ID: 1126432128

View in Genome Browser
Species Human (GRCh38)
Location 15:48597557-48597579
Sequence AAGAGGAAGCAGAAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1770
Summary {0: 1, 1: 0, 2: 11, 3: 173, 4: 1585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126432128_1126432132 -6 Left 1126432128 15:48597557-48597579 CCCTCCTACTTCTGCTTCCTCTT 0: 1
1: 0
2: 11
3: 173
4: 1585
Right 1126432132 15:48597574-48597596 CCTCTTTCCTTTATTCTTCACGG 0: 1
1: 1
2: 4
3: 55
4: 586
1126432128_1126432133 -5 Left 1126432128 15:48597557-48597579 CCCTCCTACTTCTGCTTCCTCTT 0: 1
1: 0
2: 11
3: 173
4: 1585
Right 1126432133 15:48597575-48597597 CTCTTTCCTTTATTCTTCACGGG 0: 1
1: 0
2: 9
3: 57
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126432128 Original CRISPR AAGAGGAAGCAGAAGTAGGA GGG (reversed) Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900391582 1:2436183-2436205 AGGAGGAAACAGAGGAAGGAAGG - Intronic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900610482 1:3542522-3542544 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
900661566 1:3787048-3787070 GAGAGGAAGCAGAGGCGGGAAGG - Exonic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
900917899 1:5651186-5651208 AGGAGGAAGGAGAAGCGGGAGGG + Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901300777 1:8198703-8198725 AAGAGGAAGAAGGAGGAGAAGGG - Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901647559 1:10724772-10724794 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
902130372 1:14255139-14255161 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
902279350 1:15362934-15362956 AAGTGGAAGCAGCACTGGGAAGG - Intronic
902427903 1:16339152-16339174 AGTAGGAGGCAGAAGCAGGAAGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902885822 1:19403977-19403999 AAGAGGTAACAGTAGTAGGCCGG + Intronic
902922829 1:19677430-19677452 AAGAGGAGGAAGGGGTAGGAGGG - Intronic
903080863 1:20811252-20811274 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
903359644 1:22768844-22768866 AAGAGGAAGCACCAGGAGAAGGG - Intronic
903467421 1:23561496-23561518 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
903546706 1:24128621-24128643 AAGAGGAATTGGAAGAAGGAGGG - Intronic
904078314 1:27856404-27856426 AAGCGGAAGCAGAACTGGGGAGG + Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904412046 1:30330437-30330459 GAGAGGAAGGAGAGGAAGGAGGG - Intergenic
904475637 1:30762946-30762968 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
904496822 1:30891865-30891887 AAGAGGAAGAAGAAGAAGGGAGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904599661 1:31666461-31666483 GAGAGGGAGGAGAAGTGGGAAGG - Intronic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906958606 1:50398923-50398945 AAAAGCAAGAAGAAGAAGGAAGG - Intergenic
907133948 1:52121565-52121587 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
907190635 1:52645033-52645055 AAGAAGAAGAAGAAGAAGTAAGG + Intronic
907336903 1:53705702-53705724 AACAGGAGGCAGAAGAAGGGAGG + Intronic
908086198 1:60636733-60636755 AACAGGAAGAAGAATTTGGAAGG + Intergenic
908151860 1:61310742-61310764 AAGAGGGAGAAGCAGGAGGAGGG - Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908390661 1:63680699-63680721 AAGAGGCAGCAGAATTAGCATGG + Intergenic
908708229 1:66984608-66984630 AAGAGGAAGTAAAAGTTGAAGGG + Exonic
908826044 1:68133772-68133794 AGGAGGAAGTAGAAGTGGGTAGG - Intronic
909409708 1:75335947-75335969 AAGAGCAAGCACAAGTAACATGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
910045604 1:82910494-82910516 AATATGAATCAGAAGTAGGAAGG - Intergenic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910811856 1:91246250-91246272 ACGAGGAAGTATATGTAGGAGGG + Intergenic
911008753 1:93255777-93255799 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911132555 1:94404638-94404660 AAGGGGATGCAGAAATAGAATGG - Intergenic
911354147 1:96795752-96795774 GAAAGGAAGAAGAAATAGGATGG + Intronic
911393104 1:97270677-97270699 AAGAGGAAGTAAAAGTGAGAGGG + Intronic
911553426 1:99312731-99312753 AAGCAGAAGTAGGAGTAGGAGGG + Intergenic
912069783 1:105795713-105795735 AAGAGGAAGGCAAAGTAGAAGGG + Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912233748 1:107825500-107825522 AAGAGGAAGGAAATGTAGGCAGG + Intronic
912456153 1:109798848-109798870 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
913082967 1:115406759-115406781 AAGAGAAGTCAGCAGTAGGAGGG - Intergenic
913340856 1:117756978-117757000 AAGAGGATGAAGAAGAGGGATGG + Intergenic
913425006 1:118718739-118718761 AAGAGGAAGCTAAAGTAGAGAGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914146357 1:144998565-144998587 AAGAGGAAGAAGGAAAAGGAAGG + Intronic
914250886 1:145920250-145920272 AAGAGAGAGCAGAGGTAGCAGGG - Intergenic
914260699 1:145996809-145996831 GAGAGGAAGGAGAGGAAGGAGGG + Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915112331 1:153572024-153572046 AAGAGGAAGCTGCAGTGAGAAGG - Intergenic
915166847 1:153952690-153952712 GACAGGAAGCAGAAGCAGGTGGG + Intronic
915206388 1:154273383-154273405 ATGAGGAAGAAGAAGAAGAAGGG + Exonic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
915876444 1:159616219-159616241 AAGAGCGAGCAGAAGTAGGGTGG + Intergenic
915964158 1:160292003-160292025 AAGAGATTGCAGAGGTAGGAGGG - Exonic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915981882 1:160425466-160425488 AAGAGCAAGAAGAAGAAGGGTGG - Exonic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916030756 1:160875763-160875785 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916030762 1:160875787-160875809 AAGAGGAAGGGGAAGAAGAAGGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916253948 1:162767084-162767106 AAGAATAAGCAGAAGTATTAAGG + Intronic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917635646 1:176933166-176933188 AAGAGGTAGCAGAGCTATGATGG - Intronic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918724493 1:187901839-187901861 AAGAGGAAGCAGTAAATGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918840236 1:189526376-189526398 ATGAGTAAGCGGAAGTAAGAAGG + Intergenic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919422976 1:197394156-197394178 CAGAGGAAGTGGAAGTAGAAGGG - Intronic
919535548 1:198783125-198783147 GAGAGGAAGCAGCAGAAGGGGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920055914 1:203191567-203191589 AAGAGGAAACAGGAGTAAGGGGG - Intergenic
920107154 1:203561996-203562018 AAGAGGAAGAAGAAGAAAGAAGG + Intergenic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920433002 1:205930656-205930678 AAGAGGATGGAAAAGTAGGCAGG - Intronic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920663002 1:207933995-207934017 GATGGGAAGCAGAAGTATGATGG + Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921109984 1:212026433-212026455 AGGAGGGAGCAGATGAAGGAGGG - Intronic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
922226148 1:223647523-223647545 AAGAGGAAGAGCAAGCAGGAGGG - Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
922574926 1:226655099-226655121 AGGAGGAAGAAGAGGGAGGAAGG + Intronic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
923222349 1:231906810-231906832 AAAAGGAAGCACAAGAAGAAAGG + Intronic
923329264 1:232907475-232907497 AAGAAGAAGAAGAAGAAGTAAGG + Intergenic
923957567 1:239040220-239040242 AAAAGGAGGCAGAAGTTGGAAGG + Intergenic
924006353 1:239615939-239615961 GAGAGGAAGAAGTAGAAGGAAGG - Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
924737132 1:246768394-246768416 CAGAGGAAGCAGAGTTAGGGTGG - Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063034748 10:2275627-2275649 AAGATGAAGCTGGAGTAGGCAGG - Intergenic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063312488 10:4967500-4967522 GAGAGGAAGCAGAAGCAACAAGG - Intronic
1063315444 10:5000065-5000087 GAGAGGAAGCAGAAGCAACAAGG + Intronic
1063499220 10:6537998-6538020 AACAGGAAGGAAAAGAAGGAGGG + Intronic
1063517713 10:6712907-6712929 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063760980 10:9076459-9076481 AGGAGGAAGCAGTAGTTGAAAGG - Intergenic
1063832396 10:9969098-9969120 AAGAGGAAGGGATAGTAGGAAGG - Intergenic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065064103 10:21941806-21941828 AAGAGGAAGCAGACCAAGAAGGG + Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065933426 10:30499738-30499760 AAGAGAGAGCAAAAGAAGGAAGG + Intergenic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067184319 10:44014130-44014152 AAGAGGAAGAAAAAATGGGAAGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1068170622 10:53388909-53388931 AAGGGAAAGCGCAAGTAGGAAGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068174006 10:53433494-53433516 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068623785 10:59216537-59216559 AAGAAATAGCAGAAGTAAGAAGG - Intronic
1068786278 10:60978727-60978749 AAGAAGAAGTAGAAGAAGAAAGG - Intronic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069295293 10:66836338-66836360 ACAAGGAAGCAGAATTAAGATGG - Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070292800 10:75131247-75131269 GAGAAGAAGCAGAATTAGAATGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070360171 10:75680664-75680686 ACGAGGAAGGGGAAGTAGGTAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070689127 10:78511696-78511718 ACCAGGAAGGAGAAGAAGGAGGG + Intergenic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1071083788 10:81844018-81844040 AAAAGGAATCAGAGGTAAGATGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072085632 10:92076762-92076784 AGAAGGAAGAAGAAGGAGGAAGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072567554 10:96629940-96629962 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1072785381 10:98276044-98276066 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1072916013 10:99537622-99537644 AGGAGGAAGAAAAAGAAGGAGGG + Intergenic
1072940127 10:99755555-99755577 AAAATGAAGCGGCAGTAGGAGGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073186621 10:101618911-101618933 AAGAGGAAGCCCATGGAGGAAGG + Intronic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073759828 10:106617284-106617306 AGGAGGAGGCAGAAGGAGGGAGG - Intronic
1073857798 10:107697494-107697516 AGGAGGAAGAAAAAGAAGGAAGG - Intergenic
