ID: 1126433542

View in Genome Browser
Species Human (GRCh38)
Location 15:48612295-48612317
Sequence ATGGGGAAATTTAGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126433542_1126433548 20 Left 1126433542 15:48612295-48612317 CCTTCAGCTCTAAATTTCCCCAT 0: 1
1: 1
2: 3
3: 29
4: 280
Right 1126433548 15:48612338-48612360 AAAACTGGACATTATTTCATAGG 0: 1
1: 0
2: 1
3: 28
4: 294
1126433542_1126433547 5 Left 1126433542 15:48612295-48612317 CCTTCAGCTCTAAATTTCCCCAT 0: 1
1: 1
2: 3
3: 29
4: 280
Right 1126433547 15:48612323-48612345 TACTGGAGTTTTCTGAAAACTGG 0: 1
1: 0
2: 0
3: 16
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126433542 Original CRISPR ATGGGGAAATTTAGAGCTGA AGG (reversed) Intronic
900892522 1:5459730-5459752 ATAGGGAAATTTAGGGATGGGGG + Intergenic
903177507 1:21589834-21589856 ATGGGGAAACTGAGGTCTGAAGG + Intergenic
904368992 1:30036567-30036589 ATGGGGAAACTGAGTCCTGAGGG + Intergenic
907380950 1:54088080-54088102 ATGGGGAAATTTATAATGGAGGG - Intronic
907645066 1:56234225-56234247 TTGGGCAAATTTGTAGCTGATGG - Intergenic
908940532 1:69427376-69427398 ATAGGGTAATTAAGAGCAGAAGG + Intergenic
910297320 1:85662396-85662418 TTGTAGAAATTTAGAGCTGAAGG - Intronic
911450050 1:98050560-98050582 ATGGGGAAATATAGGGATGGGGG + Intergenic
915069260 1:153252562-153252584 ATGGAGAAACTGAGATCTGAGGG + Intergenic
916873994 1:168948966-168948988 ATGGGTAAATTCAGGGATGAGGG - Intergenic
917802759 1:178585237-178585259 ATGGGGAAAGAAAGAGCTGAGGG + Intergenic
918904528 1:190475714-190475736 AAAGGGAAATTTACATCTGAGGG - Intronic
919702397 1:200644376-200644398 ATGGGGAATTTAATAACTGAGGG + Exonic
919767509 1:201136737-201136759 TTGGAGAGAATTAGAGCTGAGGG + Intronic
920194092 1:204214479-204214501 ATGGGGGAAGTTAGACGTGAAGG + Intergenic
920824304 1:209410832-209410854 ATCCAGAAATTCAGAGCTGAAGG - Intergenic
921044647 1:211466568-211466590 ATGGGGAAATGTTGATCAGAGGG + Intergenic
922185747 1:223272917-223272939 ATGGGCAAATTAACAGCTAAAGG + Intronic
922199885 1:223393150-223393172 AGGGTGACATTTAAAGCTGAGGG - Intergenic
922457441 1:225786708-225786730 ATGAGGAAATTGAGACCAGAAGG - Intronic
922874589 1:228930287-228930309 ATGGGGAAACTTGGAAATGATGG + Intergenic
923248061 1:232153025-232153047 ATGAGGAATTTTAGAACTGTTGG - Intergenic
924121004 1:240798075-240798097 ATGGGGAAATAGTGAGGTGAGGG - Intronic
924522463 1:244816889-244816911 AGGGGAAACTTGAGAGCTGATGG + Intergenic
924609650 1:245563221-245563243 ATGGGGGATTTTACATCTGATGG - Intronic
1063301740 10:4855029-4855051 AAGGGAAACTTGAGAGCTGATGG + Intergenic
1063507288 10:6611694-6611716 ATAGACAAATTTAGAGCTCAGGG + Intergenic
1064275128 10:13898642-13898664 ATGGGACAATTAAGAGATGATGG + Intronic
1064556158 10:16549341-16549363 ATGGGGAATCTTAGAACTAAGGG - Intergenic
1065257059 10:23880804-23880826 ATGGGGAAACATAGAATTGATGG + Intronic
