ID: 1126432572

View in Genome Browser
Species Human (GRCh38)
Location 15:48601885-48601907
Sequence CCTCCATCTCTCCACATTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 8, 3: 23, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126432569_1126432572 1 Left 1126432569 15:48601861-48601883 CCTGTTTCTACTGAACTAGAGCC 0: 1
1: 0
2: 0
3: 12
4: 79
Right 1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG 0: 1
1: 1
2: 8
3: 23
4: 289
1126432566_1126432572 26 Left 1126432566 15:48601836-48601858 CCACACACTGAAACACCATCAAA 0: 1
1: 0
2: 3
3: 41
4: 360
Right 1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG 0: 1
1: 1
2: 8
3: 23
4: 289
1126432568_1126432572 11 Left 1126432568 15:48601851-48601873 CCATCAAAGGCCTGTTTCTACTG 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG 0: 1
1: 1
2: 8
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126432572 Original CRISPR CCTCCATCTCTCCACATTCA CGG Intronic
903452505 1:23464027-23464049 CCTTCATCTATCCAGTTTCATGG - Intronic
903486879 1:23696103-23696125 CTTCCATCTACCCCCATTCATGG - Intronic
906973957 1:50549020-50549042 CCCCCATCTCTCCAAATTAAAGG + Intronic
907911265 1:58828669-58828691 TCTCCATTTCTCCACTTACAAGG + Intergenic
908089463 1:60670878-60670900 CATACCTATCTCCACATTCAGGG - Intergenic
908392564 1:63696902-63696924 TCTCCATCTCTCCAGACTCCTGG + Intergenic
908394240 1:63710924-63710946 CCTGCATCCCTACACATTCCAGG + Intergenic
908705885 1:66954065-66954087 CCTCCATCTCTCCTAATCCCTGG + Intronic
909079257 1:71089407-71089429 CCTCCACCTCTCCACCTCCTGGG + Intergenic
911057654 1:93722083-93722105 CCTGCAGCTCTCCACAGTCTCGG + Intronic
911117810 1:94264737-94264759 CCTCCATCTCACCCCATCCCCGG + Intronic
912596385 1:110881075-110881097 TGTCCATCACTCCACACTCATGG - Intronic
913396838 1:118380962-118380984 CCTCCATCTGTCTACATTATGGG - Intergenic
914750815 1:150533894-150533916 CCTCCCTCTCTCCTCCTCCAAGG - Intergenic
915319279 1:155047402-155047424 CCCCCATCTCTCCACACCCAAGG - Intronic
915395468 1:155580273-155580295 CCTCCATCTCCCAACATGCTGGG - Intergenic
917669720 1:177261965-177261987 CCTCCATGTCACCAAATTGAAGG - Intronic
918818494 1:189223212-189223234 CCTTCATTTCTCCACAATTATGG - Intergenic
920259922 1:204682264-204682286 CCTCCCTGCCTCCTCATTCAGGG + Intronic
921164098 1:212493783-212493805 CCTCCATCTCTCTGCCTGCAGGG + Intergenic
921390628 1:214609733-214609755 CCTCCAACTCTCCACCCTCAAGG + Intronic
922171764 1:223161562-223161584 CCTCCCTCTCTCCACCACCAGGG - Intergenic
923431013 1:233920409-233920431 TCACCATCTCTCCTCCTTCACGG - Intronic
923605052 1:235435651-235435673 CCTCCATCGCACCAAATGCAGGG + Intronic
1062826780 10:575747-575769 CCTCCATCTCGCCGCAAGCAGGG + Intronic
1065667165 10:28074810-28074832 CCTTCATGTTTCCACTTTCACGG + Intronic
1066449097 10:35511840-35511862 TCTCCATCTCTCCAGGTTCACGG - Intronic
1067992502 10:51230879-51230901 CAACCAGCCCTCCACATTCATGG - Intronic
1068049593 10:51932572-51932594 CCTCCATCTGTCCACTTAGAGGG - Intronic