1074148895 10:110740848-110740870 AAGAGGATGCAGAAGTTAGCTGG + Intronic
1074274811 10:111991049-111991071 AAGAGGAAGAAGAAATGGGTCGG + Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075284462 10:121171724-121171746 AAGAGGAAGGAAAGGAAGGAGGG + Intergenic
1075328350 10:121553252-121553274 AAGAGGAAGGAGGAGAAAGAAGG + Intronic
1075382800 10:122032571-122032593 AAGAGGAACCAGAAGCCCGAAGG - Intronic
1076038308 10:127220304-127220326 AAGAGGAGGCAGGAGTGGGGAGG + Intronic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1077392509 11:2306733-2306755 AGGAGGACGAAGAAGGAGGAGGG + Intronic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1077998898 11:7477002-7477024 AGAAGGAAGAAGAAGAAGGAGGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078282741 11:9919250-9919272 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1078405264 11:11065321-11065343 ATGAGGATACAAAAGTAGGAGGG - Intergenic
1078586011 11:12589749-12589771 AAGAGGCAGGAGAAAAAGGATGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1078822515 11:14895962-14895984 AAGAGGATGCAGAAGGGGAAAGG + Intergenic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079424669 11:20328705-20328727 AAGAGGAAGAGGAAGAAGGAAGG - Intergenic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1079807188 11:24947369-24947391 AAGAGGAGGAAGAGGTAGAAAGG + Intronic
1080160118 11:29163620-29163642 GAGAGGCAGCAGAAGTAGAATGG + Intergenic
1080233110 11:30040128-30040150 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1080285982 11:30612738-30612760 AAGAGGAAACAAAAGAAAGAAGG - Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080438572 11:32269069-32269091 AAAAGAAAGAAGAAGAAGGAAGG + Intergenic
1080549735 11:33362275-33362297 ATCAGGAAACACAAGTAGGATGG + Intergenic
1080754703 11:35185614-35185636 AAGAGGAAGAAGGAGATGGATGG - Intronic
1080756110 11:35200797-35200819 AAGAAGCTGCAGCAGTAGGAAGG - Intronic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1080951266 11:37035903-37035925 AATAGAAAGGAGAAGTAGAAAGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081305338 11:41505044-41505066 AAAAGGAAGAAGAAGAAAGAAGG - Intergenic
1081379857 11:42401021-42401043 AACAGGCAGAAGAAGTTGGAGGG + Intergenic
1081517711 11:43849457-43849479 AGGAGGCCACAGAAGTAGGAAGG - Intronic
1082283219 11:50293470-50293492 AAAAGGAATCAGAAGTATCAAGG + Intergenic
1082284189 11:50301781-50301803 AAGAGGCAGCAGAGGGAGCAGGG - Intergenic
1082665137 11:55966724-55966746 AAGAGGCAGAAGAAGTTTGAGGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082758488 11:57102465-57102487 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083139142 11:60707244-60707266 AAGAGGATGCAGAAGTGAGAAGG + Intronic
1083236993 11:61357346-61357368 AAGAGAAAGCAGAAGTCTCAGGG - Exonic
1083405578 11:62454727-62454749 AAGAGGAAGAAGAGGGAGAAAGG + Intronic
1083949642 11:65947013-65947035 AAGAGTAAGCAGCAGTGGGATGG + Exonic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084165783 11:67374072-67374094 ATGAGGAGGCAGAGGTAGGGTGG - Intronic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084907949 11:72363164-72363186 AAGAGAAAGTAAAAGAAGGAAGG + Intronic
1084911332 11:72391859-72391881 AAGTGGAAGCACATGTAGGAAGG + Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085783189 11:79428034-79428056 GGGAGAAAGCAGAAGCAGGAAGG + Intronic
1085807647 11:79650977-79650999 AGGAGGAAGAAGAAGAAGAAAGG - Intergenic
1085807656 11:79651035-79651057 TGGAGGAAGAAGAAGAAGGAAGG - Intergenic
1085925828 11:81019339-81019361 AAGAGGGAGAGGAAGAAGGAAGG - Intergenic
1086007061 11:82049136-82049158 AAGAGGAAGGAAGAGTGGGAAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086630813 11:89017596-89017618 AAAAGGAAGCAGAAGCTGAATGG + Intronic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087129831 11:94659134-94659156 AAGAGGCAGCAGGAGCAGGTGGG + Intergenic
1087597013 11:100267085-100267107 AAGAGGAATCAGAAGTACTATGG + Intronic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087920627 11:103862738-103862760 AAGAGGAATGAAAAGAAGGAGGG - Intergenic
1088303914 11:108387876-108387898 AAGGGGTAGCAGTAGTAAGAAGG - Intronic
1088381172 11:109194513-109194535 AAGAGGAGGGAGAAGAGGGAAGG - Intergenic
1088836011 11:113578415-113578437 AACAGGAATTAGAAGTTGGACGG + Intergenic
1088938157 11:114425661-114425683 AAGTGGAGGCAAGAGTAGGAAGG - Intronic
1089057622 11:115599380-115599402 AAGAGGAAGTAGAAGGGGAAGGG - Intergenic
1089057625 11:115599386-115599408 AAGGGGAAGAGGAAGTAGAAGGG - Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089240487 11:117074297-117074319 AAGAGGAAGTAGACCTAGGTGGG - Intronic
1089484733 11:118836576-118836598 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1089862514 11:121602604-121602626 AGGAGGAAGGAGAAGAGGGAGGG + Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1089996926 11:122917193-122917215 AAGTGGAAGTAGAAGTACCAAGG + Intronic
1090085676 11:123648844-123648866 AAGGGGATGAAGTAGTAGGAGGG + Intronic
1090556551 11:127882892-127882914 AAAAGGAAAATGAAGTAGGAAGG + Intergenic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091086016 11:132722687-132722709 AAGAGGCATTAGCAGTAGGAGGG + Intronic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091375588 12:22847-22869 AAGAGGGAGCAGCAGCTGGAGGG + Intergenic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1092069580 12:5621816-5621838 AAGAGGAAGAAGAAAGAGAAGGG + Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092743827 12:11654637-11654659 AAGAGGAAGTAGTAGGAGGGAGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093347021 12:18050524-18050546 AAGAGGCAGGTGACGTAGGAAGG - Intergenic
1093425148 12:19020257-19020279 AAGACAAAGCAGAAGCGGGAAGG + Intergenic
1093561987 12:20552565-20552587 AAGTGGAAGCGGAAGTCGGCAGG + Intronic
1093658225 12:21722327-21722349 GAGAGGAAGGAGAAGCACGATGG - Intronic
1093973511 12:25396428-25396450 ATGAGGAAGCATAAGTTTGAAGG + Intergenic
1094003516 12:25722649-25722671 AAGATGAGGTAGAAGAAGGATGG + Intergenic
1094008044 12:25776187-25776209 AATAGGAAGCAGAAGTCAGATGG - Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094502243 12:31032047-31032069 AAGAGGAAGCAGCAGAAAAAGGG - Intergenic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1095362499 12:41360001-41360023 AAGAGGCAGCTGAAGTAGAAAGG - Intronic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096009564 12:48201532-48201554 AAAATGAAGAAGAAGAAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096098788 12:48956668-48956690 AGGAGGCAGGAGAAGGAGGAGGG - Intronic
1096107180 12:49003135-49003157 TAGTGGAAGCAGAGGTAGGGAGG - Exonic
1096226097 12:49867780-49867802 GAGAGGCGTCAGAAGTAGGAAGG - Exonic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096629693 12:52918113-52918135 AAGAAGAGGAAGAAGAAGGAGGG + Intronic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096766811 12:53897810-53897832 AGGAGAAAGCAGAATTACGAAGG + Intergenic
1097157105 12:57020509-57020531 AAGAGGAAGGAGGAATAGGGTGG - Intronic
1097167565 12:57093849-57093871 AAGAGGATGAAGGAGCAGGAAGG + Intronic
1097473184 12:60021365-60021387 AAGAGGAAGGAAGAGTAGAAAGG - Intergenic
1097496637 12:60347100-60347122 AAAAGTAGGGAGAAGTAGGAGGG - Intergenic
1097536288 12:60873898-60873920 ACGCGGAAAGAGAAGTAGGATGG - Intergenic
1097566254 12:61272550-61272572 AAGAGGAAGCATCAGAAGTAAGG - Intergenic
1097789121 12:63795292-63795314 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1097790678 12:63812031-63812053 AGGAGGAAGAAGAAGAAGGAGGG + Intergenic
1097793668 12:63841284-63841306 AAGAGAAAGCAGAGGCTGGAAGG - Intergenic
1097842702 12:64337512-64337534 GAGAGACAGCAGATGTAGGAAGG + Intronic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098192562 12:67966019-67966041 AAGAAGAGGCAGAAGTAGCTTGG - Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098305663 12:69100133-69100155 AAGAGGAAGGAGTATTAAGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099529749 12:83763268-83763290 AAGAGGAGGCAGAGGTAGAGTGG + Intergenic
1100167238 12:91929786-91929808 AAGACCAAGCAGAGGTAGTAGGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1101026144 12:100608890-100608912 AAGAGGAAGAAAGAGTGGGAAGG - Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101358401 12:104003045-104003067 AAGAAGAAGAAGAGGTAGGGAGG + Intronic
1101360529 12:104022036-104022058 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101794126 12:107957118-107957140 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1102166411 12:110810253-110810275 GAGAGGAAGCAGGAGTGGGTAGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102189953 12:110980229-110980251 GAGAGGGAGCAAAAGAAGGAAGG + Intergenic
1102194433 12:111014531-111014553 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1103219489 12:119231949-119231971 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103404558 12:120666218-120666240 AAAAGGAAGAAGAAGAAGGGAGG + Intronic
1104309888 12:127645076-127645098 AAGAGGAAGTAGTGGTAGGCTGG + Intergenic
1104316200 12:127704281-127704303 AAGAGGAAGCAGAAGAAACAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105240650 13:18606814-18606836 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106125042 13:26894317-26894339 CTGAGGTAGCAGAAGTAGGTCGG + Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106184820 13:27400126-27400148 AAGTGGAAGCAAAAGATGGAAGG + Intergenic
1106638565 13:31558289-31558311 AAGAGGGTGCAGAAGTAGCAGGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106909387 13:34446918-34446940 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1106916748 13:34524071-34524093 TTGAGGAAGCAGAAGCAGAATGG + Intergenic
1107152712 13:37130332-37130354 ATAAGGAAGGAGAAGTATGATGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107510217 13:41076176-41076198 AACAGGAAGCAGAAGAAGGAGGG + Exonic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107897124 13:44976329-44976351 AGGAGGAAGGAGAAGAAGAAAGG + Intronic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108640996 13:52382193-52382215 CAGAGGAAGCACAAGTTGTAGGG - Intronic
1108820840 13:54347369-54347391 AAAAGGAAGAAGAATAAGGAAGG - Intergenic
1108941552 13:55962285-55962307 CAAAGTAAGCAGAAGTAAGAGGG + Intergenic