1069936267 10:71919380-71919402 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1072759121 10:98041359-98041381 ATGGGGAAATCTAGACCACAAGG + Intergenic
1072832876 10:98677596-98677618 ATGGGGAAACTGAGCTCTGAAGG + Intronic
1073187304 10:101623976-101623998 ATGAGGAATTTTTGTGCTGATGG + Intronic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1077005067 11:351099-351121 AAGGGGAACCTGAGAGCTGATGG - Intergenic
1078205605 11:9226746-9226768 ATGGGGAAATTTTCACCTTAAGG - Intronic
1078706621 11:13749702-13749724 ATGGGAAGATCTAGGGCTGAAGG - Intergenic
1078902738 11:15656431-15656453 ATGGGGACAATTATACCTGATGG - Intergenic
1079271990 11:18996589-18996611 AGAGGGAAATTTAGAGCTATAGG - Intergenic
1080794348 11:35549726-35549748 ATGAGGAAATTTACATCTCAAGG - Intergenic
1083001657 11:59297843-59297865 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1083423743 11:62571792-62571814 ATGGGAGAATTTGGAGGTGAGGG - Intronic
1084004319 11:66315111-66315133 ATGGGGATGTGTAGGGCTGATGG + Exonic
1084077082 11:66787770-66787792 ATGAACTAATTTAGAGCTGAAGG - Intronic
1086318154 11:85614808-85614830 ATGGGGAAATTTTAGACTGAGGG + Intronic
1087658328 11:100954449-100954471 AAGCAGAAATTTAGAGCTGTTGG - Intronic
1089043710 11:115480494-115480516 TCATGGAAATTTAGAGCTGAAGG - Intronic
1091392652 12:135235-135257 AAGGGGAAATGTAGAGAGGAAGG - Intronic
1092878308 12:12867692-12867714 AAGGGTAAATTTGGGGCTGAGGG - Intergenic
1093552194 12:20426941-20426963 ATGGTTAAAATTAGACCTGATGG + Intronic
1094070225 12:26404627-26404649 ATAGGGAAATTTGGTACTGAAGG + Intronic
1094100199 12:26753425-26753447 AGGGGAAACTTGAGAGCTGATGG + Intronic
1094368258 12:29707053-29707075 ATGGGGACAGTCAGACCTGATGG + Intronic
1094594122 12:31848372-31848394 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1094603416 12:31930366-31930388 ATAGGAAAATTTTGAGCTGAAGG - Intergenic
1095799462 12:46257129-46257151 AGGGGAAACTTGAGAGCTGATGG - Intronic
1097254071 12:57658910-57658932 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1097285990 12:57877871-57877893 ATGGGAAAATCTGGAGCTGTTGG + Intergenic
1098089319 12:66884152-66884174 ATGGGGAAATGCAGAGCAAAAGG + Intergenic
1098461235 12:70735166-70735188 ATGGGGATGTCCAGAGCTGAGGG - Intronic
1098502228 12:71206467-71206489 AGGGGAAACTTGAGAGCTGATGG + Intronic
1100712188 12:97269364-97269386 ATGGGGAAAAATACAGCTGCTGG - Intergenic
1100894275 12:99161750-99161772 CTGGAGCAATTTATAGCTGACGG + Intronic
1100969282 12:100050262-100050284 ATGGGGAAATTGACATCCGAGGG - Exonic
1102296789 12:111743337-111743359 CTGGGGAAATTTCCAGATGATGG + Intronic
1102721061 12:115016617-115016639 ATGGAGAAACTGAGACCTGAGGG + Intergenic
1105778315 13:23682845-23682867 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1106961886 13:35008674-35008696 ATGAGGAAATTGGGAGATGAGGG - Intronic
1108971080 13:56378006-56378028 ATGGGGAAAAATTAAGCTGAAGG + Intergenic