1068244752 10:54350329-54350351 CCTCCATAGTTCCACATTTAAGG + Intronic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070833094 10:79432178-79432200 GCCCCATCTCATCACATTCACGG - Intronic
1071452443 10:85810259-85810281 CCACCATCTCTCCACCCACATGG + Intronic
1071505903 10:86231326-86231348 CCACCATCTCTGCACACTCAGGG + Intronic
1071579245 10:86755608-86755630 CTTCCATTTCCCCTCATTCATGG - Intergenic
1072786012 10:98282860-98282882 CCTTATTCTCTCCACCTTCAAGG + Intergenic
1073516373 10:104079083-104079105 CCCACAACTCCCCACATTCAGGG - Intronic
1073551252 10:104403809-104403831 CCTCCATCTGTGCACATTCAGGG - Exonic
1074337007 10:112587827-112587849 CCTCCCTCCCTCCAAATTCCTGG + Intronic
1074766964 10:116706649-116706671 CATCCATCTTTCCTCATACAGGG + Intronic
1075387310 10:122064747-122064769 CCTCCATCCTCCCACATTCTTGG + Intronic
1076893392 10:133296207-133296229 CCCCCATGTTTCCCCATTCAGGG - Intronic
1078138408 11:8671939-8671961 CCTCCATCTGTCCACTCTTAGGG + Intergenic
1078151022 11:8759785-8759807 CCTGCACCTCTCCTCATCCATGG + Intronic
1078612124 11:12830007-12830029 CCTCTATCTCTCCACTCCCAAGG - Intronic
1079699961 11:23533309-23533331 CATCCATATTTCCACATTTATGG - Intergenic
1080210129 11:29776436-29776458 CACCCTTCTCTCAACATTCATGG - Intergenic
1082873560 11:57965968-57965990 CCTCCTACTCTCCACCATCAAGG + Intergenic
1083152092 11:60798272-60798294 CCTCAGTTTCCCCACATTCATGG + Intronic
1083190793 11:61050696-61050718 CCTCCACCTCTCCACCTCCTGGG - Intergenic
1084177673 11:67431887-67431909 CCTCCATCCGTCCACTCTCAGGG + Intronic
1087149375 11:94844898-94844920 CCTCTATCTCTCCAGCTACATGG + Intronic
1089059075 11:115611437-115611459 TCTCCCTCTCTCCACATTCAAGG - Intergenic
1091042157 11:132291821-132291843 CTTCCATGTGTCCAAATTCATGG - Intronic
1091198108 11:133749037-133749059 ATTCCACCTCTCCACACTCAGGG - Intergenic
1091239214 11:134041395-134041417 CCTTCATCTCTGCACCTTCAGGG - Intergenic
1091300260 11:134503007-134503029 TCTCCATCTCTCTTCATCCACGG - Intergenic
1092202914 12:6597958-6597980 CCTCCATCTCTGCAAATTTAGGG + Exonic
1094777605 12:33749216-33749238 CCTCCATCACTCATCACTCAAGG - Intergenic
1096053772 12:48633892-48633914 TCTCTATATCTCCACATTCCAGG + Intergenic
1096487067 12:51990396-51990418 CCTCCACCTCTCCAGGCTCAGGG + Intronic
1096718539 12:53505114-53505136 CAGCCCTCTCTCCACATGCAGGG + Exonic
1097208429 12:57344908-57344930 CCTCCACCTTTCCACCTTCCTGG + Intronic
1098163458 12:67669785-67669807 TCTCCATCTCCCCACATTCACGG - Intergenic
1098905615 12:76159019-76159041 CCTCATTGTCTCCACTTTCATGG + Intergenic
1099361187 12:81703712-81703734 CCTCCACCTCACCTCACTCATGG + Intronic
1101827379 12:108231131-108231153 CCTCCATCTCTCCCTCTTCTGGG - Intronic
1103875034 12:124120396-124120418 ACCCCATGTCTCCACATTCTTGG + Intronic
1103918902 12:124389429-124389451 CCTCCCTCTCTCCCCATCCGCGG + Intronic
1104149693 12:126070798-126070820 CCTCCTTTCCTCCACAGTCAGGG - Intergenic