1108949609 13:56074534-56074556 AAGTGAAAGCAGAGGTAGAAGGG - Intergenic
1109148024 13:58807280-58807302 AAGAGGAAGAAGAAGAAATAAGG - Intergenic
1110177479 13:72574217-72574239 AAGAGCCAGAAGAAGTAAGATGG - Intergenic
1111076792 13:83248023-83248045 AAGAAGAAGCTGAACAAGGAAGG - Intergenic
1111231588 13:85351046-85351068 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1112050947 13:95643816-95643838 CAGAGGCAGCAAAAATAGGAGGG - Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112386563 13:98945613-98945635 AAGAGAAAGCAGAGGATGGATGG - Intronic
1112489090 13:99845835-99845857 AAAACGAAGGAGAAGAAGGACGG - Intronic
1112619582 13:101040928-101040950 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1112932027 13:104752893-104752915 ATGAGGAGGCAGATGTAGGTAGG - Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1113325398 13:109276746-109276768 AGGAGACAGCAGAAGCAGGAAGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114004751 14:18300430-18300452 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1115018528 14:28646373-28646395 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115275660 14:31606052-31606074 AGGAGGAAGAAGAAGAAGAATGG - Intronic
1115293728 14:31802265-31802287 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116290276 14:43026387-43026409 GAGAGGAAGCAAGAGTGGGAAGG - Intergenic
1116412893 14:44646584-44646606 AAGAGAGAGAACAAGTAGGAAGG - Intergenic
1117225723 14:53656770-53656792 CAGAGGAAGCAGGACTAGGTGGG + Intergenic
1117312298 14:54539954-54539976 GAGAGGCAGCAGAGCTAGGATGG - Intergenic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119947567 14:78711009-78711031 AAGAAGAAGAAGAAGTATGGGGG - Intronic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120030663 14:79637147-79637169 ACAATGAAACAGAAGTAGGAAGG - Intronic
1120087593 14:80292568-80292590 AAGAGGTAACAGTAGTGGGAGGG - Intronic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120404360 14:84076053-84076075 AAGAGGAGGCAAAAGGAGCAGGG - Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121083067 14:91124330-91124352 AAGAGGAGGCATCAGGAGGAGGG - Intronic
1121109805 14:91304338-91304360 TTCAGGAAGCAGAAGCAGGAGGG + Intronic
1121146232 14:91584987-91585009 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121873713 14:97432088-97432110 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1121954931 14:98205138-98205160 AAGAGGAACCTGCAGAAGGAAGG + Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1123389211 15:19852676-19852698 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1123472157 15:20563172-20563194 AAGAGGAACCAGAAATGGGGTGG - Intergenic
1123645845 15:22437181-22437203 AAGAGGAACCAGAAATGGGGTGG + Intergenic
1123732462 15:23158163-23158185 AAGAGGAACCAGAAATGGGGTGG - Intergenic
1123750597 15:23355545-23355567 AAGAGGAACCAGAAATGGGGTGG - Intronic
1123825767 15:24080815-24080837 AAGAGGAAGAAGAAGAAGAAAGG - Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1123871730 15:24581700-24581722 ATGAGGAGGCAGGAGCAGGAAGG + Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1123899558 15:24862913-24862935 ATGAGGAGGCAGGAGCAGGAAGG + Intronic
1123998606 15:25735708-25735730 ACGTGGAAGCAGGAGTAGGCCGG - Intronic
1124282966 15:28379461-28379483 AAGAGGAACCAGAAATGGGGTGG - Intronic
1124299733 15:28532152-28532174 AAGAGGAACCAGAAATGGGGTGG + Intronic
1124420749 15:29519362-29519384 AAGAGGCAGAGGAAGTAGGAGGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124647685 15:31450474-31450496 AAGAGGAAAAAGGAGTGGGAGGG + Intergenic
1124969900 15:34477271-34477293 AACAGGAAGCTGAAGAAGGAAGG - Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125277265 15:38006173-38006195 ATCAGGAGGCAGAAGCAGGAAGG + Intergenic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126553995 15:49965965-49965987 AAGGGCAAGCAGAAATAGGGTGG + Intronic
1126573017 15:50172146-50172168 AAGAGGGAGCGGGAGTGGGAGGG - Intronic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1126881248 15:53100701-53100723 AAGAGTAGGGAGAAATAGGAAGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127423180 15:58828425-58828447 AATAGAAAGTAGAAATAGGAAGG - Intronic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1127923301 15:63512263-63512285 AAGAGGAAGAAGAAGAAGAGGGG - Intronic
1127999417 15:64176841-64176863 AAGATGAATCAGAGGAAGGAGGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128434878 15:67636946-67636968 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128727980 15:70001820-70001842 AAGAGGAAGAAGAGGAAAGAAGG + Intergenic
1128830594 15:70764404-70764426 AAGAGGATGAAGAAACAGGAAGG + Intergenic
1129173274 15:73821058-73821080 AAGAGGAAGAGGAAGTGGGGAGG + Intergenic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130292612 15:82617059-82617081 AAGAGGACTCAGAGGTAGGTAGG - Intronic
1130367677 15:83254788-83254810 AAGGGGATGGAGAAGTAGCAGGG + Intergenic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131223205 15:90602263-90602285 AAGATGAAGCAGAATTAACAAGG - Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131379825 15:91954584-91954606 AAGAGGAAGTGGAAGTTGGTGGG + Intronic
1131379831 15:91954608-91954630 AAGAGGAAGTGGAAGTTGGCGGG + Intronic
1131413239 15:92228826-92228848 AAGGGGAAGCAGAACAAGAAAGG + Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132066434 15:98734990-98735012 ACCAGGAAGCAGAAATAAGAAGG - Intronic
1132189421 15:99838478-99838500 AACAGGAAGCTGAAGAAGGAAGG + Intergenic
1132927750 16:2440209-2440231 AACAGGAAGAGGAAGCAGGAAGG - Intronic
1133431674 16:5742353-5742375 GAGAGGAAGGAGAGGAAGGAAGG - Intergenic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133520187 16:6549277-6549299 AGGAGGAGGGAGGAGTAGGAGGG + Intronic
1133686280 16:8168325-8168347 AAGAGGAACCAAAACCAGGAGGG + Intergenic
1133717897 16:8466938-8466960 GGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1133850167 16:9495982-9496004 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1133878959 16:9763035-9763057 AAGAGGAAGAAGATGTAGGGAGG - Exonic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134221800 16:12360779-12360801 AAGAGGAAGCATATTTAGGAAGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1135186070 16:20316942-20316964 ACGAGGAAGGAGAAGGAGGGAGG - Intronic
1135218507 16:20593019-20593041 AAGAGAAAGGAAAAGAAGGAAGG - Intergenic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1136748878 16:32615473-32615495 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1137014069 16:35356321-35356343 AACAGGAAGCATGACTAGGAGGG + Intergenic
1137064413 16:35825046-35825068 AAGAGAAACCAGAAATAAGATGG - Intergenic
1137229090 16:46545281-46545303 AAGAGGAGGCAGAAGAGGCAAGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137377973 16:47970525-47970547 GAGAGGAAGCACAAATAGAAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137699448 16:50486183-50486205 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1138150882 16:54655650-54655672 AAGAAAAAGCAGAAGTGGAAAGG + Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138494728 16:57401042-57401064 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138676338 16:58654212-58654234 AAGAGGAAGAAGAGGAAGGTAGG - Intergenic
1138748420 16:59390469-59390491 AAGAGAAAGCAGAACTGGGGAGG - Intergenic
1138858377 16:60723655-60723677 AAGAGAAAGAAGAAGTATAAGGG + Intergenic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1138894829 16:61190829-61190851 AAGAGGAAGAAGAGGAAGAAGGG - Intergenic
1139084557 16:63568693-63568715 AAGATGAAACAGAAGTAAGGTGG + Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139870760 16:70107212-70107234 TAGAGGAGGAAGAAGAAGGAGGG + Intergenic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1139946376 16:70645108-70645130 AGGAGGAAGAAGAGGGAGGAAGG + Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140774994 16:78241320-78241342 AGGAGGAAGCAGACCAAGGAGGG - Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141082117 16:81061707-81061729 CAGGGGAGGCAGAACTAGGAGGG + Exonic
1141208549 16:81955124-81955146 AAGAGTAAGCAGAGGTAAAATGG - Intronic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141775798 16:86121880-86121902 AGGAGGAGGCAGGAGTAGGAGGG - Intergenic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142036697 16:87866844-87866866 ACCAGGAAGGAGACGTAGGATGG - Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1203051011 16_KI270728v1_random:874687-874709 AAGTGGAAGCGGAAGTGTGAGGG + Intergenic
1203139535 16_KI270728v1_random:1752046-1752068 AAGAAGAAGAAGAAGAAGAATGG - Intergenic
1203142496 16_KI270728v1_random:1777482-1777504 AAGAGGAGGCAGAAAGAGAAGGG - Intergenic
1143036295 17:4001160-4001182 AAGAGGAGGAAGAGGCAGGATGG + Intergenic
1143067964 17:4264568-4264590 AAGAGGACGCTGAAGTTGGAAGG + Intergenic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143224527 17:5289159-5289181 AAGAGGAAGAAGAAGAAGAAAGG - Intronic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143632895 17:8148890-8148912 AGGAGGAGGCAGAGGTAGGCCGG + Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144035033 17:11357214-11357236 AAGAAGAAGAAGAAGAAGCAGGG + Intronic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144067375 17:11636767-11636789 AGGAGGAAGCAGAACTTGGTAGG + Exonic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144360239 17:14485220-14485242 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145278985 17:21454936-21454958 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146600103 17:34206589-34206611 AGCAGGAAGCAGAAGAAGAAAGG + Intergenic
1146604914 17:34249881-34249903 AAGAGAAAGAAGAGGTAGCATGG - Intergenic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147256108 17:39183347-39183369 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1147279310 17:39345472-39345494 AAGAGAAAGCAGAAATGGTAGGG + Intronic
1147523033 17:41192781-41192803 CAGAGGACGCAGCAGTACGAAGG + Intronic
1147728115 17:42579400-42579422 AAGAGGAAGCCCAGGTATGAGGG - Intergenic
1147743321 17:42680802-42680824 AGCTGGAAGCAGAGGTAGGAGGG - Intronic
1147834003 17:43317153-43317175 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1147876912 17:43628244-43628266 AAAAAGAAGAAGAAGTAAGAGGG + Intergenic