1108979014 13:56486392-56486414 AAGGGGTAATTTTCAGCTGATGG + Intergenic
1109201086 13:59431905-59431927 ATGAGAAAATCTAGAGGTGATGG - Intergenic
1110105591 13:71671636-71671658 GTGGGAAAATTTACAGCTGATGG + Intronic
1110802344 13:79713545-79713567 GTGGGGAATGTTAGAGCTGAAGG - Intergenic
1111818656 13:93187016-93187038 ATGGGTAAATTTGTAGGTGATGG + Intergenic
1114325862 14:21588122-21588144 ATGAAAAAATTTTGAGCTGATGG + Intergenic
1114790170 14:25649443-25649465 AGGGGGAAACTTGAAGCTGATGG - Intergenic
1114904537 14:27109784-27109806 ATGGGGAAATTTTGAACAAAGGG - Intergenic
1115121417 14:29941949-29941971 AAGGGGAAATGTGGGGCTGAGGG + Intronic
1117450002 14:55840710-55840732 ATGGGGAAATTTTTTGCTGGGGG + Intergenic
1118353610 14:64992220-64992242 ATGGGGAAATTTTGATATGCAGG - Intronic
1119553522 14:75535551-75535573 ATGGCCAAATAGAGAGCTGAAGG + Intronic
1121589375 14:95090586-95090608 AAGGGGAAATTTAAAGGTGTTGG - Exonic
1121610647 14:95276454-95276476 AGGGGGAACTTGGGAGCTGATGG + Intronic
1122174258 14:99905562-99905584 AGGGGAAATTTAAGAGCTGACGG - Intronic
1122864665 14:104598123-104598145 ATGGAGCAATTCAGAGATGATGG - Intronic
1123779904 15:23615932-23615954 ATGCGGAAAGTTATTGCTGATGG - Intronic
1126433542 15:48612295-48612317 ATGGGGAAATTTAGAGCTGAAGG - Intronic
1126438039 15:48656077-48656099 ATGGGGAAATTAAGGTCTGAGGG - Intergenic
1126726397 15:51636713-51636735 AGGGGAAAATAGAGAGCTGATGG - Intergenic
1127598668 15:60512964-60512986 GTGGTTAAATTTATAGCTGATGG + Intronic
1132174461 15:99699422-99699444 ATAGGGAATTTTTGAGGTGATGG + Intronic
1133222669 16:4325492-4325514 ATGGGGAAACTGAGGGCTGAAGG - Intronic
1134837298 16:17372003-17372025 ATGGGGCAACTTAGAACAGAGGG - Intronic
1135055033 16:19224782-19224804 TTGGGGAACTTTGAAGCTGAAGG - Exonic
1135790502 16:25389954-25389976 ATGGAGAAAATTAGAGTTTAAGG - Intergenic
1136131295 16:28223437-28223459 ATGGGGGAATAAAAAGCTGATGG - Intergenic
1136994789 16:35182130-35182152 ATGGGGAAATTTACAACTTAGGG - Intergenic
1138520056 16:57565935-57565957 ATGGTGAAATTTAGAGTGCAGGG - Intronic
1140856306 16:78980880-78980902 GTGGGTAAATGTAGAGGTGATGG + Intronic
1141209050 16:81959155-81959177 ATGAGTGAATTTACAGCTGATGG + Exonic
1143932338 17:10442471-10442493 ATGGTCAAAATTAGAGATGATGG - Intergenic
1145114704 17:20198454-20198476 AGGGGAAACTTAAGAGCTGATGG - Intronic
1145833801 17:27938615-27938637 GTGGGGTAAGTGAGAGCTGAAGG - Intergenic
1146732644 17:35207640-35207662 ATGGGGAAATGGGGAGGTGATGG + Intergenic
1146734346 17:35224894-35224916 ATGGGGAAGTTTAGAACAGATGG - Intergenic
1149224493 17:54453648-54453670 AAGGGGAAATTGAGAGCTGATGG + Intergenic
1149987816 17:61361142-61361164 ATGGGGAAATTAAGACCTAGAGG + Intronic
1153558704 18:6347172-6347194 AGGGGGAAATTGGGAGGTGATGG + Intronic
1155791323 18:29974116-29974138 ATGGGGAAATGAATAGCAGAAGG + Intergenic