1104168646 12:126258374-126258396 ACTCCAGCTCTGAACATTCAAGG - Intergenic
1104526140 12:129524598-129524620 TATCCATCTCTCCAGATTGATGG + Intronic
1104888341 12:132125324-132125346 CCCCCAGCTCACCACAGTCACGG + Intronic
1105728614 13:23189054-23189076 CCGTCATCTCTCCACATCCTAGG - Intronic
1107183503 13:37489825-37489847 CCTCCATCTTTTCATATACAGGG + Intergenic
1110553420 13:76831793-76831815 CCTCCATCTCTTCCTATTCAAGG + Intergenic
1110711466 13:78655633-78655655 CCCTCATCTCTCCCCCTTCATGG + Intronic
1112228431 13:97564200-97564222 CTTCCTGCTCTCTACATTCACGG - Intergenic
1112909395 13:104463019-104463041 ACTCCATGTCCCCACATCCAGGG + Intergenic
1113566267 13:111321434-111321456 CCCCCATCTATGCACATTAACGG - Intronic
1114356476 14:21914949-21914971 CAGCAATCTCTCCAAATTCATGG - Intergenic
1115635347 14:35285692-35285714 CCTCCCTTTCCCCACCTTCAGGG + Intronic
1116752657 14:48906043-48906065 CCTCTACCCCTCCACATGCATGG - Intergenic
1118654613 14:67933331-67933353 GCCCCATATCTCCACATTCTGGG - Intronic
1118993244 14:70814466-70814488 CCTCCATCTCTTCAAATGCTGGG + Intergenic
1121137017 14:91509226-91509248 CCTCGACCTCTCCACACTCCAGG + Intronic
1122891228 14:104733172-104733194 CCTGCATCTCTCCACCTCCCAGG + Intronic
1123977203 15:25564748-25564770 CCTCCAGCTCTCCACCGTCAGGG + Intergenic
1126432572 15:48601885-48601907 CCTCCATCTCTCCACATTCACGG + Intronic
1127146334 15:56028068-56028090 CCTCCATCCCTCCTCATTGCTGG + Intergenic
1128181824 15:65611410-65611432 CCTGAATCTCTCCCCATTCTCGG + Intronic
1128841957 15:70857636-70857658 CCTCCATCTCTTGGTATTCATGG - Intronic
1129274602 15:74436697-74436719 TCTCCATGATTCCACATTCAGGG + Intergenic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1131033370 15:89205035-89205057 CCTCCATATGTCAACATACAGGG + Intergenic
1131527411 15:93163663-93163685 GCTTCATGTCTCCACATCCAGGG + Intergenic
1132144639 15:99421774-99421796 CCTCCCACTCTCCACTCTCAAGG + Intergenic
1132497409 16:270451-270473 CCTCCATGTCCCCACCCTCAAGG - Intronic
1132951943 16:2567794-2567816 CTTTCATCTCTGCACAGTCATGG + Intronic
1132962407 16:2632376-2632398 CTTTCATCTCTGCACAGTCATGG - Intergenic
1133238900 16:4403211-4403233 CCTCGCTCTCTGCACACTCATGG + Intronic
1133575028 16:7080745-7080767 TCTCCATCTCTCCTCTTGCAAGG + Intronic
1134634325 16:15780563-15780585 CCTCCATCTCCCCGGGTTCAAGG + Intronic
1134682384 16:16135315-16135337 CCTCCATCTGTCCCCACTTATGG + Intronic
1135021365 16:18965839-18965861 CCTGCATCTCTGCAGATTGAAGG + Intergenic
1136161452 16:28422319-28422341 CCTCCACCTCCCCAGGTTCAAGG + Intergenic
1136922762 16:34345704-34345726 CCTCCTTCTCCCCTCATTCCAGG - Intergenic
1136981811 16:35066102-35066124 CCTCCTTCTCCCCTCATTCCAGG + Intergenic
1137375913 16:47951732-47951754 CCTCCTTCTCTCCACCACCATGG + Intergenic
1139667631 16:68468871-68468893 CCTCCACCTCTCCACCTCCCTGG - Intergenic
1140541447 16:75760051-75760073 TGTCCATCTCTTCACAGTCATGG + Intronic
1140759317 16:78097097-78097119 CCTTCCTCTCCCCACAATCAGGG + Intergenic