1148002203 17:44396103-44396125 AAACGGAAGTAGAAGTAGGCTGG - Intronic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148271450 17:46265244-46265266 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1148406062 17:47417284-47417306 AAGAGGAGGCAGAAGAGGCAAGG + Intronic
1148413552 17:47488360-47488382 AAAAAGAAGAAAAAGTAGGAGGG + Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148512142 17:48180312-48180334 AAGAGGGAGAAGGAGGAGGAGGG + Intronic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1148997092 17:51720157-51720179 AGGAGGAATCTTAAGTAGGATGG + Intronic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150135446 17:62692713-62692735 CACAGGAACCAGAGGTAGGATGG + Exonic
1150302258 17:64056301-64056323 AACAGGAAGCACAGGTAGCATGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1150962511 17:69930003-69930025 TAGATGATGCAGAAATAGGAGGG + Intergenic
1151377952 17:73704234-73704256 ATCAGGAAGAAAAAGTAGGAAGG - Intergenic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151803640 17:76391992-76392014 GAGAGGTAGCAGAAGTGGGGGGG + Exonic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152397067 17:80039933-80039955 AAGGGGAAGCAGCAGTGGAAGGG + Exonic
1152398316 17:80048709-80048731 ACGAGGAAGCAGAAGACGAAGGG + Exonic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152626964 17:81392298-81392320 AGGAGGAGGCAGAAGTGGGGAGG + Intergenic
1203170238 17_GL000205v2_random:141719-141741 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1153100641 18:1465182-1465204 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153754479 18:8266068-8266090 AAGAGGAAGAAAAGATAGGAAGG - Intronic
1154448226 18:14452245-14452267 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1154532676 18:15363438-15363460 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155044160 18:22088972-22088994 ACCAGAAAGCAGTAGTAGGAGGG + Intronic
1155069276 18:22299166-22299188 AAGGGGAGGGAGAAGTAGGTAGG + Intergenic
1155231853 18:23781816-23781838 TAGAAGCAGCAGATGTAGGAAGG - Intronic
1155756954 18:29510237-29510259 GATAGGAAGCAGTAGTAAGAGGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155865227 18:30956546-30956568 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1155972993 18:32099244-32099266 AAAACAAAGCAGAAGTAGGAAGG - Intronic
1155986740 18:32238220-32238242 AAGGGGAAGCTGAAGAATGATGG + Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156192747 18:34738568-34738590 AAGAGAAAGGAGTAGAAGGAGGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157098811 18:44711378-44711400 GAGAGGAAGGAAAAGAAGGAAGG - Intronic
1157154102 18:45248154-45248176 AAGAGGAAGGAAATGTAGGGAGG + Intronic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157812123 18:50704759-50704781 AAGAGGATGCAGAGGCAGGGAGG - Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158040409 18:53086248-53086270 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040410 18:53086274-53086296 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040411 18:53086297-53086319 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040412 18:53086323-53086345 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040413 18:53086352-53086374 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040414 18:53086378-53086400 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040415 18:53086401-53086423 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040416 18:53086427-53086449 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158040417 18:53086450-53086472 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158412691 18:57221884-57221906 AGGAGGAAGCAGTGGTAAGAGGG + Intergenic
1158646739 18:59254982-59255004 AAGAGGGAGCGGGAGTGGGAGGG - Intergenic
1158669070 18:59458237-59458259 AAGAGGAAGGAAAGGTTGGATGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1159088732 18:63822668-63822690 AAGAGGAAGTAGAAGAAAGGAGG - Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159744816 18:72219587-72219609 AACAGGAAACAGTGGTAGGAGGG + Intergenic
1159896438 18:74001363-74001385 AAGGGGAGGAAAAAGTAGGAAGG - Intergenic
1159914716 18:74178382-74178404 ACCAGGAAGCAGAGGGAGGAAGG + Intergenic
1159971304 18:74657899-74657921 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1160039274 18:75331234-75331256 AAGAAGATGAAGAAGTAGAAGGG - Intergenic
1160313364 18:77818678-77818700 AAGAGGAAAAAGAGGAAGGAGGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1161404020 19:4081852-4081874 AGGAGGAGGGAGGAGTAGGAGGG - Intergenic
1161557815 19:4954467-4954489 AAGTGGAAGCGGAAGTCGGCAGG + Exonic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1161701163 19:5796352-5796374 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1161756594 19:6138511-6138533 AAGAGGAAGGAGGAAAAGGAAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161934334 19:7362243-7362265 AAGAGGAAGAGGAAGAAGAAAGG + Intronic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162300478 19:9842177-9842199 AAGTGGAAGAAGAAGTGAGAGGG + Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162583065 19:11542182-11542204 AAGAAGAAGAAGAAGAAGGTCGG - Intronic
1162846065 19:13393567-13393589 AGGAGGAAGAAGAAGAAGAAGGG - Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163110670 19:15159499-15159521 AAGAGGAAGCATAAGTAGACTGG + Exonic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163212389 19:15850737-15850759 AAGAGAAGGTAGAAGTAGAAGGG + Intergenic
1163274470 19:16274612-16274634 AAGAGGAAGAAGAGGAAGCATGG + Intergenic
1163276090 19:16285230-16285252 AAGAGGAAGAAGAAAGAGAAGGG + Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1164292349 19:23879809-23879831 ACGAGGAGGAAGAAGAAGGAGGG + Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164858976 19:31547486-31547508 AGGAGGAAGCATAGGAAGGATGG + Intergenic
1164966021 19:32484729-32484751 AAGAGGAAGCAGAACTTGCATGG - Exonic
1165313027 19:35040038-35040060 AACAGGCAGCAGAAGCAGGGTGG - Intronic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165416039 19:35694111-35694133 AAGAGGGAGGAGGAGGAGGAAGG - Intergenic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166051506 19:40263512-40263534 AAGAGGAAGCAGCAGAACCAGGG + Intronic
1166222558 19:41375131-41375153 AGGAGGAAGCAGAGGCAGGTGGG - Intronic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166652145 19:44582693-44582715 AGGAGGAAGAAGGAGAAGGAGGG + Intergenic
1166652156 19:44582732-44582754 ACGAGGAAGAAGGAGAAGGAGGG + Intergenic
1166672688 19:44720855-44720877 TTTAGGAAGCAGAGGTAGGAGGG - Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167429113 19:49444080-49444102 AAGAGAAAGAAGAGGAAGGAAGG - Intergenic
1167442631 19:49517531-49517553 AAGAGGAAGGAAAGGAAGGAAGG + Intronic
1167573233 19:50303807-50303829 GACAGGAAGCAGCAGTAGTATGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167689458 19:50975905-50975927 AACAGGAAGAACAGGTAGGAGGG + Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167747935 19:51363802-51363824 GACAGAAAGCAGAGGTAGGAGGG + Intronic
1167774081 19:51543367-51543389 AAGAGGAAGCAGAGGCAGATAGG + Intergenic
1167863729 19:52307039-52307061 AAGAGGAATCAGAGGAAGAAGGG - Intronic
1167867133 19:52337373-52337395 GAGAGGAAGCAGAGATAGGGAGG + Intronic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
1168688204 19:58361244-58361266 AACGGGGAGCAGAGGTAGGAGGG + Intronic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925231456 2:2236755-2236777 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925878319 2:8330294-8330316 AAGAGGAGGCAGGTGTGGGAGGG + Intergenic
926109382 2:10172322-10172344 TGGAGGCAGCAGAAGTGGGAGGG - Intronic
926509895 2:13761786-13761808 CAAAGGAGGCAGAAGTGGGAAGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927178988 2:20430677-20430699 AAGCGGAAGCAGATGAAGGTGGG - Intergenic
927328317 2:21832362-21832384 AAGAGGAACCAGCAGTGGGCGGG + Intergenic
927493737 2:23538134-23538156 AATAAGTAGCAGAACTAGGATGG + Intronic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
927827173 2:26316951-26316973 AAGAGGAAGCTGAGGCAGCAGGG + Exonic
927923756 2:26994804-26994826 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
928268248 2:29830992-29831014 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
928469940 2:31564463-31564485 AAAAGAAAGGAGAAGTAGGGAGG + Intronic
928538484 2:32262361-32262383 AAGAGGAAGAAGATAGAGGAAGG + Intronic
928592896 2:32835344-32835366 GAGAGGAAGCAGAAGAGAGAGGG - Intergenic
928697662 2:33865922-33865944 AAGAGGATGGTGAAATAGGATGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929374080 2:41262952-41262974 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929604070 2:43224120-43224142 AAGAGGAAACCGAAAAAGGAGGG + Exonic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930140908 2:47950575-47950597 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
930161860 2:48166783-48166805 AATAGGGAGCAGAAGAAAGAGGG - Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
930957900 2:57226175-57226197 AAGAGGAAGCAATAATTGGACGG - Intergenic
930970255 2:57386225-57386247 AAGAGGAAGGAGTAGTTGGAAGG + Intergenic
931341216 2:61402386-61402408 AATAGGAAAGAGAAGAAGGAAGG + Intronic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931455540 2:62407242-62407264 AAGAGGAAGGAAGAGAAGGATGG - Intergenic
931801280 2:65760465-65760487 CAAAGGAAGAAGGAGTAGGAAGG + Intergenic
931992793 2:67807873-67807895 AAGGGGAAGAAGAAGAAGAAGGG - Intergenic
932076150 2:68664869-68664891 AAAAGGAAGGAAGAGTAGGAGGG + Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932208151 2:69902231-69902253 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
932208155 2:69902255-69902277 AGGAGGAAGGAGAAGAAAGAAGG - Intronic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932265723 2:70365564-70365586 AAGAGGAAGGGGTAGTAGTATGG + Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933666447 2:84969035-84969057 AAGAGTAAGCAGAAATATTATGG - Intergenic
933998740 2:87688910-87688932 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
934060065 2:88284634-88284656 AAGAGGAGGCAGAGGTGGGGAGG + Intergenic