1156330048 18:36112747-36112769 TTTGGGAAATTTAGACCTCATGG - Intronic
1157337961 18:46755314-46755336 ATGGGGAAGTTTAGAGAAGAAGG + Intronic
1158403658 18:57142598-57142620 AGGGGGACATTCAGGGCTGATGG + Intergenic
1161651993 19:5491321-5491343 CTGGGGAAATCATGAGCTGAAGG - Intergenic
1163490448 19:17614590-17614612 AAGGGGAAAGTCAGAGGTGAGGG + Intronic
1163605263 19:18271501-18271523 ATGTGGTACTTTAGGGCTGAGGG + Intronic
1164875630 19:31684709-31684731 AAGGGAAAATTTAGGGCTGGAGG - Intergenic
1165444675 19:35850315-35850337 ATGGGGAAAATTAGGGGTCAAGG + Intronic
1167603116 19:50465981-50466003 ATGGGGACATTCTGAGCTGCTGG - Intronic
1168548962 19:57277734-57277756 AGGGGAAACTTGAGAGCTGACGG - Intergenic
925776590 2:7341874-7341896 ATAGGAAAATTTCAAGCTGAAGG - Intergenic
928919991 2:36516856-36516878 ATGAGGAAACTGAGAGCTCAGGG - Intronic
929944809 2:46362233-46362255 AAGGGGAAACTGAGATCTGAGGG - Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931155765 2:59627144-59627166 CTGGTGACATTTAGAGTTGAGGG - Intergenic
931277935 2:60760582-60760604 AAGGGAAAATTTAAAGATGAAGG + Intronic
931612667 2:64120259-64120281 ATGGGGAAATTTGGAGTAGCAGG - Intronic
931965926 2:67534553-67534575 ATGGGCAAATTTTGAGGGGAAGG - Intergenic
933831681 2:86216162-86216184 ATGGGAACATGTAGAGCTGCTGG - Exonic
934684901 2:96313815-96313837 ATGGGCAATCTTTGAGCTGATGG + Intergenic
934888732 2:98047380-98047402 AGGGGAAACTTAAGAGCTGATGG + Intergenic
937354181 2:121187741-121187763 AGGGGGAAATTGAGGGCAGAGGG - Intergenic
937808533 2:126173182-126173204 ATAGAGAATTTTAGAGCAGATGG + Intergenic
938574280 2:132589317-132589339 ATGGGAGACTTGAGAGCTGAGGG - Intronic
939185057 2:138850800-138850822 ATGGAGAAATATGGAGCTCAGGG - Intergenic
939197472 2:138990644-138990666 AGGGGAAACTTGAGAGCTGATGG + Intergenic
939650387 2:144755187-144755209 AGGGGGAATTTTAGTGATGATGG - Intergenic
940180636 2:150928498-150928520 ATGGGGAAATGAAGAAATGATGG + Intergenic
942374275 2:175320827-175320849 ATGGGAAAATTTAGTGCTTAGGG - Intergenic
944095756 2:195966084-195966106 AGGGGGAAATTTATAGCTATAGG - Intronic
944594329 2:201247421-201247443 CTGGGGAAATGTGGAGCTGAGGG - Intronic
945199191 2:207264473-207264495 CAAGGGAAATTTACAGCTGAGGG - Intergenic
945227001 2:207541839-207541861 ATGGGGAGATTAAGAGGTGATGG - Intronic
946981704 2:225224262-225224284 ATGGAGAAACACAGAGCTGAAGG + Intergenic
947356156 2:229297942-229297964 ATAGGGAAATTGAGGCCTGAGGG - Intergenic
947569020 2:231216465-231216487 AGGGGGAAATTTAGGGTGGATGG + Intronic
947755931 2:232565214-232565236 AAGGGAAGATTTAGAGATGATGG - Intronic
1171956056 20:31464680-31464702 ATGGGGAAATTTTGGGAGGAAGG - Intergenic
1173372038 20:42445224-42445246 ATGAGGAAATTGAGTGCAGAGGG - Intronic
1175314753 20:58039590-58039612 AAGGGGGATTTTAGAGCCGATGG - Intergenic
1177125933 21:17192867-17192889 AGAGGGAAAATTAGATCTGAGGG + Intergenic