1142755533 17:2014393-2014415 CCCCCCACTCTCCCCATTCAAGG + Intronic
1144051429 17:11500298-11500320 CTTCCATCTCTAAACATTCTGGG - Intronic
1144193729 17:12870668-12870690 CCTCCATCTCTCTACATAATAGG + Intronic
1147420819 17:40321413-40321435 CCTCCTCCTCTCCAAATTCCAGG - Intronic
1147739259 17:42661062-42661084 TCTCCATCTCTCCCCATGCTGGG + Intronic
1148548825 17:48537414-48537436 CATCCCTCTGTCCACATTCAGGG - Intergenic
1148679344 17:49464792-49464814 CCTCAATCTCTCCTGCTTCAGGG - Intronic
1151014587 17:70539876-70539898 CCTCCACCTCTCCACCTCCCGGG + Intergenic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1153863194 18:9234623-9234645 CCCCCATATCTCCACATCCCAGG - Intronic
1156474580 18:37397548-37397570 CCTCCATCCCTCCCCACCCATGG - Intronic
1156491716 18:37500234-37500256 CCTCCCTCTCTCCCCAGCCATGG - Intronic
1157136495 18:45061977-45061999 ACTCCATGGCTCCACCTTCAAGG - Intronic
1157761093 18:50266277-50266299 TCTCCATCTCTCCGCACTCCAGG - Intronic
1159529510 18:69637503-69637525 CATCCCTCTCTCATCATTCAGGG + Intronic
1159951766 18:74489236-74489258 CCTCCTCCCCTCCACCTTCAAGG - Intergenic
1160222465 18:76987141-76987163 CCCCCATCGCTCCACATTCAGGG + Intronic
1160255813 18:77247901-77247923 TCTCCCTCCCTCCACATTCTTGG - Intergenic
1160951250 19:1668715-1668737 CCTGCATTTCCCCACATGCAGGG + Intergenic
1161194392 19:2978008-2978030 CCTCCAGCTGCCCAGATTCATGG - Intronic
1161416539 19:4150247-4150269 CCTCCCTCCTTCCCCATTCAGGG - Intergenic
1162325374 19:9996119-9996141 CCTCCATCTCTCCTCCCCCAAGG - Exonic
1163138553 19:15331658-15331680 CCCCCATCTCTTCACCTTCCCGG - Intronic
1163640075 19:18457165-18457187 CCTCCAGCTCCCCTGATTCAAGG - Intronic
1165790706 19:38490039-38490061 CCTCCATCTCTCCTCCCACACGG + Intronic
1165879952 19:39035290-39035312 CATCCATCTCTCCTAATTCAGGG - Intergenic
1166327968 19:42062757-42062779 CCTCCTTCTCTCCACAGATATGG + Exonic
1167247869 19:48384565-48384587 CTTCCTTCTCTCCACCTTCGCGG - Intronic
1168135730 19:54349822-54349844 CCTCCATCCATCCACCCTCAGGG - Intergenic
1168629319 19:57944746-57944768 CCTCCACCTCTCCACCTCCTGGG - Intronic
1168698315 19:58418938-58418960 TCTCAATCTCTCCACACACAGGG - Intergenic
924998128 2:382636-382658 CCTTCAGCTGGCCACATTCATGG + Intergenic
925237890 2:2295049-2295071 CCAGCATCTCTCCTAATTCAGGG - Intronic
925326211 2:3023925-3023947 CTTCCCTCTCTCCATCTTCAAGG - Intergenic
925973846 2:9126912-9126934 CCCCCATCTCTCCCCATCCCTGG - Intergenic
927337337 2:21940508-21940530 CCTGCATCTTCCCACCTTCATGG - Intergenic
927666276 2:25035147-25035169 CCTGCATCTCACCACAGCCAAGG - Intergenic
928102767 2:28449158-28449180 CCTCAATCTCTCCATCGTCAGGG + Intergenic
928368629 2:30722675-30722697 CCTCACTCTCTCCTCATCCATGG - Intergenic
928784474 2:34865914-34865936 CCTCCACATTTCCACATTCTAGG - Intergenic
928796732 2:35032604-35032626 CCTCCCTCTCTCCACTTTAGTGG - Intergenic
929059990 2:37914129-37914151 CCTCCACCTGTCCACACCCAGGG - Intergenic
