intergenic
1203450961 Un_GL000219v1:115843-115865 GTTCTTTAACATTTATTTTAAGG + Intergenic
1186034526 X:5406990-5407012 CTATATTAGAAATTATTTTCTGG + Intergenic
1186037435 X:5440167-5440189 CTGCCTAAGCATTTATTTTATGG + Intergenic
1186111546 X:6262540-6262562 ATTCATTAGCATTTTTATTGGGG + Intergenic
1186388656 X:9135934-9135956 CTTTATAAAGATTTATTTTCTGG - Intronic
1187833418 X:23406112-23406134 TTCCCTTAGCCTTTATTTTCCGG - Intergenic
1190631060 X:52386713-52386735 TTTCAGAAGCATTTACTTTCAGG - Intergenic
1194139167 X:90187790-90187812 ATTCATTTTCATTTATTTACTGG + Intergenic
1194521374 X:94922305-94922327 CTTCAATAGCATTTAGGTTAAGG + Intergenic
1194715809 X:97285905-97285927 CTTCTTTAATATTTATTTTGTGG + Intronic
1195112691 X:101663739-101663761 CTTCATTTCCAGGTATTTTCAGG + Intergenic
1195885846 X:109636614-109636636 CTTTATTAGCATTTATCTTTAGG - Intronic
1196117894 X:112016863-112016885 CTTCATTATCTTTTGTTTACAGG - Intronic
1197461871 X:126752591-126752613 CTCCATCAGAATATATTTTCTGG + Intergenic
1198601970 X:138294046-138294068 CATCATTAGCCTTTATTTCAGGG - Intergenic
1199435071 X:147803971-147803993 CTTCATTAGAATGTATTTGTTGG + Intergenic
1199495985 X:148452897-148452919 CTTCATTCTCATTTATATTCTGG - Intergenic
1200075999 X:153551212-153551234 CTTCAACAGCACTTATTTTCTGG + Intronic