934107899 2:88712854-88712876 AAGAAGAAGAAGAAGAAGCAAGG - Intronic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
934535331 2:95128662-95128684 ATAAGGAAGAAGAAGTAAGAAGG + Intronic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935159113 2:100513792-100513814 TAAAGAAAGCAGAAGTTGGAAGG - Intergenic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935384273 2:102484889-102484911 AGGAGGGAGCAAGAGTAGGAGGG - Intronic
935501543 2:103846852-103846874 AAGAGGAAGAGGAAGAAGGAAGG + Intergenic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
936295110 2:111261968-111261990 AAGAAGAAGAAGAAGAAGCATGG - Intergenic
936493690 2:112998765-112998787 AAGAGGGATCAGGAGTAGGTAGG + Intergenic
936508419 2:113126656-113126678 GGGAGGAAGCAGGTGTAGGAAGG - Intronic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
936855010 2:116947312-116947334 AATTTGAAGCAGAAGTAGAATGG + Intergenic
936855304 2:116950877-116950899 AATTTGAAGCAGAAGTAGAATGG + Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
936946998 2:117940175-117940197 AAGAGGAATACGGAGTAGGAGGG + Intronic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937009206 2:118546544-118546566 AAGAGGAGTCATAAGCAGGAGGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217393 2:120321345-120321367 AGGAGGAGGGAGAAGAAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937518004 2:122677479-122677501 AACAGGACGCAGAAGAAAGAGGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
938016021 2:127867786-127867808 AAGAGGAAGGAAAGGAAGGAAGG + Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938397493 2:130962251-130962273 AAAAGGAAGCAGAGGCTGGAAGG + Intronic
938531774 2:132194665-132194687 AGGAGGAAGCAGGAGAAGGTGGG - Intronic
938605898 2:132892247-132892269 ATCTGGAAGCAGAAGTAAGAAGG - Intronic
938794344 2:134705591-134705613 CAGAGGAAGCCGGGGTAGGAAGG - Intronic
939159261 2:138566924-138566946 AGGAGTTAGCAGAAGTAAGAAGG + Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
940972170 2:159906014-159906036 AAAAGCAGGCAGAAGTTGGAAGG + Intergenic
940972767 2:159911714-159911736 AAGAGGAAGCAGCAGCAGTAGGG - Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
941995242 2:171595743-171595765 GAAAGGAAGGAGAAGAAGGAAGG + Intergenic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942299380 2:174547335-174547357 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
943636258 2:190310030-190310052 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
943913173 2:193593807-193593829 AAGAGGAAGAAAGAGCAGGAAGG + Intergenic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944900344 2:204207560-204207582 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
945243475 2:207697713-207697735 GACAGGGAACAGAAGTAGGAAGG + Intergenic
945356017 2:208840794-208840816 AAGAGGAAGCATCAGGAGTATGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
946123052 2:217533223-217533245 AAGAGGAAGCAGTAATACAAGGG - Intronic
946346486 2:219115166-219115188 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946739477 2:222787817-222787839 AAGAGGACTCAGAAGTGGGCAGG + Intergenic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947077035 2:226355862-226355884 AAGAGGATGCAAAGGAAGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947543344 2:230993438-230993460 AAGAAGAAGAAGAAGAAGGTGGG + Intergenic
947619507 2:231580593-231580615 AAGAGGGAGGAGGAGGAGGAGGG + Intergenic
947627718 2:231631014-231631036 AAGAAGAAGCAAAAGTTGGCCGG + Intergenic
947706856 2:232283237-232283259 TAGAGGTGGCAGAACTAGGATGG + Intronic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168856127 20:1010391-1010413 AGGAGGAAGAAAAACTAGGATGG + Intergenic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169655242 20:7915353-7915375 AAGGGGAAGGAGAAGAAGAAGGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169798050 20:9486254-9486276 AGGAGGAGGAAGAAGAAGGAGGG - Intergenic
1169940037 20:10927033-10927055 AAGAAGAAGAAGAAGAAGCATGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170030667 20:11940619-11940641 AAGAGGCAGCTGTAGTTGGATGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170532645 20:17309892-17309914 AAGAGGAAGAAGAAGAAGAAAGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171198688 20:23223923-23223945 AAGACGAGGCTGAGGTAGGAAGG + Intergenic
1171202629 20:23254531-23254553 AGGATGAAGGAGAAGAAGGAAGG + Intergenic
1171444980 20:25196467-25196489 AAGAGGAAGGAGAGATGGGAGGG + Intronic
1171983914 20:31646086-31646108 GAGAGGAAGCAGGAGTAGGTTGG + Intergenic
1171993585 20:31715355-31715377 AGGAGGATGGAGAAGTAGGTGGG - Intronic
1172729953 20:37078722-37078744 TAGAGGAAGAAAAAGTAGAATGG + Intronic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1172928641 20:38564911-38564933 AAGAAGAAGAAGAAGAAGAAGGG - Intronic
1173107593 20:40152338-40152360 CAGATGAAGCAGAAATATGAGGG + Intergenic
1173596936 20:44264538-44264560 AAGAGGAAGCTGGAGAACGAGGG + Exonic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173841811 20:46162411-46162433 AAGAGATAGAAGAGGTAGGAAGG - Intergenic
1173965252 20:47107780-47107802 AAGAGGAAGAGGAAGAAGGAAGG + Intronic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174166103 20:48584585-48584607 AGAAGGAAGAAGAAGAAGGAAGG - Intergenic
1174570192 20:51495899-51495921 AGGAGGATGCTAAAGTAGGAAGG + Intronic
1174709505 20:52690030-52690052 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1174855172 20:54037821-54037843 AAGAGAAAGAAGAAATAGAAGGG + Intronic
1175252751 20:57619322-57619344 AAGAGGAACCTGAAGCCGGAGGG - Intronic
1175271550 20:57737564-57737586 AAAAGGAAGGAAAAGAAGGAAGG - Intergenic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176326229 21:5503515-5503537 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1176401528 21:6317436-6317458 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1176422044 21:6523931-6523953 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1176435629 21:6671668-6671690 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176459891 21:6998738-6998760 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176483452 21:7380516-7380538 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177618526 21:23556566-23556588 AAGAGGAAGAAGAAGAAAAAGGG + Intergenic
1177899269 21:26893842-26893864 AAGAGGAAGGAGACCAAGGAAGG - Intergenic
1178842661 21:36150385-36150407 AAGAGGAAGAAGAAATAAAAGGG - Intergenic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1178976002 21:37221405-37221427 AACAGGAAGCGGAAGCAGGAAGG + Intergenic
1178982124 21:37273518-37273540 AAGAGGGAGAAGGAGGAGGAGGG + Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179416866 21:41205575-41205597 AAGACACAACAGAAGTAGGAAGG - Intronic
1179488587 21:41726499-41726521 AGGAGGAAGGAGGAGCAGGAAGG - Intergenic
1179697534 21:43132246-43132268 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1180429265 22:15231220-15231242 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182148250 22:28010743-28010765 AAGAGGATGAAGCAGAAGGAAGG - Intronic
1182358398 22:29733165-29733187 CAGAGGGAGCTGAAGTGGGAAGG - Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182651236 22:31852916-31852938 AAGAGGCAGCTGAAGCTGGATGG + Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1182769615 22:32785027-32785049 AAGAGGGAAGAGAATTAGGAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183022021 22:35034949-35034971 AAGAGGAAGCGGTGGTAGGAGGG + Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184509343 22:44924038-44924060 AAGAGGAGGAAGAAGAGGGAGGG + Intronic
1184620342 22:45671973-45671995 ACGAGGAGGGAGGAGTAGGATGG - Exonic
1184911351 22:47536614-47536636 AAGAGGACGCACAAGCAGAAAGG + Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1185329044 22:50243636-50243658 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
1185396172 22:50590664-50590686 AAGAGGAAGAGGAAGAGGGAGGG - Intronic
949123074 3:411438-411460 AAGAGAAAGCTCAAGTATGAAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949924736 3:9032117-9032139 AACAGGAAGCAAAACTAGGTGGG + Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951501494 3:23392512-23392534 AACAGGAAGAAGAAGAGGGAGGG + Intronic
951530763 3:23696051-23696073 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
951534678 3:23729874-23729896 AAAAGGAAGCAGGAGTGGGCAGG - Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
951638185 3:24803461-24803483 AAAAGGAAGCAGATTTAGGAGGG - Intergenic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953199074 3:40761590-40761612 AAGAGGAAACACAAGAAGAAAGG + Intergenic
954093897 3:48307429-48307451 AAGAGGAAGTGGAAGAAGGAAGG - Intronic
954337545 3:49928611-49928633 AAGAGGGAGCAGGAGTGGTAGGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955274306 3:57533057-57533079 AAGGGGAGGGAAAAGTAGGAAGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955524356 3:59805390-59805412 AGAAGGTAACAGAAGTAGGAAGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956032214 3:65050693-65050715 AAGAGAAAGCAGAAGTTGCAAGG - Intergenic
956219229 3:66884361-66884383 AGGAGGAAACAAAAGAAGGAAGG + Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956586348 3:70869285-70869307 AAGAGGCAGCAGAAATTGGCAGG - Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957315806 3:78575200-78575222 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957404942 3:79765358-79765380 AAGAGGAAGCAGCAGCAGCTCGG - Intronic
958032668 3:88131745-88131767 AAGAGGTAGAAGAAATAAGAGGG - Intronic
958531280 3:95334095-95334117 AAGAGGAAGCAAAAGAGAGACGG - Intergenic
958723258 3:97872487-97872509 AAGAGAAATCAGAAATAGCAGGG - Exonic
958830721 3:99085491-99085513 TAGAGGAAGCAGAAGTTTGCTGG - Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959426300 3:106193046-106193068 AAAATGAAGTAGAAGAAGGAAGG - Intergenic
959580988 3:107982086-107982108 AAGAGGAAGGTGAAAAAGGAAGG + Intergenic
959667792 3:108941185-108941207 AAGAGGAATGAGAAGTAGCGGGG - Intronic
959951159 3:112181936-112181958 AAGACAAAGCTGAAGTAGGCAGG + Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960396062 3:117138893-117138915 AAGAGTACTCAGAAGTAGAAAGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960493028 3:118340486-118340508 AAGTGGATGGAGAAGTAGCATGG - Intergenic