929266928 2:39928844-39928866 CCTCCATCTGGACACATACAGGG - Intergenic
930330811 2:49980743-49980765 CCTGTATATCTGCACATTCATGG - Intronic
931933636 2:67170079-67170101 CCTCCAGCTCTCCTTATTCCAGG - Intergenic
931958549 2:67455816-67455838 CCTCTCTCTCTCCACCTTTATGG - Intergenic
932166243 2:69510194-69510216 CCTCCCACCCTCCACCTTCAAGG + Intronic
932474424 2:71992964-71992986 CCTCCATCTCCCCACAGTCAAGG + Intergenic
933083473 2:78024001-78024023 CCCCCATATCTCCACATCCCAGG - Intergenic
933151355 2:78919106-78919128 ACTCCATCTCTCCACAGTAGTGG + Intergenic
935943780 2:108268403-108268425 CCTTTCTCTCTCCACATTCATGG + Intergenic
936590802 2:113802019-113802041 ACTCTGTCTCTCCACATTGAAGG + Intergenic
937280201 2:120712549-120712571 CCACCATCACTCCACCCTCAGGG + Intergenic
937639769 2:124198563-124198585 CCTCCCTCTCTCCCCACTCTAGG + Intronic
939854568 2:147342764-147342786 CCCCCATTGCTCCACATTCTTGG + Intergenic
940635273 2:156291696-156291718 CCTCCTTCTCTCCACCATCAAGG + Intergenic
942470502 2:176254965-176254987 CCCTCATCTCTCCACCTTAATGG + Intergenic
942867980 2:180699166-180699188 CCCCCAACTCACCACATTGAGGG - Intergenic
943118233 2:183701680-183701702 CTTCCATCTCTACATATTAAAGG - Intergenic
943296871 2:186151444-186151466 CCTCCATCATTCCAAATTAAAGG + Intergenic
944682275 2:202087922-202087944 CCTCCATGTCTTCACTTTCCTGG + Intronic
944806846 2:203290891-203290913 CCTCCACCTCTCAACATGCTGGG + Intronic
945273469 2:207964485-207964507 CCTCCCTCCCTCCACTCTCATGG - Intronic
946485939 2:220100745-220100767 TCTCCATCTCTCCAAACTCAGGG + Intergenic
946498497 2:220220341-220220363 GTTCCATCTTTCCACTTTCAAGG - Intergenic
947627253 2:231627741-231627763 CCTCCCTCCCACCACATTCCAGG + Intergenic
948681934 2:239640989-239641011 ACTCCATCTCTCCAGGGTCAGGG + Intergenic
948887226 2:240890365-240890387 CCTACATCCCTCCGTATTCAGGG - Intronic
1168818347 20:756315-756337 CCTCCATCTCTCCATGATCTTGG + Intergenic
1169147863 20:3265489-3265511 CCTCCACCTCTCCACCTCCTGGG - Intronic
1172055643 20:32152525-32152547 CCCCCATCTCTGCATCTTCAAGG + Intronic
1172109873 20:32538490-32538512 CCTCCCTCCCTCCTCCTTCATGG + Intronic
1172494905 20:35373601-35373623 CCTCCACCTCTCCACCTCCCAGG - Intronic
1174285315 20:49468712-49468734 CCTCTCTCTTTCCACCTTCAAGG - Intronic
1178942567 21:36918686-36918708 CCCCCATATTTCAACATTCAGGG + Intronic
1180159492 21:45992727-45992749 CCTCCATGTCTCTCCACTCAGGG + Exonic
1182389896 22:29984633-29984655 CCTCTATCTCTCCACCTGCCAGG - Intronic
1182660139 22:31919309-31919331 ACTCCCTCTCTCCTGATTCAGGG + Intergenic
1183085700 22:35485602-35485624 CCTCCACCTCTCCTCTTTCATGG + Intergenic
1184368599 22:44068443-44068465 CCTACTTCTCCCCTCATTCAAGG + Intronic
1184576048 22:45367185-45367207 CATCTATCTCTTCACATTAAAGG + Intronic
1184578267 22:45392669-45392691 CCTCCATATCCACACTTTCATGG - Intronic
1184937415 22:47735315-47735337 GCTCCAGCTGTCCACTTTCAGGG + Intergenic
949387599 3:3520531-3520553 CCTCTTTCTCTCCAAATTAATGG - Intergenic