1178201737 21:30414725-30414747 AGGGGAAACTTGAGAGCTGATGG + Intronic
1178725070 21:35044194-35044216 CTGGGCAAAGTTAGAGCTGCAGG - Intronic
1179524022 21:41964079-41964101 CTGGGGAGATTTAGAGAGGAAGG - Intergenic
1182378833 22:29869992-29870014 ATGGGGAAATGTAGCTCTAAAGG - Intergenic
1185415358 22:50706321-50706343 ATGGGGAAATTTGGTGCTTGTGG + Intergenic
949471364 3:4400241-4400263 ATGGGGAAATTTCAGGGTGAGGG - Intronic
949962988 3:9329752-9329774 AGGGGAAACTTGAGAGCTGATGG - Intronic
950316556 3:12005906-12005928 ATGGTGAAATTGATAGGTGAAGG + Intronic
950326435 3:12114658-12114680 ATGGTGAAGTTGAGAGTTGAAGG - Intronic
950648681 3:14393681-14393703 CTGGGGTCATCTAGAGCTGAGGG + Intergenic
951186891 3:19723730-19723752 AGGGGAAACTTGAGAGCTGATGG + Intergenic
953153286 3:40344552-40344574 AGGGGAAACTTGAGAGCTGATGG + Intergenic
954562310 3:51567975-51567997 ATGGGGACATTTGGATGTGAAGG + Intronic
955007346 3:54982060-54982082 AAGGGAAACTTGAGAGCTGATGG - Intronic
955122096 3:56070923-56070945 ATGGCTAAATTGAGAGATGAGGG - Intronic
955542260 3:59989750-59989772 ATGTGGAAATTTACAGGGGAAGG - Intronic
958217372 3:90605057-90605079 AAGTGGATATTTAGAGCTGTTGG - Intergenic
959450651 3:106495537-106495559 ATGGGGAAAGTTAGGGCAAATGG - Intergenic
959839220 3:110954852-110954874 AAGGGGAAAATCAGAGATGAGGG - Intergenic
960056058 3:113277321-113277343 TTGGTGAAATGCAGAGCTGAAGG + Intronic
961310108 3:125991342-125991364 ATGAGGAAATTGAGGGCTGGAGG + Intergenic
961830301 3:129619780-129619802 ATGGGGAAATTGAGGCCTGGCGG - Intergenic
963415458 3:144990271-144990293 ATGAGGAAATTCAGAGCTCAAGG + Intergenic
965588646 3:170342135-170342157 AGGGGAAACTTGAGAGCTGATGG - Intergenic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970712096 4:18875908-18875930 ATGGGAAATTTGAGAGCTGATGG - Intergenic
973078321 4:45958896-45958918 ATGGCAAAACTTAGAGCTCAGGG + Intergenic
973685789 4:53368236-53368258 ATGGAGCAATTTAGCGCAGAGGG + Intergenic
973814276 4:54604410-54604432 AGGGGAAACTTTAGAGATGATGG - Intergenic
974356222 4:60816096-60816118 ATGAGGAAATTTTTGGCTGAGGG - Intergenic
974925814 4:68296365-68296387 AGTGGAAAATTCAGAGCTGATGG - Intergenic
976045048 4:80936486-80936508 ATGGGAACATATAGAGCTGGAGG + Intronic
976700071 4:87960077-87960099 AGGGGAAACTTGAGAGCTGATGG + Intergenic
977047939 4:92090657-92090679 AGGGGAAACTTGAGAGCTGATGG - Intergenic
977391662 4:96417326-96417348 ATGGGGAAATTAAGGCTTGAAGG + Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978697231 4:111596866-111596888 ATGAGGAAAGTGAGAGATGACGG + Intergenic
979143779 4:117214504-117214526 ATGGGGAAATTTTGATCGAAGGG - Intergenic
980172049 4:129301729-129301751 ATGAGGGAACTTTGAGCTGATGG - Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
981350328 4:143721938-143721960 ATGAGGAAATGTAGAGTTGGTGG + Intergenic
982030308 4:151293947-151293969 AAGGGTAAATTGAGATCTGAAGG - Intronic