960623961 3:119662156-119662178 AAAAGGAAGGAGAAGAAAGAAGG + Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
960812595 3:121638710-121638732 AAGAGTAAGCATAAGAAAGATGG + Intronic
960840039 3:121948402-121948424 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
960864563 3:122185837-122185859 AAGATGTAGGAGAAGTTGGAGGG + Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961696375 3:128708079-128708101 CAGAGGAAGAAAAAGTTGGAGGG + Intergenic
961869382 3:129976783-129976805 AAGAGGAAGAGGAAGAAGGGGGG + Exonic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962002950 3:131318158-131318180 AAGAGGAAGAAGAGGTGGGAAGG + Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962734912 3:138317178-138317200 GAAAGGAGGGAGAAGTAGGAAGG - Intronic
963090477 3:141478985-141479007 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
963284538 3:143420432-143420454 AAGATGAGGCAGAACTAGGATGG - Intronic
963443773 3:145374971-145374993 AAGAGGAAGGAAGAGTAAGAAGG + Intergenic
963649882 3:147965710-147965732 TAAAGGAAGCAGAATAAGGATGG - Intergenic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963848376 3:150182448-150182470 AAGAGGAACCACAAGGTGGAAGG + Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964703456 3:159593707-159593729 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
965454379 3:168879749-168879771 AAGAGGAAGAAAGAGTAGGGAGG - Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
965985684 3:174750398-174750420 AAGAAGAAGAAGAAGAAGAATGG - Intronic
966022454 3:175232139-175232161 AAGAGGAAGAGGAAGAAGAAGGG + Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966374936 3:179286804-179286826 AAGAGGAAACAAAGGTAGGAGGG - Intergenic
966522167 3:180885606-180885628 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966568160 3:181406738-181406760 AAGATGCGGCAGAAGAAGGAAGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966607529 3:181836243-181836265 AAGAGGAGGCAGAAAAATGAAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967170577 3:186820200-186820222 ACGAGGCAGCAGCAGTAGCATGG + Intergenic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968402898 4:313974-313996 AGGAGGAAGAAGAAGAAGAAGGG + Intergenic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969080977 4:4617802-4617824 AAGAGGAGGAAGAAGGAGGTAGG - Intergenic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969234710 4:5857697-5857719 ACTAGTAAGCAGAAGAAGGAAGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970010629 4:11454995-11455017 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
970470504 4:16374014-16374036 AAGAGGGAGTAGAAGTAGACAGG + Intergenic
971088950 4:23316935-23316957 TAAAGGAAGGAGAAGTAGAATGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971132463 4:23827835-23827857 AAGAGGAAGAAGAAGAGGAAGGG + Intronic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971153789 4:24061431-24061453 CAAAGGAAGTAGAAGCAGGATGG - Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
971711943 4:30124295-30124317 AAGAGGGAGAAGAAGTAGATGGG - Intergenic
972361232 4:38327305-38327327 AAGAGGCAGCAGAATAAAGATGG - Intergenic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
972675274 4:41254535-41254557 AAGAAGAAGAAGAAGAAGTAGGG - Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
972826116 4:42761119-42761141 AAGAGGCAGCAAATGTAAGAAGG - Intergenic
972838249 4:42901462-42901484 TAGTGGAAGCAGAAGTCAGAAGG - Intronic
973306684 4:48659951-48659973 AAGAAGAAGAAGAAGAAGAAAGG + Intronic
973582429 4:52357597-52357619 AACATGATGCAGAAGTTGGAGGG + Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
973666528 4:53164811-53164833 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
973955030 4:56055109-56055131 AAGAGGAATTAGAAAAAGGAAGG + Intergenic
973962783 4:56128547-56128569 AAGTGGAAACACAATTAGGAAGG + Intergenic
974089091 4:57291930-57291952 AAGAGCTAGCTGAAATAGGAAGG - Intergenic
974091952 4:57320934-57320956 AGGAGAAAGCAGAGGAAGGAAGG - Intergenic
974414911 4:61594895-61594917 AAGAGGAAGGAAGAGTGGGAAGG - Intronic
974782259 4:66567863-66567885 AAGTGGAATCAGATGTAGAATGG + Intergenic
974845403 4:67345712-67345734 AAGATAGAGCAGAAGCAGGAAGG - Intergenic
975362335 4:73485634-73485656 AAGAGGAAGAAGAAGAAGAAGGG + Intronic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976143260 4:82015296-82015318 AGGAGGAGGGAGAAGAAGGAAGG + Intronic
976431467 4:84966775-84966797 AAGAGGAAGGAAAGGCAGGAGGG - Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
977002885 4:91525734-91525756 AAGAAGAAGCATAGGTAAGAGGG - Intronic
977242648 4:94591740-94591762 AAAAGGAAGCAGGAGTGGGTAGG - Intronic
977349754 4:95867518-95867540 AAGAGGCAGCACTAGGAGGATGG - Intergenic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
977595001 4:98868923-98868945 AAGAAGAAGAAGAAGTTGGGTGG + Intergenic
977611231 4:99034184-99034206 GAGAGGAAGGAGGAGAAGGAGGG - Intronic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
978268527 4:106858860-106858882 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978497357 4:109374743-109374765 AGGAGGAAGAAGAGGAAGGAAGG + Intergenic
978543604 4:109846245-109846267 AAGAGGAAAAAGAAATTGGATGG - Intergenic
978613614 4:110571645-110571667 AAGAGGGAGCAGCAATAGGCAGG - Intergenic
979137335 4:117126377-117126399 TAGATGAGGCAAAAGTAGGAAGG - Intergenic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
980127883 4:128790839-128790861 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980841057 4:138261880-138261902 AAGAGGAAGAAGAAGGAAAAAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981056004 4:140362273-140362295 AAGAAGAAGAAGAAGAAGTAAGG - Intronic
981511432 4:145562815-145562837 AAGAGAATGGAGAGGTAGGAAGG + Intergenic
981596230 4:146425896-146425918 TAGAGGAAGCAGAGGTAGGGAGG - Intronic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
982091928 4:151887663-151887685 AATGGGAAGCAGAACTAGGCTGG - Intergenic
982240646 4:153296256-153296278 AAGAGGAAGAAGAGAAAGGAGGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983201448 4:164864492-164864514 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
983968953 4:173847499-173847521 AAGAGAAAGCAGAAAAAGGTCGG - Intergenic
984471870 4:180186371-180186393 AGAAGGACCCAGAAGTAGGATGG - Intergenic
984523346 4:180826616-180826638 AAGAAGAAGAAGAAGAAGCAAGG + Intergenic
984527876 4:180878815-180878837 AATAGGAAGAAGAAGCAGAAAGG + Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984913421 4:184698178-184698200 AAGAGGAAGGAGCACTGGGAAGG - Intronic
985148820 4:186923863-186923885 AAGAGGAAGATGAAGAAGGGTGG + Intergenic
985192346 4:187389571-187389593 AAGAGTAACCAGCAGAAGGAGGG + Intergenic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985231946 4:187827890-187827912 AAGAGGAAACATTAGTAGTAAGG - Intergenic
985294827 4:188425512-188425534 AAGAGAAAGCAAGAGCAGGATGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986002880 5:3643778-3643800 AGGAGGAAACAGCAGCAGGAGGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986657518 5:10030301-10030323 AAGAGGAGGAAAGAGTAGGAAGG - Intergenic
986720038 5:10554386-10554408 AAGAGGAAGAAGCAGTGGAAAGG + Intergenic
986989111 5:13531207-13531229 AAAAAAAAGAAGAAGTAGGAAGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
987729660 5:21752732-21752754 TAGAGGAAGTAGAGGAAGGAAGG + Intronic
987911752 5:24155501-24155523 AAGTGGAAGGAAAAGTGGGAAGG + Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988729938 5:33962038-33962060 TGGAGAAAGCAGAAATAGGAAGG - Intronic
988890959 5:35617174-35617196 AAGAGGAAGAAAAAGAAGAAGGG - Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989104850 5:37852412-37852434 AGAAGGAAGCAGAAGAAGGGAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990114347 5:52369672-52369694 AGCAGGAAGGAGAAGAAGGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990379507 5:55208062-55208084 AAGAGGAAGAAGAAGAAGAAAGG + Intergenic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990624786 5:57598689-57598711 AAGAGGAAGCAGAGGCAAGGAGG - Intergenic
990629848 5:57656306-57656328 ATGAGGAAGCTGAAGAAGAAAGG + Intergenic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992095851 5:73361833-73361855 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992737867 5:79742021-79742043 AAGAGGGAGGAGGAGGAGGAAGG - Intronic
992971098 5:82058921-82058943 AAGAGAAACCAAAAGTATGACGG - Intronic
993290858 5:86067979-86068001 AAGAGGAAGAAGAAAAAGAAAGG + Intergenic
993315213 5:86395475-86395497 AGGAGGAAGCAGAAGAGGAAGGG + Intergenic
993812022 5:92492191-92492213 AGGAGCAAGCAGAGGTTGGAGGG - Intergenic
993869524 5:93235640-93235662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
994302722 5:98165079-98165101 GAAAGGAAGCAGAAGCAGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994606263 5:101971072-101971094 TGGAGGAAGTTGAAGTAGGAAGG - Intergenic
994784309 5:104136577-104136599 AAGAGGAACCAGCAGAAGGTGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994858633 5:105159134-105159156 AAGAGGAGGAAGAAATAAGAAGG + Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995541987 5:113194674-113194696 AAGAGGAAGAAAAAGAAGAAAGG + Intronic
995821771 5:116242675-116242697 TGGCTGAAGCAGAAGTAGGAGGG - Intronic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996127536 5:119744002-119744024 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
996270256 5:121596247-121596269 AAGGGGAAGCAGAAGTCCAAAGG + Intergenic
996546794 5:124687891-124687913 AAGAGGAAATAAAAGTAGCAGGG + Intronic
996732073 5:126726095-126726117 AAGAGGAGGAAGAAGAAAGAAGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997437435 5:133885467-133885489 AAGAGGAGGCAGAGAAAGGAGGG + Intergenic
997492969 5:134294648-134294670 AAGATGAAGGAGAAGAAGAAAGG + Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997743329 5:136277108-136277130 AAGAGGCAGCAGCAGAAGCATGG - Intronic
997771767 5:136561639-136561661 AAGAGGAAGGAGGAGAAGGAGGG - Intergenic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998676213 5:144411035-144411057 AAGAGGATGCAAAAATAGAAAGG + Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998912938 5:146980517-146980539 AAAAGGAAGGAGAGGAAGGAAGG + Intronic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000485407 5:161836150-161836172 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000590886 5:163156222-163156244 AAGAGGAAGCATAAGGAACAAGG + Intergenic