951557716 3:23937293-23937315 CCTCCATCTCTCCTCCTCCCAGG - Intronic
952363651 3:32655190-32655212 CCTCCATCAATCCACATCCATGG + Intergenic
953414464 3:42707730-42707752 CCTCCATGTGTGCACACTCATGG - Intronic
954034837 3:47845898-47845920 CCTCCATCTCTCCAGACTGAAGG + Intronic
954463465 3:50640800-50640822 CCCCCATCCATCCATATTCAGGG - Intronic
956519661 3:70089871-70089893 CCTGCATCTCTCCCCTTTGATGG + Intergenic
956617570 3:71188310-71188332 CTTCGGTCTCTCCACATTGAAGG - Intronic
956793185 3:72695515-72695537 CCTCCATCTGTCCACCCTGAAGG + Intergenic
957037030 3:75302907-75302929 CCTGCTTCTCTCCACATATAAGG + Intergenic
959316236 3:104810887-104810909 CCATAATCTCTCCACATGCACGG - Intergenic
959885453 3:111494081-111494103 CCTCCTTCTCTCCCCATTTTTGG - Intronic
960965876 3:123104436-123104458 CCTCCATCTCTCTGGAGTCAGGG - Intronic
968623912 4:1618039-1618061 CCTCCATCTTCCCATCTTCACGG - Intronic
970973064 4:22007767-22007789 CATCCCTCTCTCCATATACAAGG + Intergenic
974302757 4:60090077-60090099 CCTCCCTATCTCCACCCTCAGGG + Intergenic
976327109 4:83784270-83784292 CCTCAATCTCTCAAAATTCCTGG - Intergenic
978267789 4:106847426-106847448 ACTCCATGTTTCCACACTCATGG + Intergenic
978977480 4:114896076-114896098 TCTCCATATATTCACATTCATGG + Intronic
979640908 4:123012085-123012107 CTTCCTTCTCTCCACTTTCCTGG - Intronic
979640984 4:123012340-123012362 CTTCCTTCTCTCCACTTTCCTGG - Intronic
980833719 4:138163579-138163601 TCTCCAGCTTTCCACATTCTCGG - Intergenic
983287888 4:165762158-165762180 ACACCATCTCTCCTCATTCTTGG - Intergenic
983439225 4:167759821-167759843 CCTCCCAATCTCCACCTTCAAGG - Intergenic
983663655 4:170157724-170157746 CCTCAATCTCTCCACAGTGAGGG + Intergenic
986279173 5:6309330-6309352 CTTCCAATTCTCCACACTCAGGG - Intergenic
986351055 5:6879772-6879794 CCCACATCGCTCCACCTTCAAGG + Intergenic
987449955 5:18070844-18070866 CCTCGATTTCTCCAAACTCATGG + Intergenic
987514880 5:18892432-18892454 CCTCCTTCCCTCAACATGCAGGG + Intergenic
989099488 5:37810914-37810936 CCTACTTCACTCCACACTCACGG + Intergenic
990280697 5:54247904-54247926 TCACCAGCTCTCCCCATTCATGG - Intronic
990717900 5:58659192-58659214 CCTACATATCTGCACATGCATGG - Intronic
992833067 5:80614422-80614444 GCTCCATCTCTCCATATTCATGG + Intergenic
995527916 5:113065276-113065298 CCTCCAACCCTCAACATGCACGG - Intronic
996127128 5:119739158-119739180 CCTCCCTCCCTCACCATTCACGG + Intergenic
997962477 5:138332924-138332946 CCCCCATCACTCAACAGTCAGGG - Intronic
998775199 5:145591991-145592013 CCTCTCTCTCAGCACATTCATGG - Intronic
998867176 5:146517136-146517158 CCTCCACCTCCCCAAATTCTGGG - Intergenic
999220492 5:149972378-149972400 TCTCCCTTTCTCTACATTCATGG - Intronic
1000500100 5:162037202-162037224 TCTCCTTCTCTCCATGTTCAGGG - Intergenic
1001135747 5:169101178-169101200 CCTCCAGATGCCCACATTCATGG - Intronic
1002295372 5:178227834-178227856 CCTCCACCTCTCCATCTCCATGG - Intronic
1003430797 6:6035605-6035627 TCTCCATTTCTCCCCATTGAGGG - Intergenic