982044135 4:151425004-151425026 ATGGGGAACTTTATAGCTGATGG + Intronic
982433060 4:155345584-155345606 ATGGGGAAATGTAGGGCTCATGG + Exonic
983763730 4:171449725-171449747 ATAAGGAAAGTTAGAACTGAAGG - Intergenic
987918329 5:24245764-24245786 ATGAGGAAATTTGGTGATGATGG - Intergenic
988503892 5:31805368-31805390 GTGGGAAAATTTAGCACTGAAGG - Intronic
989703964 5:44305584-44305606 ATGGGAAAAAATAGAACTGAAGG + Intronic
990695213 5:58408797-58408819 CTGGGGAAATTTGGAGCCCACGG + Intergenic
991565068 5:67996789-67996811 ATGGGGAACTCAAGAGCCGACGG + Intergenic
991583194 5:68177781-68177803 AGAGGTAAATTTTGAGCTGATGG + Intergenic
992028681 5:72698172-72698194 ATGTGGAAATCTAAATCTGAGGG - Intergenic
992893966 5:81231383-81231405 GTGGCAACATTTAGAGCTGATGG + Intergenic
994337138 5:98580404-98580426 ATGAGGAAATTTAGATTTAAAGG + Intergenic
994483205 5:100362030-100362052 AAAGGTAAATTTTGAGCTGAAGG - Intergenic
994676787 5:102833225-102833247 TTGGGGAAATTTAGAGGCCATGG + Intronic
995895404 5:117005396-117005418 AGGGGAAACTTGAGAGCTGATGG - Intergenic
996057940 5:119001080-119001102 GGGGGAAACTTTAGAGCTGACGG - Intergenic
996165987 5:120224474-120224496 ATTGGAAAATTTAGAGGAGATGG - Intergenic
996270164 5:121595306-121595328 ATGGGGAAGTTTAGAGCTATTGG - Intergenic
996618451 5:125470148-125470170 CTGGGGATATTTTGAGCTGTTGG + Intergenic
997210024 5:132071783-132071805 AGGGGGAAGTCCAGAGCTGAGGG - Intergenic
998051796 5:139042074-139042096 GTAGAGAAATTTAGAGCTGGAGG + Intronic
998749251 5:145299476-145299498 ATGAGGAAAATCAAAGCTGAAGG - Intergenic
998781669 5:145663760-145663782 ATGAGGAAATTTAGAGATGCTGG - Intronic
999105419 5:149066584-149066606 ATGGAGAAGTTAAAAGCTGAAGG + Intergenic
1000272268 5:159697247-159697269 ATGTTGAGAATTAGAGCTGATGG + Intergenic
1000842633 5:166240396-166240418 ATGCAGAAATTTAGTGCTGAGGG + Intergenic
1001424434 5:171614288-171614310 AGGGGGAAATTTGTGGCTGAAGG + Intergenic
1002195813 5:177500669-177500691 ATGGGGAAAAATAAAGCAGAGGG - Intergenic
1002539347 5:179895646-179895668 ATGTGTACATTTTGAGCTGAGGG - Intronic
1002586657 5:180252959-180252981 ATGTGGAGAAGTAGAGCTGAGGG + Intronic
1003002505 6:2349241-2349263 ATGGGGCAATGTAGGGTTGAGGG + Intergenic
1004588412 6:17025562-17025584 AAGGGGAAATATGGAGTTGAAGG + Intergenic
1005598078 6:27398314-27398336 ATGAGGAAATTTAGAGTCCAGGG + Intronic
1007353238 6:41291037-41291059 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1008548792 6:52607388-52607410 AAGGGGAAATTAAGACCTGGGGG - Intergenic
1009530464 6:64806736-64806758 AAAGGGAAATTTGGAGCTGGAGG + Intronic
1009572966 6:65413029-65413051 CTGGGGAAATTGAGAAGTGATGG - Intronic
1010024161 6:71196524-71196546 ATGTGGAAATTTAGAGGAAAGGG - Intergenic
1010118429 6:72342894-72342916 ATGGGGATATTGAAAGCTGAAGG + Intronic
1010275446 6:73963420-73963442 AAGGGGAAAAATAGAGATGAGGG + Intergenic