1000829940 5:166090243-166090265 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001661609 5:173397342-173397364 AAGAGGGAGCTGAAGAGGGAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001904853 5:175463180-175463202 GAGAGGAAGCAGGATTAGGCAGG + Intergenic
1002131245 5:177083013-177083035 AAGAGGAAGCTGGAGCATGACGG + Intergenic
1003142005 6:3479564-3479586 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1004216439 6:13708865-13708887 AAGAGGAAGAGGCAGTAGAAAGG + Intronic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004482655 6:16035651-16035673 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1004698444 6:18056050-18056072 AAGAAGCCGCAGAAGTTGGAGGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005598406 6:27401644-27401666 GAGAGGGAGAAAAAGTAGGAAGG - Exonic
1006216643 6:32449331-32449353 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1006278674 6:33028757-33028779 AAGAGGAAGCAGTAAAAGGTGGG + Intergenic
1006406034 6:33845573-33845595 CAGAGGAAGCAGATGTGAGAAGG - Intergenic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1006781231 6:36633749-36633771 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1006937289 6:37727335-37727357 AAGAGGAAGGAGAAAAAGTAGGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007510971 6:42374160-42374182 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1008391887 6:50961752-50961774 AGAAGGAAGCAGATGTAAGAAGG - Intergenic
1008527147 6:52418678-52418700 AACAGGAAACAGATGTAGTAAGG + Intergenic
1008863181 6:56176615-56176637 AAGAGGAAGGAAAAGAGGGAGGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1009952877 6:70416774-70416796 AAGAGGAATAAGAAGCAGAATGG + Intronic
1010335569 6:74678913-74678935 AAGAGAAAGAAGAGGAAGGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1010952213 6:82050155-82050177 GAGAAAGAGCAGAAGTAGGAAGG - Intergenic
1011014923 6:82744037-82744059 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012494383 6:99818522-99818544 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1013164782 6:107579936-107579958 AGGAGGATGGAGAATTAGGAGGG + Intronic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013346329 6:109264015-109264037 AAGAGGAAGAAGAATAAAGAAGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013687513 6:112601954-112601976 AAGAGGAGGGAAGAGTAGGAAGG + Intergenic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014543757 6:122708196-122708218 AAGAGGAATTAGAAGCTGGAGGG + Intronic
1014766806 6:125416534-125416556 AAGAGGATGCATAAGTTTGAGGG + Intergenic
1014869931 6:126581410-126581432 AAGAGGAAGGAAAGGAAGGAAGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015113337 6:129619210-129619232 AAGGGGAAGAAGAGGTGGGAAGG + Intronic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015697280 6:135995059-135995081 AAGAGGATGCAGAGTTGGGAGGG - Intronic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016121625 6:140349527-140349549 AAAAGAAGGTAGAAGTAGGATGG + Intergenic
1016142844 6:140634344-140634366 AAGAGGAAAGAGAGGAAGGAAGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016862189 6:148731829-148731851 AAGAGGAGGCAGAAGAAGAGGGG + Intergenic
1016987477 6:149905929-149905951 AAAAGGAAGCAGAAGCAGAAAGG + Intergenic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017665118 6:156712564-156712586 AAGAGGAAGAGGAGGAAGGAAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018089456 6:160333155-160333177 AAGAGGGAGGAGAGGTGGGAAGG + Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018609956 6:165638358-165638380 AAGAGGAAGGACGAGAAGGAAGG + Intronic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1019049229 6:169170372-169170394 GAGAGGGAGCGGAAGGAGGAAGG - Intergenic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019201586 6:170320809-170320831 AGGAGGAAGGAGAATAAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019464175 7:1177506-1177528 CTCAGGAAGCAGAAGCAGGAGGG - Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484141 7:1280823-1280845 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484170 7:1280976-1280998 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019535372 7:1526482-1526504 AGGAGGAAGAGGAAGAAGGAGGG + Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020261241 7:6531743-6531765 AAGAGGAAGGAGCCGTGGGAGGG + Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG + Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022151828 7:27616153-27616175 AAGAGGAAGCAAGAGAAAGAAGG + Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1022989424 7:35693958-35693980 AAGAGGAAGCAGAAATATCAAGG - Intronic
1023006400 7:35873783-35873805 AAAAGGAATCAGAAGTATCAAGG - Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023479300 7:40615809-40615831 AGGATGAAGCAGAAGAAGGTGGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023597659 7:41849116-41849138 TACAGGAAGCACAAGTAGGAAGG + Intergenic
1023693433 7:42818639-42818661 AAGAGGAAGAAGGAGAAGGAAGG + Intergenic
1024469954 7:49757703-49757725 AAGAGGAAGCACAAGAAAAATGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026103728 7:67404031-67404053 AAGATGAATGAAAAGTAGGAAGG - Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205680 7:68255344-68255366 AAGACGAAGAAGAGGAAGGAAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026236634 7:68532828-68532850 AAAAGAAAGCAGAATTAGGCCGG - Intergenic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1027171790 7:75878084-75878106 AAGAGGAAACAGGACTAGGGAGG - Intronic
1027708398 7:81566141-81566163 AAGAGGGAGAAGAAGTATTAGGG + Intergenic
1027735123 7:81922337-81922359 AAGAGGAATCATAAGAAAGAGGG - Intergenic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1027864907 7:83633151-83633173 AGGAGGAAGGAAAAGGAGGAAGG - Intronic
1027925948 7:84463780-84463802 AAGAGGGAGGAAAAGTGGGAGGG - Intronic
1028117014 7:87009661-87009683 AAAAGGAAGCAGAAGAAGACTGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028857525 7:95608526-95608548 AAAAGGAAGTACAAATAGGAAGG + Intergenic
1028896940 7:96052316-96052338 AAAAGAAAGCAGAAGTTTGAAGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029292292 7:99511348-99511370 AAGAGGAAACAGAGGTGAGAAGG - Intronic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1029872042 7:103704730-103704752 AAAAGGGAGCAAAAATAGGAAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030306055 7:108019726-108019748 AAAAGGAAGAAGGAGTAGAATGG + Intergenic
1030451019 7:109710987-109711009 AAGAGGAAGAAAAAGAAGAAGGG + Intergenic
1030552494 7:110980510-110980532 AAGATGAAGCACAAATAGGCCGG - Intronic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031377609 7:121047644-121047666 AAGAAGAAGAAGAAGAAGAAAGG - Intronic
1031405427 7:121379960-121379982 AATAGGAAGCAGATTTTGGAGGG - Intronic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031759904 7:125699467-125699489 GGGAGGAAGCAGAAGTAAGAAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031844505 7:126788490-126788512 AAGATGTAGTATAAGTAGGATGG - Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031998527 7:128248796-128248818 AAGTGGAATCAGGAGTGGGAAGG - Intronic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1032953147 7:136939137-136939159 ATGAGGAAGCAGTAGCAGAAGGG + Intronic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033662960 7:143415598-143415620 AAGGGGAAGCTGAAGTTGAAGGG + Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034013380 7:147555223-147555245 AAAAGGGAGCAGAATAAGGAGGG + Intronic
1034099655 7:148439822-148439844 AAGAGAAAGAATATGTAGGAGGG - Intergenic
1034607355 7:152329609-152329631 AAGAGGAAAAGGAAGTAGAAGGG + Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034711745 7:153198745-153198767 AGGAGGAAGGAAAAGGAGGAAGG - Intergenic
1034944915 7:155255640-155255662 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035117456 7:156536600-156536622 GAGAGGGAGCAGGAGCAGGAGGG + Intergenic
1035393863 7:158523153-158523175 CACAGGAAGCACAAGTTGGAGGG + Intronic
1035424071 7:158755460-158755482 AAAAGGAAGCAGTTGTAGAATGG + Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036912496 8:12768748-12768770 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037083294 8:14814356-14814378 GAGAGGAGGTAGAAGAAGGAAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037296753 8:17409955-17409977 ACGAGGCTGGAGAAGTAGGAAGG + Intronic
1037540482 8:19865769-19865791 AAGAGGAAAGAAAGGTAGGAAGG + Intergenic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037763937 8:21760139-21760161 TAGAGGAAGTAGAAGTCAGAGGG + Intronic
1037777963 8:21848137-21848159 AGGTGGAAGCAGGTGTAGGAGGG - Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038284998 8:26198614-26198636 AGGAGGAAGAAGAAGAAGAAGGG - Intergenic
1038308314 8:26424523-26424545 AGGAGGAAGCAGAAGTAGATGGG + Intronic
1038668021 8:29558119-29558141 AAGAAGAAGAAGAAGAAGAATGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038795226 8:30703747-30703769 AGGAGAAAGAAGAAGAAGGAAGG + Intronic
1039217879 8:35293182-35293204 AAGAGGTAGTGGAAGTAGAAGGG + Intronic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039478412 8:37854020-37854042 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1039566625 8:38556575-38556597 AAGAAGAAGAAGAAGAAGAAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040384026 8:46901067-46901089 GAGAGAAACCTGAAGTAGGAGGG - Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041328029 8:56689831-56689853 AAGAGGTAGCAGAAGTTGTATGG - Intergenic
1041600497 8:59711824-59711846 AAGAGGGAGCAGGAGTAGGTGGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041758524 8:61339199-61339221 AAGAGGAAACAGGAGAAGCATGG + Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042208517 8:66353170-66353192 AAGAGGAAGCAAGAGTCAGAGGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042317863 8:67443365-67443387 AAGAGGAAGCAAGAATAGGCAGG - Intronic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1042936503 8:74064550-74064572 GAGAGGGAGCAAAAGTAGGGAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042963990 8:74331224-74331246 CACAGGAAGCAGGAGTAGGCGGG - Intronic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1043315811 8:78920294-78920316 AGGAGAAAGAAGAACTAGGAAGG + Intergenic