1003478381 6:6506517-6506539 CCTCTATCTCTGCACTGTCATGG - Intergenic
1007039689 6:38710378-38710400 CCTCCATTTCTCCCCAGTCCGGG - Intergenic
1007250239 6:40490336-40490358 CCTCCATCTCTCCACACTGGTGG - Intronic
1007286805 6:40753720-40753742 CCTCCCTCTCTCCACCATCCTGG - Intergenic
1008161338 6:48079771-48079793 CTTCCACCTCTCCACCTCCATGG + Intergenic
1008246788 6:49184931-49184953 AATCCATATCTCCCCATTCAAGG + Intergenic
1008664536 6:53703132-53703154 CCTCCATCTCTCTACCAGCAGGG + Intergenic
1010318836 6:74483206-74483228 CCTCCCTCTCTACATATTCCTGG + Intergenic
1011281455 6:85681921-85681943 CCTCCAACCCTCCACCCTCAAGG + Intergenic
1011314416 6:86015922-86015944 CCTCCATCTCTTGACAGTCCAGG + Intergenic
1012170800 6:96015493-96015515 CCTCCTTCTCTCCTCTTTCTGGG - Intergenic
1014794468 6:125708248-125708270 CCTCCATCTATTCCCATTCAGGG + Intergenic
1014843322 6:126245195-126245217 CCTCCAGCTCTAATCATTCATGG - Intergenic
1016056157 6:139579730-139579752 TCTCCATCTCACCACATAAAAGG + Intergenic
1016928474 6:149378489-149378511 CCTACATCTTTGCACATACATGG + Exonic
1018107157 6:160499974-160499996 GCTCCATCTCTCCACTCTTAGGG + Intergenic
1018787333 6:167118419-167118441 CATCAATCTCTTCACATTCCAGG + Intergenic
1019488527 7:1300486-1300508 CCTCGGTGTCTCCACACTCAGGG - Intergenic
1019817177 7:3209887-3209909 CCTCCCACTCTCCACCCTCAAGG + Intergenic
1020339872 7:7098750-7098772 CCTCCATTTCTCTGAATTCAGGG + Intergenic
1024038274 7:45527119-45527141 CCTTCATCTCTCCAAAACCAAGG + Intergenic
1024557928 7:50619685-50619707 CTTCCATCTCTGCACCTTCTTGG - Intronic
1024991105 7:55235159-55235181 CCTCTATGTCTCCAAAGTCACGG - Intronic
1028198898 7:87937603-87937625 CCTCCTTTTCTCCCCATTTATGG + Intronic
1028457074 7:91050083-91050105 CCTCCACTCCTCCCCATTCAGGG - Intronic
1028518888 7:91707349-91707371 CCCCTATCTCTCCACATCCTGGG + Intronic
1028860690 7:95646840-95646862 CCTCCCTTTCTCCACCCTCAAGG + Intergenic
1029862153 7:103584029-103584051 CCCCCATATCTCCACATCCTAGG + Intronic
1031426862 7:121615715-121615737 CCTTCATCTCTCCACACTTGGGG + Intergenic
1031616171 7:123883007-123883029 CCCCAATTTCTCCACATTCTTGG - Intergenic
1032513838 7:132492642-132492664 CCCCCATCACCCCAGATTCAAGG - Intronic
1033310527 7:140258583-140258605 CCTCCACCTCTCCACCTCCGGGG - Intergenic
1034454837 7:151163107-151163129 TCTACATTTCTCCACATTCACGG + Intronic
1035336014 7:158127377-158127399 CGTTCATCTCTCCACAGTCCAGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037178655 8:15976338-15976360 CCTCCCTCTGTCAACACTCATGG + Intergenic
1037265436 8:17054670-17054692 TCAACATCTCTCAACATTCAAGG + Intronic
1038631064 8:29244433-29244455 CTTTCACCTCTCCACTTTCAGGG + Intronic
1038672707 8:29595359-29595381 CATCCAGCTCTCCACACGCAGGG - Intergenic
1039706847 8:40016063-40016085 CCACCAACTCAACACATTCAGGG - Exonic
1040947907 8:52903582-52903604 CCTCCATCTCTTCATTTTCCTGG + Intergenic
1041586137 8:59522079-59522101 CCTCCCCCTCTCCACCCTCAAGG - Intergenic