1010466167 6:76168776-76168798 ATGATAAAAATTAGAGCTGAAGG + Intergenic
1010736610 6:79450722-79450744 ACGGGGAATTTTATTGCTGATGG - Intergenic
1012397875 6:98820881-98820903 AGGGGGAAATTTAGAGCTGAAGG - Intergenic
1012610049 6:101206341-101206363 AAGGGGAAAAATAGAGCAGAGGG - Intergenic
1012936420 6:105372521-105372543 CTGGGAAAATTTAGAAGTGAAGG + Intronic
1014316993 6:119880199-119880221 ATGGGGAAATTTGTACCTAAAGG + Intergenic
1015890298 6:137963644-137963666 ATGGATAAATTTGGAGCTGCAGG + Intergenic
1016345020 6:143104089-143104111 ATCAGCAAATTTAGAGGTGAGGG + Intronic
1016789339 6:148051659-148051681 TTGATGAACTTTAGAGCTGATGG + Intergenic
1016791115 6:148067860-148067882 ATGGGGAAACTGGGAGGTGAGGG - Intergenic
1017297892 6:152820157-152820179 TTGTGGAAAGCTAGAGCTGAAGG - Intergenic
1017726750 6:157281637-157281659 AAGAGCAAAATTAGAGCTGATGG + Intergenic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1021433073 7:20583723-20583745 ATGGGAAATTTTTGTGCTGAGGG + Intergenic
1021743189 7:23709541-23709563 ATGAGGAAACTTTGAGGTGATGG + Intergenic
1023588740 7:41758897-41758919 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1025768640 7:64482747-64482769 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1027026068 7:74852422-74852444 CTGGGCAAAGTTAGAGCTGCCGG - Intergenic
1027061688 7:75091688-75091710 CTGGGCAAAGTTAGAGCTGCCGG + Intergenic
1027782156 7:82533245-82533267 CTGGGGAAATTTGGAGACGAAGG - Intergenic
1029811191 7:103050760-103050782 AGGGGAAACTTGAGAGCTGATGG - Intronic
1030134755 7:106236094-106236116 ATGGGGAAATAAAGAGCAGATGG - Intergenic
1030189921 7:106800642-106800664 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1030543829 7:110867658-110867680 AAGGTGAAATCTAGAGATGAGGG - Intronic
1030757519 7:113306624-113306646 ATAGAGAAATTAAGAGCTGTGGG - Intergenic
1031304937 7:120114450-120114472 AAGGGAAACTTGAGAGCTGATGG + Intergenic
1031500377 7:122507268-122507290 ATGGGGAAAATAAAAGCTGTAGG + Intronic
1031848849 7:126839018-126839040 ATTGGGAAATTTCAGGCTGAAGG - Intronic
1034186500 7:149181818-149181840 ATGGGAAAATTTAGGGGTGCTGG + Intronic
1035634386 8:1132962-1132984 AGGGAGAAATTTAGAGCAAAGGG + Intergenic
1040346153 8:46498262-46498284 ATGGGGCAATTAGGAGCTCAAGG - Intergenic
1041774294 8:61507367-61507389 ATGGGGAAAGTGAGTGCTGTCGG + Intronic
1041880335 8:62742480-62742502 ATGAGGATTTTTTGAGCTGAAGG - Intronic
1045500766 8:102742862-102742884 ATGGGGAATATGAGATCTGAAGG + Intergenic
1047141665 8:122147778-122147800 ATGGGGAAAGGTAGAGTTCAGGG - Intergenic
1048618489 8:136105789-136105811 ATGGAGAAATTGAGAGTTGAAGG + Intergenic
1050250295 9:3736312-3736334 ATGGGGAACTGAATAGCTGAAGG + Intergenic
1050860134 9:10418510-10418532 ATGGAGAAAATTACAGCAGAAGG - Intronic
1051121931 9:13761055-13761077 AAGGGGAAATTGAGATATGAAGG + Intergenic
1051177985 9:14380312-14380334 AAAGGGGAATTCAGAGCTGAGGG + Intronic