1043548041 8:81337249-81337271 AAGAGGAGGCGGAAGAAGGAAGG + Intergenic
1043777927 8:84293849-84293871 AAGAGGAAGAAGAAGTAGTAAGG - Intronic
1043823947 8:84902234-84902256 AAGATGCAGCAGGAGTAGGCAGG + Intronic
1044112541 8:88293247-88293269 AAGAGGAAACAGTGGAAGGAGGG - Intronic
1044288720 8:90441928-90441950 AAGAAGGAACAGAAGTAGAAGGG + Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045030150 8:98127429-98127451 AAGAGGAATCTTACGTAGGAAGG - Intronic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045474660 8:102542616-102542638 ACGATGAAGAAGAAGAAGGAGGG - Intergenic
1045642363 8:104265397-104265419 AACAGTAAGCATAAGAAGGATGG - Intergenic
1045851454 8:106703796-106703818 GAAAGGAAGGAGAAGTAGCAAGG + Intronic
1045885033 8:107085791-107085813 AGGAGGAAGGAAAAATAGGAGGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1047054885 8:121152998-121153020 CAGAGGAAGAAGAGGTAGAAGGG - Intergenic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047195184 8:122714557-122714579 AAGTGGAAGCACAGATAGGAAGG + Intergenic
1047411442 8:124627713-124627735 AAGAGGAAGCTCAGCTAGGAGGG + Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047464473 8:125099225-125099247 AAGATAAAGCAGAAGCAGAAGGG + Intronic
1047794155 8:128236848-128236870 AAATGGAAGCAGAAGTCTGAAGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048250154 8:132858922-132858944 AAGAGCCAGCAGAAGAAGTATGG + Intergenic
1048250963 8:132866605-132866627 AGGAGGAAGGAGAAGGAGAAAGG + Intergenic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048430864 8:134369285-134369307 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048792325 8:138115236-138115258 AAGATGAAGAGGAAGTAGGAGGG + Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049203690 8:141353659-141353681 CAGAGGAGGCTGAAGTGGGAAGG + Intergenic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049300840 8:141868566-141868588 TAAAGGCAGCAGAAGTGGGAAGG - Intergenic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049767639 8:144362392-144362414 AGGAGGGAGCAGAAGTGGGGAGG - Intergenic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050454791 9:5823918-5823940 TAGAGGCAGCAGGTGTAGGAGGG - Exonic
1050688495 9:8198929-8198951 AATAGGAAGGAGAAGCAGGAAGG + Intergenic
1050998564 9:12251114-12251136 AATAGGTGGCAAAAGTAGGATGG + Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051464368 9:17360399-17360421 AAGAGGAAACATCAGTGGGAAGG + Intronic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051705353 9:19873224-19873246 AAGAGGAGGAAGACGAAGGAAGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052395691 9:27935267-27935289 AAGAAAGAGCAGAGGTAGGAAGG + Intergenic
1052421085 9:28243710-28243732 AAGAAGAAGAAGAAGAAGAAGGG + Intronic
1052424266 9:28284150-28284172 CAGAGGAAGCAGACATTGGAAGG - Intronic
1052557532 9:30036421-30036443 AAGAGGAATCAGAATTGGGGAGG - Intergenic
1052830617 9:33212255-33212277 AAGAGGGAGCAGCAGAAGAAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053180311 9:35962569-35962591 AAGAGGAAAAAGAAGAAAGAGGG - Intergenic
1053472229 9:38355117-38355139 AAGAGGGAGAGGAAGAAGGAAGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053710384 9:40801157-40801179 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1054329836 9:63740671-63740693 AAGATGAAGAAGGAGTAGGCAGG + Intergenic
1054420292 9:64921946-64921968 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055074571 9:72200325-72200347 AAAAGGAAGAAGAAGGAGAAGGG - Intronic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055502575 9:76916288-76916310 AAAAAACAGCAGAAGTAGGAAGG + Intergenic
1055688688 9:78806900-78806922 AAGATGAAGCAGGAGTAAGAAGG + Intergenic
1056175053 9:84026412-84026434 AAGATGAAGAAGAAGAAAGAAGG - Intergenic
1056328014 9:85497160-85497182 AAGAAGAAGAAGAAGAAGAAAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056523171 9:87418813-87418835 AGGAGGAAGGAAAAGAAGGAAGG - Intergenic
1057231969 9:93326713-93326735 AGGAGGAAGCAGGAGTGAGAAGG + Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057488836 9:95506883-95506905 AAGAGGAAGCCGAGGTAGAGAGG + Intronic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1058276811 9:103052995-103053017 AAGAGAAAGAAGAAAAAGGAAGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058584815 9:106495464-106495486 AAGAGAAGGCATAAGTTGGAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058852905 9:109029936-109029958 AAGAGAAAGCAAAAGTCGTATGG + Intronic
1058888803 9:109343417-109343439 AAGAGGATGCAGAAATTAGAGGG + Intergenic
1058957011 9:109958688-109958710 GAGAGGAAGGAGAGGAAGGAAGG + Intronic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059995836 9:119908090-119908112 AAGTGGATGCAGAACTCGGATGG + Intergenic
1060014312 9:120073348-120073370 AAGAGAAAGCTGAGGCAGGAAGG + Intergenic
1060105646 9:120871273-120871295 TACAGGAAGGAGAAGTAGGTGGG - Intronic
1060459200 9:123833015-123833037 CTCAGGAAGCTGAAGTAGGAGGG + Intronic
1060476377 9:123989861-123989883 AAGAGGAAAAAAAAGAAGGAAGG + Intergenic
1060532211 9:124354565-124354587 AGCAGGAAGCAGAACAAGGAGGG + Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060805514 9:126573471-126573493 AAGAAGAAGAAGAAGAAGTAAGG - Intergenic
1060821994 9:126666462-126666484 AAGAGGAAAGGGAAGCAGGAAGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061239036 9:129358593-129358615 AAGAGGTAGAGGAAGCAGGATGG - Intergenic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203435896 Un_GL000195v1:136967-136989 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185591538 X:1280713-1280735 AGGAGGAAGAAGAAGAAGAAGGG - Intronic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185915992 X:4036153-4036175 AGGAGGAGGAAGAAGAAGGAAGG - Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187372980 X:18725802-18725824 AAGAGGAAGTAGAAGACAGAGGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187618646 X:21026742-21026764 AAGGGGAAGTAAGAGTAGGAGGG - Intergenic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188101545 X:26094161-26094183 AAGATGGAGAAGAAGTGGGAGGG - Intergenic
1188373262 X:29395071-29395093 AAGAGGAACCAGCAGTATCACGG + Intronic
1188592050 X:31849526-31849548 GACAGGAAGCAGAAGAAGTACGG + Intronic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189110593 X:38286077-38286099 AAGAGGAAGGAGAAGGGGAAGGG - Exonic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189363481 X:40370660-40370682 AGGAGCAACCAGAAGCAGGAAGG + Intergenic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189615685 X:42780623-42780645 AAGAGGAAGAAGCAATGGGAAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189854360 X:45209135-45209157 AAGGGGAAGAAAGAGTAGGAAGG - Intergenic
1189955067 X:46269507-46269529 AAGAGGAAGCATATGGAAGAAGG + Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190123416 X:47682760-47682782 AAGAGGAAGAAGAGGAAGGAAGG - Intergenic
1190211334 X:48450969-48450991 AAAAGGAAGAAAAAGAAGGAAGG + Intergenic
1190379874 X:49829279-49829301 ACAAGGAGGCAGAAGTAGGTAGG + Intronic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190831550 X:54063407-54063429 AAGAAGAGGAAGAAGTAAGATGG + Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1191912135 X:66162633-66162655 AGGTGGAAGCACCAGTAGGAAGG - Exonic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192557459 X:72101755-72101777 TGGAGGAGGCAGCAGTAGGAAGG - Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1192853578 X:74983277-74983299 AAGAGGTAGAGGAAGTAAGAGGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193080750 X:77403891-77403913 AAGAGAGAGCAAAAGTAGAAGGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193103022 X:77637012-77637034 AGGAGGAGGAAGAAGAAGGAAGG + Intronic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193286121 X:79717261-79717283 TAGAGGAAGCCGAAGTATTAGGG - Intergenic
1193297094 X:79846238-79846260 AATAGGAGGAAAAAGTAGGAAGG - Intergenic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193546609 X:82838475-82838497 AAGAGGAAGGAGGAATAGGGTGG - Intergenic
1194327649 X:92540281-92540303 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1194461369 X:94173522-94173544 GAGAGGAAGCAAGAGTGGGAGGG + Intergenic
1194777030 X:97977804-97977826 AAGAGGCAGCAGAACAAAGAAGG - Intergenic
1194777907 X:97988370-97988392 AAGAGGAACAAGATGTAAGAAGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195719436 X:107852292-107852314 AAGAGGAAGTAAAATTAAGATGG - Intronic
1195980229 X:110569459-110569481 AAAATGAAGCAGAGCTAGGAAGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197053971 X:122094546-122094568 AAGGGGAAGGAGAAATGGGAAGG + Intergenic
1197250467 X:124210476-124210498 AAGATGAAGCAGTAGTTTGAAGG + Intronic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197616347 X:128696047-128696069 AGGAGGAAACAAAAGTAGAAGGG + Intergenic
1197645707 X:129014392-129014414 AAAAAGAAGCAGAAATAGCAGGG + Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198005950 X:132492539-132492561 AAGAAGAAGAAGAAGAAGAAGGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198507515 X:137316274-137316296 AAGAGGATGCAAAAGATGGAGGG - Intergenic
1198601502 X:138288865-138288887 AAGAGCAAGTACAAGTAAGATGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1199029893 X:142985245-142985267 AAGAGTAAGCATATGTATGAAGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199614100 X:149641640-149641662 CAGAGGAGGAAGAGGTAGGAGGG + Intergenic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200269858 X:154672330-154672352 AAGAAGAAGAAGAAGAAGAAGGG - Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200636360 Y:5659499-5659521 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1200755297 Y:6985028-6985050 ATGAGGAAGCAGAAGTGGAGAGG - Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201461670 Y:14232519-14232541 AAGATGAAGAAGAAGAAGAAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201537751 Y:15069237-15069259 AAGTGCAAGCAGAAGCAGGTGGG + Intergenic