1043777531 8:84288650-84288672 CTTGCATCTCTTCTCATTCATGG - Intronic
1043823473 8:84896686-84896708 TCTCCTTGTCCCCACATTCAGGG - Intronic
1044799223 8:95936329-95936351 CCTTCATCTCTCTGCACTCAGGG + Intergenic
1045220745 8:100197622-100197644 TCTCCATCTCATCACATTCCGGG + Intronic
1045341264 8:101256771-101256793 CCTCCCTCTCCCTTCATTCACGG + Intergenic
1049232072 8:141489656-141489678 GCTCCATCTCTTCACCTTCCAGG + Intergenic
1052355258 9:27497991-27498013 GCTCCATCTATTCATATTCATGG - Intronic
1053203595 9:36168781-36168803 CCTCCACCTCTCCATTTTGAAGG + Intergenic
1053312500 9:37028382-37028404 CCTCCCTCACTCCACCTGCAGGG + Intronic
1053535788 9:38924115-38924137 CCTCCTTCTCTCCCCCTTCTAGG - Intergenic
1054208010 9:62148528-62148550 CCTCCTTCTCTCCCCCTTCTAGG - Intergenic
1054630344 9:67439822-67439844 CCTCCTTCTCTCCCCCTTCTAGG + Intergenic
1054805570 9:69393401-69393423 CCTCCATCTCTCCCATTTCTAGG - Intergenic
1055662550 9:78519848-78519870 CTTCTATATCTCCACATTCCTGG + Intergenic
1055833009 9:80405383-80405405 CACCTATCTCTCCACATTCTGGG - Intergenic
1056507697 9:87272963-87272985 CCTCCCACCCTCCACCTTCAAGG - Intergenic
1057233865 9:93343098-93343120 CCTCTCACTATCCACATTCAGGG - Intronic
1057251985 9:93510925-93510947 CCTCTCACTATCCACATTCAGGG + Intronic
1057581070 9:96288387-96288409 CCTTCAGCTCTCCAGAGTCATGG - Intronic
1059255035 9:112922154-112922176 CCTCCATCTCTCCACATCCAAGG - Intergenic
1059384556 9:113954170-113954192 CCTAGAACTTTCCACATTCAAGG - Intronic
1059695969 9:116730864-116730886 CTTCCATCTCTGCTCATTCCTGG + Intronic
1060947823 9:127580516-127580538 CCTTCCTCTCTGCCCATTCAGGG + Intergenic
1186139200 X:6553280-6553302 CCTCCCTCTCTCCCCGTTCTAGG - Intergenic
1186402472 X:9272352-9272374 CCTCCATCTCTGCCCAGTCATGG - Intergenic
1188663519 X:32790567-32790589 CTTCCCTATCTCCACATTCCTGG + Intronic
1190877940 X:54472778-54472800 CCTCCATCTCTCCCTATGCAAGG - Intronic
1191868216 X:65723073-65723095 CCTGTAACTCTCCACAGTCATGG + Intronic
1192189715 X:68983437-68983459 CCTCCATCTTCTCACATCCATGG - Intergenic
1192585272 X:72314072-72314094 CCTCCAGCTCAGCACAATCATGG + Intergenic
1192605187 X:72509182-72509204 CCTCCACCTCTCCACCTCCCAGG + Intronic
1193171026 X:78335906-78335928 CCTCCCACCCTCCACAGTCATGG + Intergenic
1194062997 X:89227635-89227657 CCTCCATATCTCCACATTCTGGG + Intergenic
1194785052 X:98073090-98073112 CCTCCTTTTCTCCACTTTGAAGG - Intergenic
1194912003 X:99657048-99657070 CCTCCATTGCTCAACCTTCATGG + Intergenic
1195467676 X:105197910-105197932 CCTCCCACTCTCCACCCTCAAGG + Intronic
1197553395 X:127923041-127923063 CCTCCCTCCATCCACCTTCAAGG - Intergenic
1198693163 X:139306584-139306606 CCTCCCTCCCTCCACATGTAGGG - Intergenic
1200046692 X:153406920-153406942 CCTCCACCTCCCATCATTCACGG - Intergenic
1200716809 Y:6556303-6556325 CCTCCATATCTCCACATTCTGGG + Intergenic
1201311063 Y:12598496-12598518 CCTCCAGCTCTCCCATTTCAGGG - Intergenic
1201720796 Y:17094618-17094640 CCTCCATCTCTCAAAATGCTGGG - Intergenic