1051224921 9:14889192-14889214 ATGTGGAATTGTAAAGCTGAAGG + Intronic
1051225317 9:14892682-14892704 AGGGGAAACTTGAGAGCTGATGG + Intronic
1052802235 9:32979610-32979632 ATGTGCAAATGTAGTGCTGATGG - Intronic
1053913542 9:42928464-42928486 ATGGGGAAAGTTAGAGGTGGGGG + Intergenic
1054796399 9:69306466-69306488 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1055328623 9:75159034-75159056 AGGAGGAAATTTAGAACTGAGGG + Intergenic
1055927592 9:81526558-81526580 CTGGGGAATTTTAGAGTAGAGGG - Intergenic
1056061874 9:82891635-82891657 ATGGGGATAAGTAGAGCAGATGG - Intergenic
1056510282 9:87298132-87298154 ATAGGGGAATTTAGGGCAGAGGG + Intergenic
1056677505 9:88687654-88687676 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1056726819 9:89126516-89126538 AGGGGAAACTTGAGAGCTGATGG + Intronic
1058974978 9:110117483-110117505 ATGGGGAAACTCAGTGCTAAAGG - Intronic
1060354025 9:122887073-122887095 CTGGGGAAATTTATAGCAGATGG - Intronic
1060681422 9:125568365-125568387 AGGGGAAACTTGAGAGCTGATGG + Intronic
1185479572 X:435837-435859 CTGGGAAAATGCAGAGCTGAGGG + Intergenic
1187368122 X:18681275-18681297 ATGTAGAAATTTAGTGCTGCAGG - Intronic
1187558971 X:20382056-20382078 ATGGGGAGATTTTGAGCAGAAGG - Intergenic
1187869086 X:23749564-23749586 ATTGGGAAAGCTAGAGGTGAGGG - Intronic
1189627440 X:42914185-42914207 ATGAGGAAACTAAGATCTGAGGG + Intergenic
1190137824 X:47813417-47813439 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1190520282 X:51272291-51272313 AAGGGTAGATTTGGAGCTGAAGG - Intergenic
1190912791 X:54788019-54788041 ATGTGGAAACTCAGAACTGAAGG + Intronic
1190962590 X:55267237-55267259 AGGGGAAACTTGAGAGCTGATGG + Intronic
1192495162 X:71611636-71611658 ATGGTGAAATTGAGATCTCAGGG - Intronic
1192864634 X:75117738-75117760 AGGGGAAACTTGAGAGCTGATGG + Intronic
1192888472 X:75362701-75362723 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1193000181 X:76554802-76554824 ATGGGGACTTTTGGAGGTGATGG + Intergenic
1193775475 X:85635852-85635874 AAAGGGAAATTTAGAAATGACGG + Intergenic
1195375175 X:104219587-104219609 ATGGGCAAATTTAGGCCAGAGGG - Intergenic
1195559094 X:106262903-106262925 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1196861909 X:120036599-120036621 AAGGAGAAATTAAGAGCTGCTGG - Intergenic
1198055479 X:132990621-132990643 CTGGGCCATTTTAGAGCTGAGGG - Intergenic
1198498175 X:137214921-137214943 AGGGGAAACTTGAGAGCTGATGG + Intergenic
1198812811 X:140552766-140552788 ATGGGGAAATTTATAACTGATGG - Intergenic
1198844836 X:140899794-140899816 AGGGGAAACTTGAGAGCTGATGG - Intergenic
1199247843 X:145627022-145627044 AAGGGGAAAATCAGAGCTAATGG + Intergenic
1199774279 X:150997172-150997194 ATGGGAGAATTTACAGATGAGGG - Intergenic
1199797202 X:151211525-151211547 ATGATGAATTTTTGAGCTGATGG + Intergenic
1200108861 X:153728889-153728911 GGGGGGGAAATTAGAGCTGATGG + Intronic